Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012072474 Xt7.1-CABK5902.3.5 - 87 ESTs
                                                                       ..-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABK5902.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTACTCTCCGCTATAGCCGCCTTGTCTCTGGTTCGTGGAGATATTTGACTTGTTTGGGAAGCACCCAGAACTTATTTGGAGTGTGGAGATAGATTTTGGTAGGCAAGATGGAAGAATCCCACAATGGTGTACAATATGGAGAAGATACAGCAGATGCAAAAACATATTTTACAAATCAGCAGATAAGCCTGCAAAACTGTGATATAAAAGACATGGAAAAAAAAACAAAGTTTGCTCATCTCCACAAGTACAGAACTGATTACCCTGAGATGGGAATTTGCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAATGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTTCATCCAGGCATGCAGGGGAACAGATCTTGATTCAGGCATTGAAACAGACAGTGGCAGTGAACCAGGGGAAGAGATTCAGCGGATTCCAGTTGAGGCTGACTTCTTATATGCCTATTCTACAGTTCCTGGGTACTATTCCTGGAGAAACACAATGAATGGTTCCTGGTTCATCCAGTCCTTGTGCGAAATGATAAAATTATATGGACCACATCTTGAACTTATCCAGATTCTGACCTGTGTAAATCATATGGTAGCTCTAGAATTTGAGTCTTGTTCAACTCAGCAAGCTTTTCATGCAAAGAAACAAATTCCTTGTGTTGTGTCCATGCTCACAAAAGCATTTTACTTTTTAAAGTAAAGAGAGGAATTTAGCACGTATATCGGCATCATGTAACAAAGGAGGATGCACCCAGCAGTCCATCGGCAATCAAATCTCATTTCATTCCATAGAAGTGGAACCTACAGTCATACTGAATCTGAAGATTTTGCAACAGACAAAAATAATAGTGAGTTCACATGCACAGTTATAGCTTTGGCAGTTTGCAGGTCAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTTACTTCTTGTTTAAATGAAGTACACTATCCAAATTCTGATTTTCAGATAATGAATCTGTTTAGTAGAAGCTGCATTTTATTGCAGTTATTGCAAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCACTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCACTCTCTTCTGCAGCTTCACATAGCTGCACTGACAGGCACAGCGCTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAATTGTACAGAACTGTGAATCCTGGTAGCTCTATATAAATAAAGTTATTCATACATCCATCCATACATCCATACATTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008223664                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTCCGCTATAGCCGCCTTGTCTCTGGTTTGTGGAGATATTTGACTTGTTTGGGAAGCACCCAGAACTTATTTGGAGTGTGGAGATAGATTTTGGTAGGCAAGATGGAAGAATCCCACAATGGTGTACAATATGGAGAAGATACAGCAGATGCAAAAACATATTTTACAAATCAGCAGATAAGCCTGCAAAACTGTGATATAAAAGACATGGAAAAAAAAACAAAGTTTGCTCATCTCCACAAGTACAGAACTGATTACCCTGAGATGGGAATTTGCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAATGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTTCATCCAGGCATGCAGGGGAACAGATCTTGATTCAGGCATTGAAACAGACAGTGGCAGTGAACCAGGGGAAGAGATTCAGCGGATTCCAGTTGAGGCTGACTTCTTATATGCCTATTCTACAGTTCCTGGGTACTATTCCTGGAGAAACACAATGAATGGTTCCTGGTTCATCCAGTCCTTGTGCGAAATGATAAAATTATATGGACCACATCTTGAACTTATCCAGATTCTGACCTGTGTAAATCATATGGTAGCTCTAGAATTTGAGTCTTGTTCAACTCAGCAAGCTTTTCATGCAAAGAAACAAATTCCTTGTGTTGTGTCCATGCTCACAAAAGCATTTTACTTTTTAAAGTAAAGAGAGGAATTTAGCACGTATATCGGCATCATGTAACAAAGGAGGATGCACCCAGCAGTCCATCGGCAATCAAATCTCATTTCATTCCATAGAAGTGGAACCTACAGTCATACTGAATCTGAAGATTTTGCAACAGACAAAAATAATAGTGAGTTCACATGCACAGTTATAGCTTTGGCAGTTTGCAGGTCAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTTACTTCTTGTTTAAATGAAGTACACTATCCAAATTCTGATTTTCAGATAATGAATCTGTTTAGTAGAAGCTGCATTTTATTGCAGTTATTGCAAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCACTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCACTCTCTTCTGCAGCTTCACATAGCTGCACTGACAGGCACAGCGCTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAATTGTACAGAACTGTGAATCCTGGTAGCTCTATATAAATAAAGTTATTCATACATCCATCCATACATCCATACATTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                          2     3     2     3     2     3     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     7     6     8     6     8     6     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     9     7     9     6     9     8     9     8     9     8     9     8     9     8     9     8     9     9    10     9    10     8    10     8    10     8    10     8    10     8    11     7    10     7    10     7    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     9    11     8    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     7     9     6     6     5     6     4     6     4     6     4     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     7     4     7     4     7     4     7     6     8     7     8     7     8     7     8     7     8     8     9     7     9     7    10     8    10     8    10     8    10     8    10     9    11     8     9     8     9     7     9     8    10     8    10     8    10     9    11    10    11    10    11    10    11    10    11    10    11    11    12    10    12    10    12    10    12     9    11     9    11     8    10     8    10     9    12    10    11    10    11    10    11    10    11    11    12    11    13    11    13    11    13    12    14    12    14    12    14    12    13    12    13    12    13    12    13    11    13    13    14    13    15    14    15    13    15    14    16    14    16    13    16    14    16    14    16    15    17    14    16    13    16    15    17    16    18    14    17    16    19    16    19    13    18    14    18    15    19    15    19    15    20    15    19    15    18    14    18    13    18    13    18    13    17    13    17    13    17    15    18    15    18    15    18    15    18    17    