Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 572.0    0Xt7.1-XZG22687.3.5                         27 PI      82        200      823                Brachyury-like T-box transcription factor [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012072432 Xt7.1-TNeu097o03.3.5 - 101 ESTs
                                                                       .....-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TNeu097o03.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTCTTATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTAAAAAAAAAA
                                                  Xt7.1-CHK-1008223220                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTAAAAAAAAAAAAAAAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 4     5    12    13    14    14    16    17    16    17    17    18    18    19    19    20    20    21    20    21    20    21    20    21    20    21    22    23    22    23    23    24    23    24    23    24    23    24    25    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    25    26    25    28    26    29    26    30    26    30    26    30    26    30    26    30    27    31    27    30    28    31    28    31    28    31    28    31    28    31    28    32    29    32    29    32    28    31    28    31    29    32    27    30    27    30    27    30    26    29    26    29    27    30    25    28    25    28    25    28    25    29    25    29    25    29    25    29    22    27    22    27    21    28    23    28    22    28    22    27    22    27    21    27    20    26    19    25    15    24    13    22    13    22    12    21    12    21    13    21    13    21    12    19    11    18    10    17    10    17    10    16    10    16    10    16    10    16    10    16    10    16    10    15    10    15    10    14    10    14    11    15    11    15    11    15    12    15    12    15    12    15    12    15    12    15    13    16    13    16    12    16    12    16    13    17    13    17    13    17    13    16    13    15    13    15    14    16    14    16    13    15    13    16    13    15    13    15    13    15    16    19    16    19    17    21    20    23    20    24    20    26    21    30    23    32    25    35    21    32    22    32    22    32    22    34    22    36    21    37    24    39    25    40    25    40    24    39    25    39    25    39    38    41    35    41    35    40    37    43    38    44    37    43    37    44    36    43    35    42    37    42    40    45    40    46    42    47    43    48    42    48    43    48    42    48    41    48    42    49    44    50    44    49    43    49    44    50    44    49    44    49    43    49    42    49    42    49    42    49    44    48    44    48    43    48    42    46    39    46    43    47    43    47    42    46    43    47    35    46    40    46    39    46    39    46    38    45    41    45    37    43    33    41    32    41    34    41    33    38    30    38    28    37    11    15    10    12    10    12     9    11     9    11     9    11     8    11     9    11     8    10     7    10     8    10     8    10     8    10     8    10     8    10     7    10     8    10     6     7     3     4
  5   1   2  SIG                                    Xt7.1-TNeu097o03.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTCTTATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TGas127j16.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGAATGGAAGGCGAATGTTTCCAGTTCTACGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAAT
  5   1   2  SIG                                      Xt7.1-XZG60160.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCAGGCAGAGTATGGCAGGTTTTTGCTGTACTACAACCATTAATATGGGTATGGTCATGTGATAACATGGGTGTGGTTTCAAGTGGGTGCGGTTTCAAAAAGGGGAGTGGTCAAAACTGGCTTCCATTATCGGCCCTCCACCACGTAGGTCGGAAAAATTCCGGCCCTCGGTACAACAGAAGTTGGACAGCACTGACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACTGTAGATATCCATTTCTAAGTATGGCCACTTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGCTTCTCTAATTTGTTATAGCATATTTCTTATCCTTTGTTAAATATATCAATCAGGAGATTCATCGCATCCCTACTACTGTTGCACTTTTATAGGCGTATTTATTATATTAACACTGTTTGTGAAGAAAATAAGATTAGTTTGTAACTGCTTATTAAGTAGGAAAGCTAGTCAGCCTTATTTTATAGCTGACTTGAAAGACAAGTATTTTTTACTTTTATTCATTCCTGAAACATAATATTCCTGCTCACTTTTTAAAATGTAACAGAAATGAGTATGAATTAAGTTTTGTGACTTGATTGGTTAGATTAGATGTCCAGGAATTGCTCTAGGGCAGACTGAAGTGTTATTGCCATTAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTAATAATGGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAGAGTATGGCAGGTTTTTGCTGTACTACAACCATTAATATGGGTATGGTCATGTGATAACATGGGTGTGGTTTCAAGTGGGTGCGGTTTCAAAAAGGGGAGTGGTCAAAACTGGCTTCCATTATCGGCCCTCCACCACGTAGGTCGGAAAAATTCCGGCCCTCGGTACAACAGAAGTTGGACAGCACTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACTGGTATTGCTGTATTTATTTTTTCCATGTGACT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTGTGGTAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTAAATATGTTATTGTATGCTGTAAGACAATCAGAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------A-
