Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 09 Aug 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 572.0    0Xt7.1-XZG22687.3.5                         27 PI      82        200      823                Brachyury-like T-box transcription factor [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012072432 Xt7.1-TNeu097o03.3.5 - 101 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 4     5    12    13    14    14    16    17    16    17    17    18    18    19    19    20    20    21    20    21    20    21    20    21    20    21    22    23    22    23    23    24    23    24    23    24    23    24    25    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    25    26    25    28    26    29    26    30    26    30    26    30    26    30    26    30    27    31    27    30    28    31    28    31    28    31    28    31    28    31    28    32    29    32    29    32    28    31    28    31    29    32    27    30    27    30    27    30    26    29    26    29    27    30    25    28    25    28    25    28    25    29    25    29    25    29    25    29    22    27    22    27    21    28    23    28    22    28    22    27    22    27    21    27    20    26    19    25    15    24    13    22    13    22    12    21    12    21    13    21    13    21    12    19    11    18    10    17    10    17    10    16    10    16    10    16    10    16    10    16    10    16    10    15    10    15    10    14    10    14    11    15    11    15    11    15    12    15    12    15    12    15    12    15    12    15    13    16    13    16    12    16    12    16    13    17    13    17    13    17    13    16    13    15    13    15    14    16    14    16    13    15    13    16    13    15    13    15    13    15    16    19    16    19    17    21    20    23    20    24    20    26    21    30    23    32    25    35    21    32    22    32    22    32    22    34    22    36    21    37    24    39    25    40    25    40    24    39    25    39    25    39    38    41    35    41    35    40    37    43    38    44    37    43    37    44    36    43    35    42    37    42    40    45    40    46    42    47    43    48    42    48    43    48    42    48    41    48    42    49    44    50    44    49    43    49    44    50    44    49    44    49    43    49    42    49    42    49    42    49    44    48    44    48    43    48    42    46    39    46    43    47    43    47    42    46    43    47    35    46    40    46    39    46    39    46    38    45    41    45    37    43    33    41    32    41    34    41    33    38    30    38    28    37    11    15    10    12    10    12     9    11     9    11     9    11     8    11     9    11     8    10     7    10     8    10     8    10     8    10     8    10     8    10     7    10     8    10     6     7     3     4
  5   1   2  SIG                                      Xt7.1-XZG60160.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCAGGCAGAGTATGGCAGGTTTTTGCTGTACTACAACCATTAATATGGGTATGGTCATGTGATAACATGGGTGTGGTTTCAAGTGGGTGCGGTTTCAAAAAGGGGAGTGGTCAAAACTGGCTTCCATTATCGGCCCTCCACCACGTAGGTCGGAAAAATTCCGGCCCTCGGTACAACAGAAGTTGGACAGCACTGACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACTGTAGATATCCATTTCTAAGTATGGCCACTTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGCTTCTCTAATTTGTTATAGCATATTTCTTATCCTTTGTTAAATATATCAATCAGGAGATTCATCGCATCCCTACTACTGTTGCACTTTTATAGGCGTATTTATTATATTAACACTGTTTGTGAAGAAAATAAGATTAGTTTGTAACTGCTTATTAAGTAGGAAAGCTAGTCAGCCTTATTTTATAGCTGACTTGAAAGACAAGTATTTTTTACTTTTATTCATTCCTGAAACATAATATTCCTGCTCACTTTTTAAAATGTAACAGAAATGAGTATGAATTAAGTTTTGTGACTTGATTGGTTAGATTAGATGTCCAGGAATTGCTCTAGGGCAGACTGAAGTGTTATTGCCATTAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTAATAATGGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAGAGTATGGCAGGTTTTTGCTGTACTACAACCATTAATATGGGTATGGTCATGTGATAACATGGGTGTGGTTTCAAGTGGGTGCGGTTTCAAAAAGGGGAGTGGTCAAAACTGGCTTCCATTATCGGCCCTCCACCACGTAGGTCGGAAAAATTCCGGCCCTCGGTACAACAGAAGTTGGACAGCACTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACTGGTATTGCTGTATTTATTTTTTCCATGTGACT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTGTGGTAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTAAATATGTTATTGTATGCTGTAAGACAATCAGAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------A-
