Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012072433 Xt7.1-CABJ5010.5 - 73 ESTs
                                                                       -450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABJ5010.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGTTGGGGGCTAGTAAGTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAATTGAAGGAGTTCTCACAGAAACCGGATTCAGCGAAAAACGTGCCCGTTCAATGGATATCGATGATTTTATGGCACTCCTTCATGGATTTAATTCACAAGGAATCCACTTTACATAAGCACCTTGGGACTCTCCGCTGACCCCGGCAGTTTGGTGACAATGGATTTCTGTCACAGGGAGGAATCGGCCACTGATCTTGCAGTTTGTGTAGAATGGTTCTCATTTGTACAGTTTCTCTTCCACACTACCTGCACATTACTGTTGTGAACACTGAAATAATGTGTGACCTGAAATGTAAAATAACTTATACAAAGCCAAGTCTGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTGGGTGGTTCACCTTTAAGTTAGCTTTTAGTTTGTTATAGAATGGCCACTTCTTAGCAACTTTTCAACTGGTCTTCATGCTATTAAAATTGTTTTTGGATTATTTGCCTTCCTCTTCTGCCTCTTTCCAGCTTTCAAACGGGGTTCACTGACCCCAGCAGTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224226                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGCTAGTAAGTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAATTGAAGGAGTTCTCACAGAAACCGGATTCAGCGAAAAACGTGCCCGTTCAATGGATATCGATGATTTTATGGCACTCCTTCATGGATTTAATTCACAAGGAATCCACTTTACATAAGCACCTTGGGACTCTCCGCTGACCCCGGCAGTTTGGTGACAATGGATTTCTGTCACAGGGAGGAATCGGCCACTGATCTTGCAGTTTGTGTAGAATGGTTCTCATTTGTACAGTTTCTCTTCCACACTACCTGCACATTACTGTTGTGAACACTGAAATAATGTGTGACCTGAAATGTAAAATAACTTATACAAAGCCAAGTCTGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTGGGTGGTTCACCTTTAAGTTAGCTTTTAGTTTGTTATAGAATGGCCACTTCTTAGCAACTTTTCAACTGGTCTTCATGCTATTAAAATTGTTTTTGGATTATTTGCCTTCCTCTTCTGCCTCTTTCCAGCTTTCAAACGGGGTTCACTGACCCCAGCAGTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAAxxAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                        7    10     8    10    13    15    16    18    20    22    20    22    21    22    22    24    22    24    22    25    22    25    23    26    24    27    24    27    25    27    25    27    25    27    25    27    25    27    25    27    25    27    25    27    25    28    26    28    26    28    27    28    27    28    28    29    28    29    28    29    28    29    27    28    27    28    27    28    27    28    27    28    27    28    27    28    26    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    29    29    29    29    29    29    29    29    29    29    28    30    29    30    28    29    27    28    28    28    27    28    27    28    26    27    25    27    25    27    25    27    23    26    24    27    23    25    22    25    21    24    20    23    20    23    15    18    11    17    11    16    11    13    10    13    10    12    11    13    10    12     9    11     8    11     8    11     8    10     8     9     9     9     9     9     8     8     8     8     8     8     9     9     8     8     8     8     9     9     9     9     9     9     9     9    10    10    12    12    12    12    13    13    13    13    17    17    18    18    20    20    22    22    26    26    28    29    30    31    34    35    34    36    34    36    33    36    34    36    35    37    37    37    37    38    36    38    36    39    38    40    38    39    36    39    37    39    35    39    35    38    37    40    36    40    38    40    38    40    37    40    37    40    36    40    38    41    39    41    38    40    34    39    37    39    37    39    37    39    35    39    36    39    37    39    36    39    36    39    36    39    35    39    37    39    33    38    35    37    35    37    34    38    35    37    36    37    33    36    33    35    31    35    30    34    29    33    29    32    29    32    30    32    30    32    29    32    30    32    29    32    29    32    29    32    27    30    27    30    27    30    21    25     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --------A--C