                                               BLH ATG     148    1870                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               BLH MIN     148     293                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               BLH OVR     148      48                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               EST CLI      -4      21                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               ORF LNG     148       4                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 9e-051     NP_498088.1 T BoX family member (47.0 kD) (tbx-2) [Caenorhabditis elegans] --------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 2e-081     BAE06334.1 transcription factor protein [Ciona intestinalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Cs ==== 1e-085     BAA92187.1 brachyury [Ciona savignyi] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 5e-090     NP_524031.1 CG7260-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Sp ---- 7e-113     XP_782140.2 PREDICTED: similar to transcription factor Brachyury [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Bb ---= 3e-147     AAP31567.1 T-box protein brachyury 2 [Branchiostoma belcheri] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Bf ---- 2e-150     CAA62999.1 AmBra-1 [Branchiostoma floridae] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Dr ---- 0          XP_689261.1 PREDICTED: similar to brachyury transcription factor [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 0          NP_033335.1 brachyury; brachyury-like 3; low ratio; brachyury-like 2 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 0          NP_003172.1 transcription factor T; T brachyury-like [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Gg ==== 0          NP_990271.1 brachyury (T) [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 0          AAA49663.1 brachyury (T) [Xenopus laevis]  ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === ?? ==== 0          NP_001084047.1 brachyury (T) [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 0          NP_001008139.1 MGC89607 protein [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu097o03.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAG------------------------------------TGA---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------TAA---------------------------------------------TAA---------------------TGA------------------TAA---------------------------------------------------------------------------TGA---------------------TAG------------TGATAA---------------------TAG---ATG---------------ATG---------------------------------------------------------TGA------------------------------------TAATAA------------------------------------------------------------------------------------TAG---------TAA------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGA---------------------------------------TAA------------ATG---TAA---------------------------------------------------TAA------------------------------------------------TAA---------------------------------TAA------------TAA------------------------------TAG------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  3   1   1         - Gas7      in                         XZG60906.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTAAGATCAGGGTCTCTCCACTTATTCTACCCACTGTAGATATCCATTTCTAAGTATGGCCACTTCTNTCAGACATCAAGGCTTCTCTAATTTGTTATAGCATATTTCTTATCCTTTGTTAAATATATCAATCAGGAGATTCATCGCATCCCTACTACTGTTGCACTTTTATAGGCGTATTTATTATATTAACACTGTTTGTGAAGAAAATAAGATTAGTTTGTAACTGCTTATTAAGTAGGAAAGCTAGTCAGCCTTATTTTATAGCTGACTTGAAAGACAAGTATTTTTTACTTTTATTCATTCCTGAAACATAATATTCCTGCTCACTTTTTAAAATGTAACAGAAATGAGTATGAATTAAGTTTTGTGACTTGATTGGTTAGATTAGATGTCCAGGAATTGCTCTAGGGCAGACTGAAGTGTTATTGCCATTAACTGCCTTACTATGTTAATAATGGCAGTTCAGTTAAGATATCCCATCAGTATAGTCCTTACCCTTATCTACATGGCTTATATCTACAGTCATTATATTCAATGAATAGAAAGCTAGATTAGATACCTGTATCTCTATACCCTTTCACTCTCTGTATTTCAATACAGACAGGTATATTGTGGCCCAGAATACAAATACATTTACTTTTACAACTTCTTTACTTCTGAATTGTCAGCTTTTACCAGGTACAGACAACTAGGCCACACAGAAATATTAATGTAATTGAACACAAAATGGAAGCTATAGCATATAGTGCATTTATT
  5   1   1         - Gas       out                  TGas077n14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTATTCTACCCACTGTAGATATCCATTTCTAAGTATGGCCACTTCTTTCAGACATCAAGGCTTCTCTAATTTGTTATAGCATATTTCTTATCCTTTGTTAAATATATCAATCAGGAGATTCATCGCATCCCTACTACTGTTGCACTTTTATAGGCGTATTTATTATATTAACACTGTTTGTGAAGAAAATAAGATTAGTTTGTAACTGCTTATTAAGTAGGAAAGCTAGTCAGCCTTATTTTATAGCTGACTTGAAAGACAAGTATTTTTTACTTTTATTCATTCCTGAAACATAATATTCCTGCTCACTTTTTAAAATGTAACAGAAATGAGTATGAATTAAGTTTTGTGACTTGATTGGTTAGATTAGATGTCCAGGAATTGCTCTAGGGCAGACTGAAGTGTTATTGCCATTAACTGCCTTACTATGTTAATAATGGCAGTTCAGTTAAGATATCCCATCAGTATAGTCCTTACCCTTATCTACATGGCTTATATCTACAGTCATTATATTCAATGAATAGAAAGCTAGATTAGATACCTGTATCTCTATACCCTTTCACTCTCTGTATTTCAATACAGACAGGTATATTGTGGCCCAGAATACAAATACATTTACTTTTACAACTTCTT