                                               BLH ATG     148    1870                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               BLH MIN     148     293                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               BLH OVR     148      48                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               EST CLI      -4      21                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               ORF LNG     148       4                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 9e-051     NP_498088.1 T BoX family member (47.0 kD) (tbx-2) [Caenorhabditis elegans] --------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 2e-081     BAE06334.1 transcription factor protein [Ciona intestinalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Cs ==== 1e-085     BAA92187.1 brachyury [Ciona savignyi] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 5e-090     NP_524031.1 CG7260-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Sp ---- 7e-113     XP_782140.2 PREDICTED: similar to transcription factor Brachyury [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Bb ---= 3e-147     AAP31567.1 T-box protein brachyury 2 [Branchiostoma belcheri] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Bf ---- 2e-150     CAA62999.1 AmBra-1 [Branchiostoma floridae] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Dr ---- 0          XP_689261.1 PREDICTED: similar to brachyury transcription factor [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 0          NP_033335.1 brachyury; brachyury-like 3; low ratio; brachyury-like 2 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 0          NP_003172.1 transcription factor T; T brachyury-like [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Gg ==== 0          NP_990271.1 brachyury (T) [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 0          AAA49663.1 brachyury (T) [Xenopus laevis]  ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === ?? ==== 0          NP_001084047.1 brachyury (T) [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 0          NP_001008139.1 MGC89607 protein [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu097o03.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAG------------------------------------TGA---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------TAA---------------------------------------------TAA---------------------TGA------------------TAA---------------------------------------------------------------------------TGA---------------------TAG------------TGATAA---------------------TAG---ATG---------------ATG---------------------------------------------------------TGA------------------------------------TAATAA------------------------------------------------------------------------------------TAG---------TAA------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGA---------------------------------------TAA------------ATG---TAA---------------------------------------------------TAA------------------------------------------------TAA---------------------------------TAA------------TAA------------------------------TAG------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  3   1   1         - Gas7      in                         XZG60906.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTAAGATCAGGGTCTCTCCACTTATTCTACCCACTGTAGATATCCATTTCTAAGTATGGCCACTTCTNTCAGACATCAAGGCTTCTCTAATTTGTTATAGCATATTTCTTATCCTTTGTTAAATATATCAATCAGGAGATTCATCGCATCCCTACTACTGTTGCACTTTTATAGGCGTATTTATTATATTAACACTGTTTGTGAAGAAAATAAGATTAGTTTGTAACTGCTTATTAAGTAGGAAAGCTAGTCAGCCTTATTTTATAGCTGACTTGAAAGACAAGTATTTTTTACTTTTATTCATTCCTGAAACATAATATTCCTGCTCACTTTTTAAAATGTAACAGAAATGAGTATGAATTAAGTTTTGTGACTTGATTGGTTAGATTAGATGTCCAGGAATTGCTCTAGGGCAGACTGAAGTGTTATTGCCATTAACTGCCTTACTATGTTAATAATGGCAGTTCAGTTAAGATATCCCATCAGTATAGTCCTTACCCTTATCTACATGGCTTATATCTACAGTCATTATATTCAATGAATAGAAAGCTAGATTAGATACCTGTATCTCTATACCCTTTCACTCTCTGTATTTCAATACAGACAGGTATATTGTGGCCCAGAATACAAATACATTTACTTTTACAACTTCTTTACTTCTGAATTGTCAGCTTTTACCAGGTACAGACAACTAGGCCACACAGAAATATTAATGTAATTGAACACAAAATGGAAGCTATAGCATATAGTGCATTTATT
  5   1   1         - Gas       out                  TGas077n14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTATTCTACCCACTGTAGATATCCATTTCTAAGTATGGCCACTTCTTTCAGACATCAAGGCTTCTCTAATTTGTTATAGCATATTTCTTATCCTTTGTTAAATATATCAATCAGGAGATTCATCGCATCCCTACTACTGTTGCACTTTTATAGGCGTATTTATTATATTAACACTGTTTGTGAAGAAAATAAGATTAGTTTGTAACTGCTTATTAAGTAGGAAAGCTAGTCAGCCTTATTTTATAGCTGACTTGAAAGACAAGTATTTTTTACTTTTATTCATTCCTGAAACATAATATTCCTGCTCACTTTTTAAAATGTAACAGAAATGAGTATGAATTAAGTTTTGTGACTTGATTGGTTAGATTAGATGTCCAGGAATTGCTCTAGGGCAGACTGAAGTGTTATTGCCATTAACTGCCTTACTATGTTAATAATGGCAGTTCAGTTAAGATATCCCATCAGTATAGTCCTTACCCTTATCTACATGGCTTATATCTACAGTCATTATATTCAATGAATAGAAAGCTAGATTAGATACCTGTATCTCTATACCCTTTCACTCTCTGTATTTCAATACAGACAGGTATATTGTGGCCCAGAATACAAATACATTTACTTTTACAACTTCTT
  5   1   3        nb Neu  5g                        TNeu049h06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTAATCAAGGACTCTTATTCCTCCAATGCCTTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTT
  5   1   3        nb Gas  FL   in                   TGas116l23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAATCAAGGACTCTTATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACACCACCGCTGGAAGTACGTGAATGGA
  5   1   3        nb Gas  5g                        TGas020f02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCGGGCTTATTCCTCCAATGCCATTTGNGATTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTNTGGAGCCCACTGGATGAAAGATCCTGTTTC
  5   1   3        nb Gas  5g                        TGas056e20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGACTCTTATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCATGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATG
  5   1   0       chi Gas7      in                         XZG60906.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGTAAGATCAGGGTCTCTCCACTTATTCTACCCACTGTAGATATCCATTTCTAAGTATGGCCACTTCTTTCAGACATCAAGGCTTCTCTAATTTGTTATAGCATATTTCTTATCCTTTGTTAAATATATCAATCAGGAGATTCATCGCATCCCTACTACTGTTGCACTTTTATAGGCGTATTTATTATATTAACACTGTTTGTGAAGAAAATAAGATTAGTTTGTAACTGCTTATTAAGTAGGAAAGCTAGTCAGCCTTATTTTATAGCTGACTTGAAAGACAAGTATTTTTTACTTTTATTCATTCCTGAAACATAATATTCCTGCTCACTTTTTAAAATGTAACAGAAATGAGTATGAATTAAGTTTTGTGACTTGATTGGTTAGATTAGATGTCCAGGAATTGCTCTAGGGCAGACTGAAGTGTTATTGCCATTAAACTGCCTACTATGTTAATAATGGCAGTTCAGTTA
  5   1   2       add Neu0 5g                            IMAGE:6993982                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAAGCATTTCTGGGATGCAAAAGNAAAGAAAATGATTTATTAAAGACATCCTTGAAATGANGGGTATTTGAATAGTCAACAACTCAAAATTTTCTCCTCAGCCGATACTTTGGGCTGAATT
  5   1   3   12   nb Gas7 5g3  in                         XZG62821.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACA
  5   1   3        nb Neu  5g                        TNeu024f07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTATTCCTCCATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTT
  5   1   3        nb Gas  5g                        TGas105l22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGGCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGA
  5   1   2       add Neu0 5g                            IMAGE:6994425                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTTAAATCAAACACAACCCCCTTTGCCAAAGCATTTCTGGGATGCAAAAAGAAAGAAATGATTTATAAGGACATCCTTGGGATGGAGGGGTATTGGATAGTTCAAACAACTCAAAATT
  5   1   3        nb Gas  5g                        TGas023e12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAA
  5   1   3   14   nb Gas6 5g3  in                          ANBT594.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGGCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTG
  5   1   3        nb Gas  5g                        TGas033b23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTT
  5   1   2   12  ext Gas7 5g3  in                         XZG44335.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGC
  5   1   3        nb Neu0 FL                            IMAGE:6995163                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTTGGATGAAGGTATTGATAGTCCACACTCAAAATTTCTCTCAACTAAGGTACTTGGGCTGATTCCCC
  5   1   3   12   nb Gas7 5g3  in                         XZG15236.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTGCCGATCATTCACACCGTTGGTTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTA
  5   1   3        nb Neu  5g3  in                   TNeu086l10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAA
  5   1   3   10   nb Ovi1 5g3  in                         CABI2014.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCGATTACATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCCAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCC
  5   1   2       add Gas1 5g                            IMAGE:6987547                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGGCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACCTGGGCTGATTCCCAACGTGGGATCTTTTATGTTCGCCCCATTCAAACACACAAGTTCGGGGGCGCCGGATTTCTCTATTCGTCTCCCTCATGGCTGGCAAGCGAAAACTCCTCCTCCTAAAAAACCACCGGGTTCGGGCTTTCCCTTACCCAAAGTTCCCATATGGTTTCAACAGAAAAACAAATTCCCCCCAAAACAA
  5   1   2       add Neu0 5g                            IMAGE:6993550                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGANGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGGATCTTTTATGTTCGCCCCAATCCACACACACAGGTTCGGGGGCGCCGAATTTTCTCCTATCG
  5   1   3        nb Gas1      in                     NISC_mq05e03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGATGTGGGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTA
  5   1   3        nb Gas1      in                     NISC_mq06g09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATACAGCACT
  5   1   3        nb Gas7                                 XZG50712.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGATTGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGANAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCATCCACACACACAGTTCGGGGGCGCCGATTTCTCTATCG