                                               BLH ATG      37     919                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH MIN      37     161                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH MPR      16     161                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH OVR      37      66                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               CDS MIN      37      34                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               EST CLI      -8      34                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               ORF LNG      37       4                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Sc ---- 1e-099     NP_015057.1 Dimethyladenosine transferase,(rRNA(adenine-N6,N6-)-dimethyltransferase),reponsible for m6[2]Am6[2]Adimethylation in 3'-terminal loop of 18S rRNA; Dim1p [Saccharomyces cerevisiae] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Ce ==== 1e-100     NP_496061.2 Ribosomal RNA adenine dimethylase (34.6 kD) [Caenorhabditis elegans] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Gg ---- 7e-120     XP_424746.2 PREDICTED: similar to DIMT1L protein [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dm ==== 5e-129     NP_651660.1 CG11837-PA [Drosophila melanogaster] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Sp ==== 3e-141     XP_001176419.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Mm ---- 1e-147     NP_079723.1 RIKEN cDNA 1500031M22 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Hs ==== 5e-150     NP_055288.1 putative dimethyladenosine transferase [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 1e-152     NP_001003556.1 zgc:101122 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 5e-172     AAI06333.1 MGC130862 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = ?? ==== 5e-172     NP_001089685.1 hypothetical protein LOC734747 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 2e-172     AAI23078.1 LOC779588 protein [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABJ5010.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------TAA------------------------------------TGA---------------------------------------------------TAG------------------------------------------------------------TGA---------TGA------ATGTAA------------------------------------------------------------------------------------------------------------ATG---------------TGA---ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------ATG---------------------------------------------------------------------TGA---------------------TGA------------------------TAA------------TAG---------------------------------------TAG---------TAA---------------------------------------------TGA---------------ATG---------------------ATG---------------------------------------------TAATAGTAA---TGA---------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  0   1   1           Mus1 FLt5                        CABH7611.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAATTGAAGGAGTTCTCACAGAAACCGGATTCAGCGAAAAACGTGCCCGTTCAATGGATATCGATGATTTTATGGCACTCCTTCATGGATTTAATTCACAAGGAATCCACTTTACATAAGCACCTTGGGACTCTCCGCTGACCCCGGCAGTTTGGTGACAATGGATTTCTGTCACAGGGAGGAATCGGCCACTGATCTTGCAGTTTGTGTAGAATGGTTCTCATTTGTACAGTTTCTCTTCCACACTACCTGCACATTACTGTTGTGAACACTGAAATAATGTGTGACCTGAAATGTAAAATAACTTATACAAAGCCAAGTCTGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTGGGTGGTTCACCTTTAAGTTAGCTTTTAGTTTGTTATAGAATGGCCACTTCTTAGCAACTTTTCAACTGGTCTTCATGCTATTAAAATTGTTTTTGGATTATTTGCCTTCCTCTTCTGCCTCTTTCCAGCTTTCAAACGGGGTTCACTGACCCCAGCAGTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCAGGAAAAAAA
  5   1   2   16  bld Gas7 5g3  in                         XZG53747.5p GTAAGTTGTCCCGCACAGCCAGACCCTGAGGAGAGCAAACTCTCAGCACTCACCTCCAGCCCTCACTAGTAGCTCCGAGCCCCACGCCGGGCAGCCACAGCCGGAAGTATCGCGGGATTTGGGCCACTGGCTGGGAAGGAGGGAGGAGACGCGCAGCTTCGGGCTCCCCGCTAGTGCAGAATTGCTGCTCCCATTGAGATGCTGAGAGTTGTCATTCAGCAATAGCCGGGAGCTGAGGCGTTAGAACCCATACCATGCGCTGAGCCCAAAAACTACTGTTAGCTACAACACGCCCTGCCGTATTAGTCCGTCACTAAAAAGTCCACACACTTCCTAGGCTATGTAGGAACGCGTTCTCTATCGGGAACTACAACTCCCGTCAAACATCGGGTTCAAAGAATTGTGTCGCGCCGCCGTTACGTCACTGCTCTGCGACCTTAGGCCGACACCACGTTGGGGGCTAGTAAGTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCCAGTCATGGTTGGCGATGTTTTGAAGACAGACCT