  5   1   2  SIG                                    Xt7.1-TNeu097o03.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTCTTATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTAAAAAAAAAA
                                                  Xt7.1-CHK-1008279136                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTAAAAAAAAAAAAAAAG
  0   1   1           Gas  FL                     TGas116l23.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTAATCAAGGACTCTTATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAC
  5   1   1           Neu0 FL                     IMAGE:6995163.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   4      seed Gas  5g3  in                   TGas127g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAAAGGCACCATGGGGCTCGTCCAGGCCTATTCAATGAGAGAGAGAAAGATCACTCTCCTAATCAAGGACTCTTATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTTATAAGACATCTTGGATGAGGGTATTGATAGTCAACACT
  5   1   3        nb Neu  5g                        TNeu049h06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTAATCAAGGACTCTTATTCCTCCAATGCCTTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTT
  5   1   3        nb Gas  FL   in                   TGas116l23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAATCAAGGACTCTTATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACACCACCGCTGGAAGTACGTGAATGGA
  5   1   3        nb Gas  5g                        TGas020f02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCGGGCTTATTCCTCCAATGCCATTTGNGATTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTNTGGAGCCCACTGGATGAAAGATCCTGTTTC
  5   1   3        nb Gas  5g                        TGas056e20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGACTCTTATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCATGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATG
  5   1   0       chi Gas7      in                         XZG60906.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGTAAGATCAGGGTCTCTCCACTTATTCTACCCACTGTAGATATCCATTTCTAAGTATGGCCACTTCTTTCAGACATCAAGGCTTCTCTAATTTGTTATAGCATATTTCTTATCCTTTGTTAAATATATCAATCAGGAGATTCATCGCATCCCTACTACTGTTGCACTTTTATAGGCGTATTTATTATATTAACACTGTTTGTGAAGAAAATAAGATTAGTTTGTAACTGCTTATTAAGTAGGAAAGCTAGTCAGCCTTATTTTATAGCTGACTTGAAAGACAAGTATTTTTTACTTTTATTCATTCCTGAAACATAATATTCCTGCTCACTTTTTAAAATGTAACAGAAATGAGTATGAATTAAGTTTTGTGACTTGATTGGTTAGATTAGATGTCCAGGAATTGCTCTAGGGCAGACTGAAGTGTTATTGCCATTAAACTGCCTACTATGTTAATAATGGCAGTTCAGTTA
  5   1   2       add Neu0 5g                            IMAGE:6993982                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAAGCATTTCTGGGATGCAAAAGNAAAGAAAATGATTTATTAAAGACATCCTTGAAATGANGGGTATTTGAATAGTCAACAACTCAAAATTTTCTCCTCAGCCGATACTTTGGGCTGAATT
  5   1   3   12   nb Gas7 5g3  in                         XZG62821.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACA
  5   1   3        nb Neu  5g                        TNeu024f07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTATTCCTCCATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTT
  5   1   3        nb Gas  5g                        TGas105l22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGGCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGA
  5   1   2       add Neu0 5g                            IMAGE:6994425                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTTAAATCAAACACAACCCCCTTTGCCAAAGCATTTCTGGGATGCAAAAAGAAAGAAATGATTTATAAGGACATCCTTGGGATGGAGGGGTATTGGATAGTTCAAACAACTCAAAATT
  5   1   3        nb Gas  5g                        TGas023e12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAA
  5   1   3   14   nb Gas6 5g3  in                          ANBT594.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGGCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTG
  5   1   3        nb Gas  5g                        TGas033b23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCCAATGCCATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTT
  5   1   2   12  ext Gas7 5g3  in                         XZG44335.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTTGGATTTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGC
  5   1   3        nb Neu0 FL                            IMAGE:6995163                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTACTACCTGCCGATCATTCACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTTGGATGAAGGTATTGATAGTCCACACTCAAAATTTCTCTCAACTAAGGTACTTGGGCTGATTCCCC
  5   1   3   12   nb Gas7 5g3  in                         XZG15236.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTGCCGATCATTCACACCGTTGGTTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTA
  5   1   3        nb Neu  5g3  in                   TNeu086l10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACACCTTGGGTTTTGTTCCGATTACAATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAA
  5   1   3   10   nb Ovi1 5g3  in                         CABI2014.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCGATTACATAAGAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCCAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCC
  5   1   2       add Gas1 5g                            IMAGE:6987547                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGAAATCAGAGGAAGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGGCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACCTGGGCTGATTCCCAACGTGGGATCTTTTATGTTCGCCCCATTCAAACACACAAGTTCGGGGGCGCCGGATTTCTCTATTCGTCTCCCTCATGGCTGGCAAGCGAAAACTCCTCCTCCTAAAAAACCACCGGGTTCGGGCTTTCCCTTACCCAAAGTTCCCATATGGTTTCAACAGAAAAACAAATTCCCCCCAAAACAA
  5   1   2       add Neu0 5g                            IMAGE:6993550                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAGCTGCTGTTAGTTTCCCCCCAGTGTGTGCGCTTGGAAGCCCCTCTCTTGAGGAATGAGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGANGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGGATCTTTTATGTTCGCCCCAATCCACACACACAGGTTCGGGGGCGCCGAATTTTCTCCTATCG
  5   1   3        nb Gas1      in                     NISC_mq05e03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGATGTGGGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTA
  5   1   3        nb Gas1      in                     NISC_mq06g09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTGTAAGTGCCACCGAGAGCTGCGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATACAGCACT
  5   1   3        nb Gas7                                 XZG50712.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCAAAGAATGTGCAGTACCGGGTCGATCACCTTCTCAGCGCTGTGGAGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGATTGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGANAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCATCCACACACACAGTTCGGGGGCGCCGATTTCTCTATCG
  5   1   2       ext Te5       in                         CAAO8385.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAATGAGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTA
  5   1   3        nb Gas                            TGas112n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTCCAGGCTGGCAGCGAGAAGGGGGACCCCACCGAGAAGGAGCTGAAGGTGAGCCTGGAGGAGCGGGACCTGTGGATGAGGTTCAAGGAGCTCACCAATGAGATGATCGTCACCAAGAATGGAAGGCGAATGTTTCCAGTTCTAAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTC
  5   1   3        nb Gas7      in                         XZG23392.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCCCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGC
  5   1   3        nb Gas7      in                          XZG5412.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGAT
  5   1   3        nb Gas7                                   XZG670.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGNGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCCTCATACTCATCTCTTTCACATGCTGTTC
  5   1   3        nb Gas7      in                         XZG62790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTG
  5   1   3        nb Gas7                                 XZG14617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATC
  5   1   2       add Gas7      in                         XZG57109.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCTCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAATTACCAAAAACACTGA
  5   1   3        nb Gas7      in                          XZG5196.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTCAGCACTTAAAATCAAACACAACCCCTTTGCCAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas7      in                          XZG5196.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACC
  3   1   3        nb Gas7      in                          XZG5412.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTCCC
  5   1   2       ext Ovi1      in                         CABI8149.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGGTGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCANAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCACAATCGTTATTACCTT
  5   1   2       ext Neu       in                   TNeu097o03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTGCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATC
  5   1   3        nb Gas7                                 XZG58355.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGGAACACCTCCTACCTCAAGTCAGTACTCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAA
  5   1   0       chi Gas7      in                          XZG4324.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGTTGATGAAAGCCTGGAATGTGCTGTGACGTCATACTGGTTTTCTGCTATTTCTGTTTGTGATCCATGTTCATACAATGGAGATCCTGTGGCTGGTGAGGGAACAGCATGTGAAAGAGATGAGTAATGAGGCGTAGAGCCGCGTAAGTACTGGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTtaggtcagtgctgtccaactggcggcccgcgggccgcatgcggcccgcggcccccctctgtgtgggcccccacctgtctggctgctttgatggcttaccttt