  5   1   2       ext Te5       in                         CAAO8385.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTA
  5   1   3        nb Gas                            TGas112n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTC
  5   1   3        nb Gas7      in                         XZG23392.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCCCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGC
  5   1   3        nb Gas7      in                          XZG5412.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGAT
  5   1   3        nb Gas7                                   XZG670.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGNGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCCTCATACTCATCTCTTTCACATGCTGTTC
  5   1   3        nb Gas7      in                         XZG62790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTG
  5   1   3        nb Gas7                                 XZG14617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATC
  5   1   2       add Gas7      in                         XZG57109.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCTCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAATTACCAAAAACACTGA
  5   1   3        nb Gas7      in                          XZG5196.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTCAGCACTTAAAATCAAACACAACCCCTTTGCCAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas7      in                          XZG5196.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACC
  3   1   3        nb Gas7      in                          XZG5412.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTCCC
  5   1   2       ext Ovi1      in                         CABI8149.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGGTGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCANAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCACAATCGTTATTACCTT
  5   1   2       ext Neu       in                   TNeu097o03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTGCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATC
  5   1   3        nb Gas7                                 XZG58355.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGGAACACCTCCTACCTCAAGTCAGTACTCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAA
  5   1   0       chi Gas7      in                          XZG4324.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGTTGATGAAAGCCTGGAATGTGCTGTGACGTCATACTGGTTTTCTGCTATTTCTGTTTGTGATCCATGTTCATACAATGGAGATCCTGTGGCTGGTGAGGGAACAGCATGTGAAAGAGATGAGTAATGAGGCGTAGAGCCGCGTAAGTACTGGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTtaggtcagtgctgtccaactggcggcccgcgggccgcatgcggcccgcggcccccctctgtgtgggcccccacctgtctggctgctttgatggcttaccttt
  5   1   3        nb Gas7      in                          XZG3330.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTC
  5   1   3        nb Gas7                                   XZG855.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGT
  5   1   3        nb Gas       in                   TGas106d03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTA
  5   1   3        nb Gas7      in                         XZG24521.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAA
  5   1   3        nb Gas                            TGas106p01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATGTAGGGAGAGACTGTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGCCCAACC
  3   1   2       ext Neu       in                    TNeu097o03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGGGAACAGAAAAAAAAAAAAAAAAAA
  5   1   2       add Tad5      in                         XZT48890.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGACGCGTGGGCAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTtaggtcagtgctgtccaactggcggcccgcgggccgcatgcggcccgcggcccccctctgtgtggccccccacctgtctggctgctttgatggcttacctttgtgtaagctttaaatggtatcagaactgtaattaactgcccccccccccctgcatggttctcacctcaaattcaggctgtaatcaggctgtattgtttaaatatgtaatcccctgtactgttcacaccttttaatccctggattgttcaccccctgaagtgttcaaaactca
  3   1   3        nb Gas  FL   in                    TGas116l23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATANAAAAAATACTGGGAACAGAAACAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Ovi1      in                         CABI8149.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTCGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAAGCCTC
  5   1   3        nb Gas                            TGas033k01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCA
  3   1   4      seed Gas  5g3  in                    TGas127g08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGGGAACAGAAAAAACAAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu  5g3  in                    TNeu086l10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATTCAGATAAAAAAATACTGGGAACAGAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Ovi1 5g3  in                         CABI2014.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAAC
  5   1   3        nb Gas8      in                          st79d23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTT
  5   1   3        nb Gas8      in                          st78d23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGT
  3   1   2       add Gas7      in                         XZG57109.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        tacaaccattaatatgggtatggtcatgtgataacatgggtgtggtttcaagtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACGG
  5   1   3        nb Neu                            TNeu060b06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCT
  5   1   2       ext Sto1      in                          CABG475.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATA
  3   1   2       ext Te5       in                         CAAO8385.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGCAAATTACCAAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAG
  3   1   3        nb Gas7      in                         XZG62790.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAACTTGAAGATGTTCTGGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGTTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGATTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAG
  3   1   2       add Tad5      in                         XZT48890.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        caaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATTTACTGTGTCAGACAAGCTATTATTTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGGCCGG
  3   1   2       add Gas7      in                          XZG4324.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        caaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGGGAAC
  3   1   3        nb Gas6 5g3  in                          ANBT594.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGTCCAACCAGGTGTGAGTGGTTTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTTTGCTTATTTTTTTTACAATCCCTATTTACTTCTATTTGGGACTGGTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATTTACTGTGTCAGACAAGTTATTATTTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTTTAAAACCCAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAAAGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACCGG
  3   1   3        nb Gas8      in                          st78d23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTA
  3   1   3        nb Gas8      in                          st79d23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATNTGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGNCTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATNGTGTAACTGGTATTGCTGNATTTATTTTTTCCATGTGACTTCCCATGTGATGTTTTTGTGGTAAATGTATNTGTGCTGCAAATATGTTAT
  3   1   2       ext Sto1      in                          CABG475.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTGTGAGTGGTCTGCACTGCAGCTCACTATCTGAGAAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCACNAATCGTTATTACCTTAGAATATGTTATGTNGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTAAAAAAAAA
  3   1   3        nb Gas7 5g3  in                         XZG62821.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTTTTTTACAATCCCTATTTACTTCTATTTGGGACTGGTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTTTTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGGGGTACTGTCTAGAGTCTAGGGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATTTACTGTGTCAGACAAGTTATTATTTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTTTAAAACCCAAAGGGAAAGTATCCTAATTCATTGGGTAACTGGTATTGCGGTATTTATTTTTTCCATGTGACTTCCATGGGATGTTTTTGTGGTAAAAGTATATGTGCGGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTG
  3   1   3        nb Neu                             TNeu103l12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATTTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTTTAAAACACAAAGAGAAAGTATCTTAATTCATTGGGAAACTGGTATGGCGGTATTTATTTTTTCCATGTGACTTCCATGTGAGGTTTTTGTGGTAAATGTATATGTGCGGTAAATATGTTATTGTATGCTGTAGGCCATTCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCGGAGTCCATATAATGTACAGATATAAGAAAACTTTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATA
  3   1   2       ext Gas7 5g3  in                         XZG44335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATATTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTACCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATATTAATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTAAAAAAAAAAAAAAAGG
  5   1   3        nb Gas                            TGas054e22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGAGAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACCG
  5   1   3        nb Gas                            TGas144c22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACATTCAGTTTTCTGAATGTGCTTGGCAAAGGGTAATTTACCCTGGAAGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTTGTATTAATAAGAAAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTTGCTGCTACAGGCTACATTGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGAACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAATATCCTAATTATTGTGTAACTGGTATTGCTGTATTTATT
  3   1   3        nb Gas7 5g3  in                         XZG15236.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTGAAGGGAATTTAAAGATGCGGGAAAACGGAAACTGTATTAATAAGAGAATCCCTTCTGGTTATTTCTTTTACAATCCCTATTTACTTCTATATGGGAGTGCTGCTACAGGCGACATGGTTTTTTTTTATAGACATATTTTTAATATGCCTTTTTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTGGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCGTTTACTGTGTCAGACAAGCTATTTTTTGCTGCCTAAATAACTGCAAACTGCCCCCAGCTAAATTGATTTTAAATATTGTTTTTAAAAAACAAAGAGAAAGTATCCTAATTCCTTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGAGGTTTTTGTGGTAAAAGTATATGTGCGGTAAATATGTTATTTTTTGCTGTAAGACAACCAGATAAAAAAATACT
  3   1   3        nb Gas7      in                          XZG3330.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATA
  3   1   3        nb Gas1      in                     NISC_mq06g09.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATTTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTTTAAAACCCAAAGAGAAAGTATCCTAATTCATTGGGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGCCAATCAGATAAAAAAATTCTGTGGACCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   3        nb Gas       in                    TGas106d03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTTAAGATGCAGGAAACGGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTAAAAAAAAAAAAAAA
  5   1   2       ext Gas7      in                         XZG27116.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATATTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTACCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATATTAATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTATTCACCAGAAAAAAAAAAAAAAAAAAAACAGAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG23392.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACCCAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGGGACTTCATGTGATGTTTTTGTGGTAAATGTATATGTGCGGTAAATATGTTATTGTATGCTGTAAGCCAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTCCATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCCCTAATGTGCAGTGTTATAAGGTATCACCCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCTT
  3   1   3        nb Gas7      in                         XZG24521.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTACATGGTTTTTTTTTATAGACATATTTTTAATATGCCTTTTTAAGGGAAAATAATTTAAAAGGCTTAAATAATTTAAAATGGGGTCCTGTCTAGAGTCTAGAGACTTTAGACTATGAAAAAATTTTTGCAGCAGAATTTGTTTGCATTTACTGTGTCAGACAAGTTTTTTTTTGCTGCCTAAATAACTGCAAACTGCCCCCAGCTAAATTGATTTTAAATATTGTTTTTAAAACCCAAAGGGAAAGTTTCCTAATTCATTGGGTAACGGGTATTGCGGTATTTTTTTTTTCCATGGGACTTCCATGGGAGGTTTTTGGGGTAAAGGTATATGGGCGGTAAATATGTTAT
  3   1   3        nb Gas1      in                     NISC_mq05e03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTAAAAAAAAAAAAAAAG
  3   1   2       ext Gas7      in                         XZG27116.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGCTGCCTAAATAACTGCAAACTGCCCCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGGGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAAAGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGCCAATCAGATAAAAAAATTCTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATATTTTCATAGAGAGATTCCATTATGCAGAGTCCATTTAATGTACAGATATAAGAAAACTCTCTTGTTACCCCTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGGGGTTCATTTTAATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTTTTCCCCGGaaaaaaaaaaaaaaaaaaaccggaaaaaaaaaaaaaaaaaaaaaCC
  5   1   3        nb Gas                            TGas126a18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAG
  5   1   4      seed Gas       in                   TGas127j16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGAATGGAAGGCGAATGTTTCCAGTTCTACGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATACTAATGGAATAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTCACATGCTGTTCC
  5   1   3        nb Gas7      in                         XZG40892.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGNGA
  5   1   3        nb Gas7      in                         XZG28772.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACCTCCCAGCACA
  5   1   2       ext Gas7                                  XZG9536.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACAGCACTTAAAATCAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAG
  3   1   4      seed Gas       in                    TGas127j16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGGGAACAGAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG28772.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCAGTGTTTCTGGGCTTGAGCTGCTGGGGGTNCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAAC
  3   1   3        nb Gas7      in                         XZG40892.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATTTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACCCAAAGGGAAAGTATCCTAATTCATTGGGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGGGATGTTTTTGTGGTAAAGGTATATGTGCGGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATAC
  5   1   2  SIG                                      Xt7.1-XZG60160.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCAGGCAGAGTATGGCAGGTTTTTGCTGTACTACAACCATTAATATGGGTATGGTCATGTGATAACATGGGTGTGGTTTCAAGTGGGTGCGGTTTCAAAAAGGGGAGTGGTCAAAACTGGCTTCCATTATCGGCCCTCCACCACGTAGGTCGGAAAAATTCCGGCCCTCGGTACAACAGAAGTTGGACAGCACTGACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAA
                                                  Xt7.1-CHK-1008279142                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGAGTATGGCAGGTTTTTGCTGTACTACAACCATTAATATGGGTATGGTCATGTGATAACATGGGTGTGGTTTCAAGTGGGTGCGGTTTCAAAAAGGGGAGTGGTCAAAACTGGCTTCCATTATCGGCCCTCCACCACGTAGGTCGGAAAAATTCCGGCCCTCGGTACAACAGAAGTTGGACAGCACTGACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACT
  5   1   4      seed Gas7      in                          XZG7164.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGACTCCCCCACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAG
  5   1   2       ext Gas7      in                         XZG63674.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ggaaggcagagtatggcacacacaaaggcagggtagggcaggcagagtatggcaggtttttgctgtactacaaccattaatatgggtatggtcatgtgataacatgggtgtggtttcaagtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTG
  3   1   2       ext Gas7      in                         XZG63674.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             agncagggtagggcaggcagagtatggcaggtttttgctgtactacacccattaatatgggtatggtcatgtgataacatgggtgtggtttcaagtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAATACTGTGGGCCGG
  5   1   3        nb Gas7      in                         XZG19597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ggcaggcagagtatggcaggtttttgctgtactacaaccattaatatgggtatggtcatgtgataacatgggtgtggtttcaagtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAA
  3   1   2       ext Gas7      in                         XZG60160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCgcaggtttttgctgtactacacccattaatatgggtatggtcatgtgataacatgggtgtggtttcaagtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACGG
  5   1   2       ext Gas7      in                         XZG17712.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        caggtttttgctgtactacaaccattaatatgggtatggtcatgtgataacatgggtgtggtttcaagtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTG
  5   1   2       ext Gas7      in                         XZG60160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        caggtttttgctgtactacaaccattaatatgggtatggtcatgtgataacatgggtgtggtttcaagtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGT
  3   1   3        nb Gas7      ?                          XZG22119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           gtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGG
  3   1   4      seed Gas7      in                          XZG7164.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           gtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAATATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGGGAACAG
  5   1   3        nb Gas7                                 XZG18702.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTANATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCA
  3   1   3        nb Gas7      in                         XZG19597.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTTCCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTTTTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGGGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATTTACTGTGTCAGACAAGCTATTTTTTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGGGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGGGATGTTTTTGTGGTAAATGTATATGGGCGGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATAC
  3   1   2       ext Gas7      in                         XZG17712.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAAAGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATATTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTACCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATATTAATTTTTTGGCAATAAAGTGCAGTGTCATAAGGT

In case of problems mail me! (