  5   1   2       bld TbA  5g3  in                   TTbA074c12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTAGCCGACACCACGTTGGGGGCTAGTAATTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGC
  5   1   2       bld Gas  5g                        TGas019k11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGACACCACGTTGGGGGCTAGTAAGTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAAT
  5   1   2   14  bld Brn4 5g3  in                        CAAL18627.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGACACCACGTTGGGGGCTAGTAAGTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATNTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAATGAAGGAGTTCT
  5   1   2       bld Gas  5g                        TGas005h13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGACACCACGTTGGGGGCTAGTAATGGTACAGTAACAGGGAACATGCCGAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTC
  5   1   2   10  bld Tail 5g3  in                         CBSW9531.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................ACACCACGTTGGGGTATAGTAAGTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGATGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTG
  5   1   2   10  bld Fat1 5g3  in                        CABC10547.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCGATTCAATTCGCCGAGGGTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGA
  5   1   2   32  bld Gas7 PIPE out                        XZG44465.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCACGTTGGGGGCTAGTAAGTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGTACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTTGTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAAT
  5   1   2       bld TbA  5g3  in                   TTbA068d22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGTTGGGGGCTAGTAAGTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGC
  5   1   2   14  bld Brn4 5g3  in                        CAAL23447.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................CACGTTGGGGGCTAGTAAGTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAA
  5   1   2       bld TbA  5g                        TTbA051k07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAGTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCA
  5   1   2       bld TbA  5g                        TTbA051k09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAGTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCC
  5   1   2   10  bld Mus1 5g3  in                        CABH10412.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAG
  5   1   2       chi 1030 5x                         IMAGE:7028073.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGTGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATATTTTCGGGCCCCCTCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAAATCCTCCACCTCCTATTTATTTTTCAGGAAATGGGACCGGCTTGGTTCAGGAATGCATTTTGGTCGAAAAAAATAAAACCCCTTGGCCGCCGCTTTTCAAATCCACCGGGCTGGTGCAAAAAACCTTGCTTGAGAAAAAAATTACCAAAATCCCCTTTGCTTCGCCTGCCAAAAAAATTTTCCGGGGGGCCCGAAAAAACTTTCCCGTAATTGGT
  5   1   2       bld TbA  5g3  in                   TTbA036c03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGTACAGTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGC
  5   1   2   10  bld Spl2 5g3  in                        CBSS8828.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGG
  5   1   2   12  bld Tad5 5g3  in                         XZT26885.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAG
  5   1   2   10  bld Spl1 5g3  in                        CABK11023.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAATTGAAGGAGTTCTCACAGAAACCGGATT
  5   1   2       bld TpA  FL   in                  TTpA022k20.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAATTTGAAGGAGTTCTCACAGAAACCGGATTCAGCGAAAAACGTGCCCGTTCAATGGNATATCGATGGATTTTATGGCACTCCTTCATGGATTTAATTCACAAGGAATCCACTTTACATA