  5   1   3        nb Gas7      in                          XZG3330.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTC
  5   1   3        nb Gas7                                   XZG855.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGT
  5   1   3        nb Gas       in                   TGas106d03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTA
  5   1   3        nb Gas7      in                         XZG24521.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAA
  5   1   3        nb Gas                            TGas106p01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATGTAGGGAGAGACTGTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGCCCAACC
  3   1   2       ext Neu       in                    TNeu097o03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCAGGCTTTCATCAACATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGGGAACAGAAAAAAAAAAAAAAAAAA
  5   1   2       add Tad5      in                         XZT48890.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGACGCGTGGGCAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTtaggtcagtgctgtccaactggcggcccgcgggccgcatgcggcccgcggcccccctctgtgtggccccccacctgtctggctgctttgatggcttacctttgtgtaagctttaaatggtatcagaactgtaattaactgcccccccccccctgcatggttctcacctcaaattcaggctgtaatcaggctgtattgtttaaatatgtaatcccctgtactgttcacaccttttaatccctggattgttcaccccctgaagtgttcaaaactca
  3   1   3        nb Gas  FL   in                    TGas116l23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATANAAAAAATACTGGGAACAGAAACAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Ovi1      in                         CABI8149.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTCGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAAGCCTC
  5   1   3        nb Gas                            TGas033k01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCA
  3   1   4      seed Gas  5g3  in                    TGas127g08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGGGAACAGAAAAAACAAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu  5g3  in                    TNeu086l10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATTCAGATAAAAAAATACTGGGAACAGAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Ovi1 5g3  in                         CABI2014.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAAC
  5   1   3        nb Gas8      in                          st79d23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTT
  5   1   3        nb Gas8      in                          st78d23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGT
  3   1   2       add Gas7      in                         XZG57109.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        tacaaccattaatatgggtatggtcatgtgataacatgggtgtggtttcaagtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACGG
  5   1   3        nb Neu                            TNeu060b06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCT
  5   1   2       ext Sto1      in                          CABG475.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATA
  3   1   2       ext Te5       in                         CAAO8385.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGCAAATTACCAAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAG
  3   1   3        nb Gas7      in                         XZG62790.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAACTTGAAGATGTTCTGGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGTTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGATTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAG
  3   1   2       add Tad5      in                         XZT48890.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        caaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATTTACTGTGTCAGACAAGCTATTATTTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGGCCGG
  3   1   2       add Gas7      in                          XZG4324.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        caaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGGGAAC
  3   1   3        nb Gas6 5g3  in                          ANBT594.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGTCCAACCAGGTGTGAGTGGTTTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTTTGCTTATTTTTTTTACAATCCCTATTTACTTCTATTTGGGACTGGTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATTTACTGTGTCAGACAAGTTATTATTTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTTTAAAACCCAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAAAGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACCGG
  3   1   3        nb Gas8      in                          st78d23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTA
  3   1   3        nb Gas8      in                          st79d23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATNTGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGNCTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATNGTGTAACTGGTATTGCTGNATTTATTTTTTCCATGTGACTTCCCATGTGATGTTTTTGTGGTAAATGTATNTGTGCTGCAAATATGTTAT
  3   1   2       ext Sto1      in                          CABG475.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTGTGAGTGGTCTGCACTGCAGCTCACTATCTGAGAAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCACNAATCGTTATTACCTTAGAATATGTTATGTNGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTAAAAAAAAA
  3   1   3        nb Gas7 5g3  in                         XZG62821.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTTTTTTACAATCCCTATTTACTTCTATTTGGGACTGGTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTTTTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGGGGTACTGTCTAGAGTCTAGGGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATTTACTGTGTCAGACAAGTTATTATTTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTTTAAAACCCAAAGGGAAAGTATCCTAATTCATTGGGTAACTGGTATTGCGGTATTTATTTTTTCCATGTGACTTCCATGGGATGTTTTTGTGGTAAAAGTATATGTGCGGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTG
  3   1   3        nb Neu                             TNeu103l12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATTTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTTTAAAACACAAAGAGAAAGTATCTTAATTCATTGGGAAACTGGTATGGCGGTATTTATTTTTTCCATGTGACTTCCATGTGAGGTTTTTGTGGTAAATGTATATGTGCGGTAAATATGTTATTGTATGCTGTAGGCCATTCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCGGAGTCCATATAATGTACAGATATAAGAAAACTTTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATA
  3   1   2       ext Gas7 5g3  in                         XZG44335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATATTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTACCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATATTAATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTAAAAAAAAAAAAAAAGG
  5   1   3        nb Gas                            TGas054e22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGAGAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACCG
  5   1   3        nb Gas                            TGas144c22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACATTCAGTTTTCTGAATGTGCTTGGCAAAGGGTAATTTACCCTGGAAGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTTGTATTAATAAGAAAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTTGCTGCTACAGGCTACATTGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGAACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAATATCCTAATTATTGTGTAACTGGTATTGCTGTATTTATT
  3   1   3        nb Gas7 5g3  in                         XZG15236.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTGAAGGGAATTTAAAGATGCGGGAAAACGGAAACTGTATTAATAAGAGAATCCCTTCTGGTTATTTCTTTTACAATCCCTATTTACTTCTATATGGGAGTGCTGCTACAGGCGACATGGTTTTTTTTTATAGACATATTTTTAATATGCCTTTTTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTGGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCGTTTACTGTGTCAGACAAGCTATTTTTTGCTGCCTAAATAACTGCAAACTGCCCCCAGCTAAATTGATTTTAAATATTGTTTTTAAAAAACAAAGAGAAAGTATCCTAATTCCTTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGAGGTTTTTGTGGTAAAAGTATATGTGCGGTAAATATGTTATTTTTTGCTGTAAGACAACCAGATAAAAAAATACT
  3   1   3        nb Gas7      in                          XZG3330.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATA
  3   1   3        nb Gas1      in                     NISC_mq06g09.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATTTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTTTAAAACCCAAAGAGAAAGTATCCTAATTCATTGGGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGCCAATCAGATAAAAAAATTCTGTGGACCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   3        nb Gas       in                    TGas106d03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTTAAGATGCAGGAAACGGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTAAAAAAAAAAAAAAA
  5   1   2       ext Gas7      in                         XZG27116.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATATTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTACCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATATTAATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTATTCACCAGAAAAAAAAAAAAAAAAAAAACAGAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG23392.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACCCAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGGGACTTCATGTGATGTTTTTGTGGTAAATGTATATGTGCGGTAAATATGTTATTGTATGCTGTAAGCCAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTCCATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCCCTAATGTGCAGTGTTATAAGGTATCACCCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCTT
  3   1   3        nb Gas7      in                         XZG24521.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTACATGGTTTTTTTTTATAGACATATTTTTAATATGCCTTTTTAAGGGAAAATAATTTAAAAGGCTTAAATAATTTAAAATGGGGTCCTGTCTAGAGTCTAGAGACTTTAGACTATGAAAAAATTTTTGCAGCAGAATTTGTTTGCATTTACTGTGTCAGACAAGTTTTTTTTTGCTGCCTAAATAACTGCAAACTGCCCCCAGCTAAATTGATTTTAAATATTGTTTTTAAAACCCAAAGGGAAAGTTTCCTAATTCATTGGGTAACGGGTATTGCGGTATTTTTTTTTTCCATGGGACTTCCATGGGAGGTTTTTGGGGTAAAGGTATATGGGCGGTAAATATGTTAT
  3   1   3        nb Gas1      in                     NISC_mq05e03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATGTTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTCCCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATGTTCATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTAAAAAAAAAAAAAAAG
  3   1   2       ext Gas7      in                         XZG27116.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGCTGCCTAAATAACTGCAAACTGCCCCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGGGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAAAGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGCCAATCAGATAAAAAAATTCTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATATTTTCATAGAGAGATTCCATTATGCAGAGTCCATTTAATGTACAGATATAAGAAAACTCTCTTGTTACCCCTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGGGGTTCATTTTAATTTTTTGGCAATAAAGTGCAGTGTCATAAGGTTTTCCCCGGaaaaaaaaaaaaaaaaaaaccggaaaaaaaaaaaaaaaaaaaaaCC
  5   1   3        nb Gas                            TGas126a18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAG
  5   1   2  SIG                                    Xt7.1-TGas127j16.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGAATGGAAGGCGAATGTTTCCAGTTCTACGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAAT
                                                  Xt7.1-CHK-1008279138                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAGGCGAATGTTTCCAGTTCTACGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGGG
  5   1   4      seed Gas       in                   TGas127j16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGAATGGAAGGCGAATGTTTCCAGTTCTACGGTGAGCGTGTCGGGCCTGGATCCCAATGCCATGTACACATTTCTGCTGGATTTTGTGGCAGCTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATACTAATGGAATAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTCACATGCTGTTCC
  5   1   3        nb Gas7      in                         XZG40892.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGACAACCACCGCTGGAAGTACGTGAATGGAGAATGGGTTCCAGGTGGCAAACCTGAGCCCCAGGCCCCCAGTTGTGTTTACATTCACCCAGACTCCCCCAACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGNGA
  5   1   3        nb Gas7      in                         XZG28772.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACCTCCCAGCACA
  5   1   2       ext Gas7                                  XZG9536.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACAGCACTTAAAATCAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAGAAAACCAGTATGACGTCACAGCACATTCCAGGCTTTCATCAACATGGACAACAGTTGCACCACCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAG
  3   1   4      seed Gas       in                    TGas127j16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGGACAACAGTTGCACCGCCGTCAATCTAAAGCAAAGACTTTAAGGACTTAATATAAAAATCAGTGTTTCCTGGGCTTGAGCTGCTGGGGGTCCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGGGAACAGAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG28772.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCAGTGTTTCTGGGCTTGAGCTGCTGGGGGTNCCTGGCCCATAAAAGCAAATTACCAAAACAACTTGAAGATGTTCTTGCAATAATTAAGTTGGCTTTTACCTGTTTCAAAAGGCTTCACTGGTCCAACCAGGTGTGAGTGGTCTGCACTGCAGCTCACTATCTTGAGAAGCAAAGCACAAACAAAAGTAGGATTCACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAAC
  3   1   3        nb Gas7      in                         XZG40892.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCAGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGTTATTATTTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAACCCAAAGGGAAAGTATCCTAATTCATTGGGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGGGATGTTTTTGTGGTAAAGGTATATGTGCGGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATAC
  5   1   2  SIG                                      Xt7.1-XZG60160.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCAGGCAGAGTATGGCAGGTTTTTGCTGTACTACAACCATTAATATGGGTATGGTCATGTGATAACATGGGTGTGGTTTCAAGTGGGTGCGGTTTCAAAAAGGGGAGTGGTCAAAACTGGCTTCCATTATCGGCCCTCCACCACGTAGGTCGGAAAAATTCCGGCCCTCGGTACAACAGAAGTTGGACAGCACTGACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAA
                                                  Xt7.1-CHK-1008279142                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGAGTATGGCAGGTTTTTGCTGTACTACAACCATTAATATGGGTATGGTCATGTGATAACATGGGTGTGGTTTCAAGTGGGTGCGGTTTCAAAAAGGGGAGTGGTCAAAACTGGCTTCCATTATCGGCCCTCCACCACGTAGGTCGGAAAAATTCCGGCCCTCGGTACAACAGAAGTTGGACAGCACTGACTTAGGTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACT
  5   1   4      seed Gas7      in                          XZG7164.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGACTCCCCCACTTTGGAGCCCACTGGATGAAAGATCCTGTTTCTTTCAGCAAAGTCAAACTTACAAACAAAATGAATGGTGGAGGCCAGATTATGCTAAACTCGTTGCACAAATATGAACCTCGAATCCACATAGTGAGAGTTGGAGGCACCCAGAGAATGATCACCAGTCACTCATTTCCTGAGACACAGTTCATAGCAGTGACAGCATACCAGAATGAAGAGATTACAGCACTTAAAATCAAACACAACCCCTTTGCCAAAGCATTTCTGGATGCAAAAGAAAGAAATGATTATAAAGACATCTTGGATGAGGGTATTGATAGTCAACACTCAAATTTCTCTCAGCTAGGTACTTGGCTGATTCCCAACGGTGGATCTTTATGTTCGCCCAATCCACACACACAGTTCGGGGCGCCGATTTCTCTATCGTCTCCTCATGGCTGCGAGCGATACTCATCTCTAAGAAACCACCGCTCGGCTCCCTACCCAAGTCCATATGTTCACAGAAACAATTCCCCAAACAATTTAGCAGATAATTCTTCAGCCTGTCTTTCAATGCTCCAGTCCCATGATAACTGGTCCACACTTCAAATGCCGGCACACACTGGGATGTTGCCAATGAGTCACAGCGCGGGAACACCTCCTACCTCAAGTCAGTACCCTTCCTTGTGGTCTGTGAGTAACAGCACCCTCACACCAGTGTCTCAGTCTGGAGGAATAACTAATGGAATAAGCTCCCAGTACTTACGCGGCTCTACGCCTCATTACTCATCTCTTTCACATGCTGTTCCCTCACCAGCCACAGGATCTCCATTGTATGAACATGGATCACAAACAGAAATAGCAG
  5   1   2       ext Gas7      in                         XZG63674.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ggaaggcagagtatggcacacacaaaggcagggtagggcaggcagagtatggcaggtttttgctgtactacaaccattaatatgggtatggtcatgtgataacatgggtgtggtttcaagtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTG
  3   1   2       ext Gas7      in                         XZG63674.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             agncagggtagggcaggcagagtatggcaggtttttgctgtactacacccattaatatgggtatggtcatgtgataacatgggtgtggtttcaagtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAATACTGTGGGCCGG
  5   1   3        nb Gas7      in                         XZG19597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ggcaggcagagtatggcaggtttttgctgtactacaaccattaatatgggtatggtcatgtgataacatgggtgtggtttcaagtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAA
  3   1   2       ext Gas7      in                         XZG60160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCgcaggtttttgctgtactacacccattaatatgggtatggtcatgtgataacatgggtgtggtttcaagtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACGG
  5   1   2       ext Gas7      in                         XZG17712.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        caggtttttgctgtactacaaccattaatatgggtatggtcatgtgataacatgggtgtggtttcaagtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTG
  5   1   2       ext Gas7      in                         XZG60160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        caggtttttgctgtactacaaccattaatatgggtatggtcatgtgataacatgggtgtggtttcaagtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGT
  3   1   3        nb Gas7      ?                          XZG22119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           gtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGG
  3   1   4      seed Gas7      in                          XZG7164.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           gtgggtgcggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAATATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGGGAACAG
  5   1   3        nb Gas7                                 XZG18702.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ggtttcaaaaaggggagtggtcaaaactggcttccattatcggccctccaccacgtaggtcggaaaaattccggccctcggtacaacagaagttggacagcactgacttaggTGATAAAACCAACAATCGTTATTACCTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTACCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTANATGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCA
  3   1   3        nb Gas7      in                         XZG19597.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTAGAATATGTTATGTTGCCTATGTATGTTCTACATCAGTTTTCTGAATGTGCTGGCAAAGGGTAATTTTCCCTGGAGGCTCTTTTGAAGGGAATTTAAAGATGCAGGAAAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTTTTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGGGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATTTACTGTGTCAGACAAGCTATTTTTTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGGGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGGGATGTTTTTGTGGTAAATGTATATGGGCGGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAAATAC
  3   1   2       ext Gas7      in                         XZG17712.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACGGAAACTGTATTAATAAGAGAATCCATTCTGCTTATTTCTTTTACAATCCCTATTTACTTCTATCTGGGACTGCTGCTACAGGCTACATGGTTTTTTATTATAGACATATTTTTAATATGCCTTATTAAGTGAAAATAATTTAAAATGCTTAAATAATTTAAAATGTGGTACTGTCTAGAGTCTAGAGACTCTAGACTATGAAAAAATATTTGCAGCAGAATTTGTTTGCATCTACTGTGTCAGACAAGCTATTATCTGCTGCCTAAATAACTGCAAACTGCACCCAGCTAAATTGATTTTAAATATTGTTTCTAAAAAACAAAGAGAAAGTATCCTAATTCATTGTGTAACTGGTATTGCTGTATTTATTTTTTCCATGTGACTTCCATGTGATGTTTTTGTGGTAAAAGTATATGTGCTGTAAATATGTTATTGTATGCTGTAAGACAATCAGATAAAAAATACTGTGGAACAGAAAGATGGAGTCCATTTTCATAAATATTTCAGGATATTTTCATAGAGAGATTACATTATGCAGAGTCCATATAATGTACAGATATAAGAAAACTCTCTTGTTACCACTAATGTGCAGTGTTATAAGGTATCAACCTTAATATATATATATGTATATAGGGGGAGGTTCATATTAATTTTTTGGCAATAAAGTGCAGTGTCATAAGGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)