  5   1   2       bld TpA       in                   TTpA041g01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGAAAGTCAGAGCGGAGAAGAAAACACGGCAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAATTGAAGGAGTTCTCACAGAAACCGGATTCAGCGAANAACGTGCCCGTTCAATGGATATCGATGATTTTATGGCACTCCTTCA
  5   1   2       bld Gas7      in                         XZG33872.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGTACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGANAACTTCAGTATTGCAGAAAAAATTGAAGGAGTTCTCACAGAAACCGGATTCAGC
  5   1   2       bld Mus1 FLt5 in                         CABH7611.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAANAAATTGAAGGAGTTCTCACAGAAACCGGATTCAGCGAANAACGTGCCCGTTCAATGGATATCGATGATTTTATGGCACTCTTTCATGGATTTAATTCACAGGAATCACTTTACATAAGCACCTTGGGACTCTCCGCTGACCC
  5   1   2       bld Gas7      in                          XZG6866.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGGTTAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGATGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGTTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAG
  5   1   2       chi TpA       in                   TTpA078m19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAANAAATTGAAGGAGTTCTCACAGANACCGGATTCAGCGAANAACGTGCCCCGTTCATGGATATCGATGATTTTATGGCAC
  5   1   2       bld Tbd1      in                        CBXT16302.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTAACAGGGAACATGCCGAAAGTCAGAGCGGAGAAGAAAACACGGAGGCATCAGGAGGTTAAGAGTCAGGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAATTGAAGGAGTTCTCACAGAAACCGGATTCAGCGAAAAACGTGCCCGTTCAATG
  5   1   2       bld Tad5      in                         XZT57781.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAAGAATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAAATTGAAGGAGTTCTCACAGAAACCGGATTCAGCGAAAAACGTGCCCGTTCAATGGATATCGATGATTTTATGGCACTCCTTCATGGATTTAATTCACAAGGAATCCACTTTACATAAGCACCTTGGGACTCTCCGCTGACCCCGGCA
  5   1   2       bld TbA       in                   TTbA009b08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGATCCCTTGATTGTGAACAGCATTATTGATAAGGCTGCAATAAGACCTACAGATGTGGTGCTTGAAGTTGGCCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGGCAAAAAGGGTGGTTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAATTGAAGGAGTTCTCACAGAAACCGGATTCAGCGAAAAACGTGCCCGTTCAATGGATATCGATGATTTTATGGCACTCCTTCATGGATTTAATTCACAAGGAATCCACTTTACATAAGCACCTTGNGACTCTCCGCTGACCCCGGCAGTTTGGTGACAATGGATTTCTGTC
  5   1   2       bld Neu       in                   TNeu117g06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTTGCTTGTGAACTTGACCACGCCTTGTTGCAGAGCTTCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAAGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAAGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTGTAAGTATGAGTGTGTGCAGCTCTGTGTCTCTGGGAACTTATATGCTAATGCTGCACTG
  5   1   2       bld Eye       in                         CCAX9507.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTCTTTGATCTCTGCGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTTCTTCTTCATCGACCATTTTTTAGGTGTGCGGTGCTGATGTTTCAAAGAGAATTTGCACTGCGCTTGGTGGCCAAACCTGGAGATAAACTGTACTGCAGGCTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAATTGAAGGAGTTCTCACAGAAACCGGATTCAGCGAAAAACGTGCCCGTTCAATGGATATCGATGATTTTATGGCACTCCTTCATGGATTTAATTCACAAGGAATCCACTTTACATAAGCACCTTGGGACTCTCCGCTGACCCCGGCAGTTTGGTGACAATGGATTTCTGTCACAGGGAGGAATCGGCCACTGATCTTGCAGTTTGTGTAGAATGGTTC
  5   1   2       bld Tad5      ?                          XZT36038.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCAGCTCTTGGCTCGTGTTGATCACATCATGAAAGTAGGAAAGAATAATTTCAGGCCCCCTCCAAAAGTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCCTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAATTGAAGGAGTTCTCACAGAAACCGGATTCAGCGAAAAACGTGCCCGTTCAATGGATATCGATGATTTTATGGCACTCCTTCATGGATTTAATTCACAAGGAATCCACTTTACATAAGCACCTTGGGACTCTCCGCTGACCCCGGCAGTTTGGTGACAATGGATTTCTGTCACAGGGAGGAATCGGCCACTGATCTTGCAGTTTGTGTAGAATGGTTCTCATTTGTACAGTTTCTCTTCCACACTACCTGCACATTACTGTTGTGAACACTGAAATAATGTGTGACCTGAAATGTAAAATAACTTATACAAAGCCAAGTCTGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCCATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAAGCACCAGGGTGCATTGGGAGAACTCTAGG
  5   1   2       bld HdA       in                   THdA024a23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCGGTGGCAACTTGAATCCAGTGTAGTCCGGATAGAGCCCAAAAATCTTCCACCTCCTATTAATTTTCAGGAATGGGACGGGCTGGTCAGGATTGCATTTGTTCGAAAAAATAAAACCCTTGCAGCAGCTTTCAAATCCACGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAATTGAAGGAGTTCTCACAGAAACCGGATTCAGCGAAAAACGTGCCCGTTCAATGGATATCGATGATTTTATGGCACTCCTTCATGGATTTAATTCACAAGGAATCCACTTTACATAAGCACCTTGGGACTCTCCGCTGACCCCGGCAGTTTGGTGACAATGGATTTCTGTCACAGGGAGGAATCGGCCACTGATCTTGCAGTTTGTGTAGAATGGTTCTCATTTGTACAGTTTCTCTTCCACACTACCTGCACATTACTGTTGTGAACACTGAAATAATGTGTGACCTGAAATGTAAAATAACTTATACAAAGCCAAGTCTGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGNGAGAACTCTAGGTAAGAAAGGTCCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGG
  3   1   2       bld Gas7      in                         XZG33872.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGCTGTGCAAGAGCTGCTTGAGAAAAATTACAAAATCCATTGCTCGCTGCATAATATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAATTGAAGGAGTTCTCACAGAAACCGGATTCAGCGAAAAACGTGCCCGTTCAATGGATATCGATGATTTTATGGCACTCCTTCATGGATTTAATTCACAAGGAATCCACTTTACATAAGCACCTTGGGACTCTCCGCTGACCCCGGCAGTTTGGTGACAATGGATTTCTGTCACAGGGAGGAATCGGCCACTGATCTTGCAGTTTGTGTAGAATGGTTCTCATTTGTACAGTTTCTCTTCCACACTACCTGCACATTACTGTTGTGAACACTGAAATAATGTGTGACCTGAAATGTAAAATAACTTATACAAAGCCAAGTCTGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatGCTATTAAAATTGTTTTTGGATT
  3   1   2       bld Tbd1      in                        CBXT16302.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTCGGTGCCAGAAAACTTCAGTATTGCAGAAAAAATTGAAGGAGTTCTCACAGAAACCGGATTCAGCGAAAAACGTGCCCGTTCAATGGATATCGATGATTTTATGGCACTCCTTCATGGATTTAATTCACAAGGAATCCACTTTACATAAGCACCTTGGGACTCTCCGCTGACCCCGGCAGTTTGGTGACAATGGATTTCTGTCACAGGGAGGAATCGGCCACTGATCTTGCAGTTTGTGTAGAATGGTTCTCATTTGTACAGTTTCTCTTCCACACTACCTGCACATTACTGTTGTGAACACTGAAATAATGTGTGACCTGAAATGTAAAATAACTTATACAAAGCCAAGTCTGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTGGGTGGTTCACCTTTAAGTTAGCTTTTAGTTTGTTATAGAATGGCCACTTCTTAGCAACTTTTCAACTGGTCTTCATGCTATTAAAATTGTTTTTGGATTAAAAAAAAAAAAAAA
  5   1   2       bld Lun1      in                         CABD4576.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGGATTCAGCGAAAAACGTGCCCGTTCAATGGATATCGATGATTTTATGGCACTCCTTCATGGATTTAATTCACAAGGAATCCACTTTACATAAGCACCTTGGGACTCTCCGCTGACCCCGGCAGTTTGGTGACAATGGATTTCTGTCACAGGGAGGAATCGGCCACTGATCTTGCAGTTTGTGTAGAATGGTTCTCATTTGTACAGTTTCTCTTCCACACTACCTGCACATTACTGTTGTGAACACTGAAATAATGTGTGACCTGAAATGTAAAATAACTTATACAAAGCCAAGTCTGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTTCATCTTGCACATCACTATCTAGTTGCTA
  5   1   2       bld Tad5      in                         XZT23141.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGATGATTTTATGGCACTCCTTCATGGATTTAATTCACAAGGAATCCACTTTACATAAGCACCTTGGGACTCTCCGCTGACCCCGGCAGTTTGGTGACAATGGATTTCTGTCACAGGGAGGAATCGGCCACTGATCTTGCAGTTTGTGTAGAATGGTTCTCATTTGTACAGTTTCTCTTCCACACTACCTGCACATTACTGTTGTGAACACTGAAATAATGTGTGACCTGAAATGTAAAATAACTTATACAAAGCCAAGTCTGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGG
  3   1   2       bld TbA  5g3  in                    TTbA074c12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACCCCGGCAGTTTGGTGACAATGGATTTCTGTCACAGGGAGGAATCGGCCACTGATCTTGCAGTTTGTGTAGAATGGTTCTCATTTGTACAGTTTCTCTTCCACACTACCTGCACATTACTGTTGTGAACACTGAAATAATGTGTGACCTGAAATGTAAAATAACTTATACAAAGCCAAGTCTGATAATGTCTGGGCAACCCAAGGAGAGGAAATAGAAATTTTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTTTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTTTgggtggttcacctttaagttagcttttagtttgttatagaatggccactttttagcaacttttcaactggttttcatgctattaaaattgtttttggattatttgccttccttttttgcctctttccagctttcaaacggggttcactgaccccagcagTGGGTACAATCTTGAGGGTACAATATCATTGTTATTTTTTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATTTTGCACATCACTATTTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCCATTGGGAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld TbA                             TTbA075h05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCTTGCAGTTTGTGTAGAATGGTTCTCATTTGTACAGTTTCTCTTCCACACTACGTGCACATTACTGTTGTGAACACTGAAATAATGTGTGACCTGAAATGTAAAATAACTTATACAAAGCCAAGTCTGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacccttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtgttcatgctattaaaattgtttttggattatttgccttcctcttatgcctctttccagctttcaaacggggttcactgaccccagcagTGGGTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATATAGTCGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGGTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Gas7      in                          XZG6866.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCACACTACCTGCACATTACTGTTGTGAACACTGAAATAATGTGTGACCTGAAATGTAAAATAACTTATACAAAGCCAAGACTGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGCACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGGAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttaacctttaagttaacttttagtttgttatagaatggccacatcttagcaacttttcaactggtcttcatgttgttaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacgggggtcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTACACATCACTATCTAGTTGCTAGGGTAATTTGGACCCTAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAAT
  5   1   2       bld Ski1      in                        CABJ11417.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTGTGACCTGAAATGTAAAATAACTTATACAAAGCCAAGTCTGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTA
  3   1   2       bld Gas                             TGas142l11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATGTAAAATAACTTATACAAAGCCAAGTCTGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTTAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTGGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA041g01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATGTAAAATAACTTATACAAAGCCAAGTCTGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTTAAACCAGGAAAAAAAAAAAAAAAAA
  5   1   2       bld Ski1      in                         CABJ5010.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGATAATGTCTGGGCAACACAAGGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCAAAAAAAAAAAAAAAAACT
  3   1   2      seed Ski1      in                        CABJ11417.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACC
  3   1   2       bld Ski1      in                         CABJ5010.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACC
  3   1   2       bld Tail 5g3  in                         CBSW9531.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGCACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGGAGCACCAGTCTGGGGGAAAAGTTTTCTGGGTGGTTAACCTTTAAGTTAACTTTTAGTTTGTTATAGAATGGCCACATCTTAGCAACTTTTCAACTGGTCTTCATGTTGTTAAAATTGTTTTTGGATTATTTGCCTTCCTCTTCTGCCTCTTTCCAGCTTTCAAACGGGGGTCACTGACCCCAGCAGTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTACACATCACTATCTAGTTGCTAGGGTAATTTGGACCCTAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATAAAAAAAAAAAAAAA
  3   1   2       bld Mus1 FLt5 in                         CABH7611.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCAGGAAAAAAA
  3   1   2       bld Fat1 5g3  in                        CABC10547.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAATAGAAATTCTGCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCNCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTTATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACC
  3   1   2       bld Mus1 5g3  in                        CABH10412.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTTGTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATGGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCAGG
  3   1   2       bld HdA       in                    THdA024a23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTGGCTACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTTTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttgttagcaacttttcaagtggtcttcatggtattaaaatcgtttttggattatttgccttcctgttatgcctctttccaggtttcaaacggggTTCAGTGACCCCAGCAGTGGTTACAATCTTGAGGATACAAGATCATTGCTATTTTGTAATATCTTTTTATTGAGGCCTATCATCTTGATAGGTCAATCGGGCACATCACTATTTAGTGGCTAGGGTAATTTGGACCCCAGCAAACATATAGGGGGTATAAAGGGGGGC
  3   1   2       bld Neu       in                    TNeu117g06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAAAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTATAAACCAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Lun1      in                         CABD4576.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAAGCCAATTGCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCAGG
  3   1   2       bld Spl1 5g3  in                        CABK11023.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTTACTTTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACC
  3   1   2       bld TbA       in                   TTbA009b08.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccactttttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttttgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTTTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATTTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTTTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTTAAACCAGGAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Tad5      in                         XZT23141.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTAT
  3   1   2       bld Brn4 5g3  in                        CAAL23447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCAGG
  3   1   2       bld Gas7 5g3  in                         XZG53747.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCCCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACNCAATAGTACATTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAGGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCAG
  3   1   2       bld TpA  FL   in                    TTpA022k20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTATAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA036c03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGACCAATGCTGGATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTTTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTTCCAAACAGAAGCACCAGTTTGGGGGAAAAGTTTTTTgggtggttcacctttaagttagcttttagtttgttatagaatggccactttttagcaacttttcaactggttttcatgctattaaaattgtttttggattatttgccttccttttttgcctctttccagctttcaaacggggttcactgaccccagcagTGGGTACAATTTTGAGGGTACAATATCATTGTTATTTTTTAATATCTTTCTATTTAGGCCTTTCCTTTTCATACTTCAATTTTGCACATCACTATTTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTTTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTTTCGGACAATATAACCTATTTTAAACCCGAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld TbA  5g3  in                    TTbA068d22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATTTAGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCAGAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Brn4 5g3  in                        CAAL18627.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTACTGTGACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCCGG
  3   1   2       bld TpA       in                   TTpA078m19.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ovi1      in                         CABI4197.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCAAAAA
  5   1   2       bld Ovi1      in                         CABI4197.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCCATGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGCTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCAAAAA
  3   1   2       bld Tad5 5g3  in                         XZT26885.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCATCATTTTGGTCATTCTCAATGCTCAGTTTCAGTTTCTTCAGACTTGTACATGGACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCAAAT
  3   1   2       chi TbA       ?                     TTbA034j15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTGGTCATTGTCAATGTTCAGGTTCAGATTTTTCAGATTTGTTCATGGACCCAAAAAAACATTTTGGGTTTCTCGGCCCCTTGGGGGCTAGAAAACCACAAGGGGGCCTTGGGAGAAATTTAGGTAAGAAAGGTCCCGGGCCCCCTTCCAATTTTTTCCCAAACAGAAGCCCCCCTTTGGGGGAAAAATTTTCCGGGGGGTTCCCCCTTAAGTTAGCTTTTAGATAGAAAAAAAAGGCCATTTTTTACCAACTTTTCAATTGGTTTTCATGATAAAAAAATTTTTTAAGGAGTATTTGCCTTTCTTTTTTGCCTTTTTACAAATTTCAAACCGGGTTCATTGGCCCCGGCAGAGGCTTCATTTTTTAGGCCCCAAAATCATTGTTATTTCCCAAATATTTGTATGGGGGCCTCTCCCCCTCATAGTTCAATCTTGCACATCGGTTTCTGGGTGTTTGGGTAAAATAAACCCCCGCTTTCTTTTCCCTGCCCTAAAATGGGGCGAAGATGAATAAAAAGTTCCATAAAGAAAAAAAACTCCACTAAAAAAATGAAGGCCTAAACAAACCATTTCAGAAAAGCCCTTTTTATCTTTTTAATAAAAAAGGGAACAAACCCCTTAATATGCTGGGGGGGGTTTAACCTTCTCTTTGAATAAGGATTCCCCCTATTATTTTCCCTCCCCTCCCAAGGTTTTTATaaaaatataagacaaaaaaaaataattataaaccaggaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaa
  3   1   2       bld Eye       in                         CCAX9507.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCCAATAGTACATTTTGGGCTACTGGGCACATTGGAGGCTAGAAAGCCACAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTGGGTGGTTCACCTTTAAGTTAGCTTTTAGTTTGTTATAGAATGGCCACTTCTTAGCAACTTTTCAACTGGTCTTCATGCTATTAAAATTGTTTTTGGATTATTTGCCTTCCTCTTCTGCCTCTTTCCAGCTTTCAAACGGGGTTCACTGACCCCAGCAGTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATA
  3   1   2       bld Tad5      in                         XZT57781.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGCTACTGGGCACATTGGAGGCTAGAAAGCCTCAAGGGTGCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGGTAGGGTAATTTGGGCCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGTTGAATAAAAAGTTCAATAATGGAA
  3   1   2       bld TpA                             TTpA045m19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAAGGGGGCATTGGGAGAACTTTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTTCCAAACAGAAGCGCCAGTGTGGGGGAAAAGATTTCTGGGTGGTTCCCCTTTAAGATAGCTTTTAGTTTGTTATAGAATGGCCCCCTCTTAGCAACTTTTTAACTGGTAATCACGCTATTAAAAGAGATTTTGGATTATTTGCCTTCCTCATAAGCCTCTTGCCAGCTTTTCAACGGGGTTAGTTGTCCCCAGCACTGGGTTCAATGTCGAGGCTACAATTTCATTGTTATTTTCTCATATCTTTGAAATTAGGCCTCTCCTTTTCATGCTTCAATTTTTCACATCAATATCTAGTAGATGGGGTAATTTGGAGCCCAGCAAACATCAAGGAGGGATAATCTGGAGCCTTTCTGAATAAAAAGATCCTTAATGAAATAAAACACAAATAAAAAAATTAAGCCCGAAGGCAAAGGGTCTCAGGATAGCTCTCTCTATCCAGGGAAATAGTAAGGGTGAACAAACCCTTTAATATTCTGGGGAGTGTTTAATAAGTCCTTAGAAAACTGGTTTGTTGCTATTATCCCACTTACAATCACAACTATTTTATAAAAGGGTCGGACAAAATAACCTATTTAAA
  3   1   2       bld Spl2 5g3  in                        CBSS8828.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCATTGGGAGAACTCTAGGTAAGAAAGGTCCCTGGCGCCATTACAATTTTTTCCCAAACAGAAGCACCAGTCTGGGGGAAAAGTTTTCTGGGTGGTTCACCTTTAAGTTAGCTTTTAGTTTGTTATAGAATGGCCACTTCTTAGCAACTTTTCAACTGGTCTTCATGCTATTAAAATTGTTTTTGGATTATTTGCCTTCCTCTTCTGCCTCTTTCCAGCTTTCAAACGGGGTTCACTGACCCCAGCAGTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCAG
  5   1   2       bld Gas       in                   TGas082h21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTCGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGAGTTTAATATGTCCTCTGATTATGGTGTCTTGCTATTATTTAACATACAATCACAACTA
  3   1   2       bld Gas       in                    TGas082h21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGGGGGAAAAGTTTTCTgggtggttcacctttaagttagcttttagtttgttatagaatggccacttcttagcaacttttcaactggtcttcatgctattaaaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTATAAACCAAAAAAAAAAAAAAAAA
  5  -1   2       bld Neu       out                  TNeu078p15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCATGCTATTAAaattgtttttggattatttgccttcctcttctgcctctttccagctttcaaacggggttcactgaccccagcagTGGCTACAATCTTGAGGCTACAATATCATTGTTATTTTCTAATATCTTTCTATTTAGGCCTCTCCTCTTCATACTTCAATCTTGCACATCACTATCTAGTTGCTAGGGTAATTTGGACCCCAGCAAACATATAGGTGCTATAAACTGGAGCATTGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAAAAAAAAAAAAAAAAAGCGGCC
  5   1   2       bld HdA                            THdA004l11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATATAGGTGCTATAAACTGGAGCATTNGCTGAATAAAAAGCTCAATAATGAAAAAAAACACAAATAAAAAAATGAAGACCTATTGCAAAGTGTCTCAGAATAGCACTCTCTATACATACTAATAGTAATGGTGAACAAACCCTTTAATATGCTGGGGAGTGTTTAATATGTCCTTTGATTATGGTTTCTTGCTATTATTTAACATACAATCACAACTATTTTATCCAACTCTCGGACAATATAACCTATTTATAAACCAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)