18    16    18    16    18    17    19    17    19    17    19    17    18    16    18    16    18    15    18    15    18    17    20    17    20    17    20    16    19    16    19    16    20    18    21    16    19    16    19    17    20    18    20    18    19    20    23    24    27    24    27    23    26    24    29    25    31    29    33    29    34    30    35    33    38    34    39    34    40    34    40    35    41    36    41    36    43    36    43    35    43    35    44    35    44    37    45    37    46    36    46    35    45    37    46    34    44    34    44    36    45    35    44    35    44    34    43    40    43    42    44    42    44    42    44    41    44    41    44    40    43    40    43    40    44    40    44    41    44    41    44    39    44    39    44    40    46    41    46    41    46    39    45    39    44    39    42    40    43    40    43    39    42    38    41    38    41    37    41    37    41    38    41    38    41    38    41    38    41    38    41    35    41    33    41    35    41    34    41    33    40    34    40    29    40    27    40    26    38    26    36    19    30     8    10     3     3
  5   1   2  SIG                                      Xt7.1-XZG40554.5                                                                                                                                                                                                                                                                                                                                                                                                                     AAACACGCCAGACACAAAAGCAGCAAGGAAGGAACGGAGCAGCCTGTACTGTACTCTCCGCTATAGCCGCCTTGTCTCTGGTTCGTGGAGATATTTGACTTGTTTGGGAAGCACCCAGAACTTATTTGGAGTGTGGAGATAGATTTTGGTAGGCAAGATGGAAGAATCCCACAATGGTGTACAATATGGAGAAGATACAGCAGATGCAAAAACATATTTTACAAATCAGCAGATAAGCCTGCAAAACTGTGATATAAAAGACATGGAAAAAAAAACAAAGTTTGCTCATCTCCACAAGTACAGAACTGATTACCCTGAGATGGGAATTTGCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAATGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTTGTGGGGTTTATTTGTCAATAAATGTCCTTTACATATTCAGCAGGCAAACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTAAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTTTTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABK5902.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGTTTGTGGAGATATTTGACTTGTTTGGGAAGCACCCAGAACTTATTTGGAGTGTGGAGATAGATTTTGGTAGGCAAGATGGAAGAATCCCACAATGGTGTACAATATGGAAAAGATACAGCAGATGCAAAAACATATTTTACAAATCAGCAGATAAGCCTGCAAAACTGTGATATAAAAGACATGGAAAAAAAAACAAAGTTTGCTCATCTCCACAAGTACAGAACTGATTACCCTGAGATGGGAATTTGCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAATGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTTCATCCAGGCATGCAGGGGAACAGATCTTGATTCAGGCATTGAAACAGACAGTGGCAGTGAACCAGGGGAAGAGATTCAGCGGATTCCAGTTGAGGCTGACTTCTTATATGCCTATTCTACAGTTCCTGGGTACTATTCCTGGAGAAACACAATGAATGGTTCCTGGTTCATCCAGTCCTTGTGCGAAATGATAAAATTATATGGACCACATCTTGAACTTATCCAGATTCTGACCTGTGTAAATCATATGGTAGCTCTAGAATTTGAGTCTTGTTCAACTCAGCAAGCTTTTCATGCAAAGAAACAAATTCCTTGTGTTGTGTCCATGCTCACAAAAGCATTTTACTTTTTAAAGTAAAGAGAGGAATTTAGCACGTATATCGGCATCATGTAACAAAGGAGGATGCACCCAGCAGTCCATCGGCAATCAAATCTCATTTCATTCCATAGAAGTGGAACCTACAGTCATACTGAATCTGAAGATTTTGCAACAGACAAAAATAATAGTGAGTTCACATGCACAGTTATAGCTTTGGCAGTTTGCAGGTCAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTTACTTCTTGTTTAAATGAAGTACACTATCCAAATTCTGATTTTCAGATAATGAATCTGTTTAGTAGAAGCTGCATTTTATTGCAGTTATTGCAAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCACTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCACTCTCTTCTGCAGCTTCACATAGCTGCACTGACAGGCACAGCGCTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAATTGTACAGAACTGTGAATCCTGGTAGCTCTATATAAATAAAGTTATTCATACATCCATCCATACATCCATACATTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TACATCAAACCTTGTAAATGTTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACTTGAAAATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATGCAAGACAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTATGTAGTTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGTGTTTTGTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTAGTTGTAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTGATGATGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGATCGTGGACAGTAGATTCTTTTTTTTAACATTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTAAAGCATGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATAGTAAAGCATGTTTTCTGTAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGTATGTTTAC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------G-----
                                               BLH ATG     109     136                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH MIN     109     100                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH OVR     109     603                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               ORF LNG     109      36                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ci ---- 6e-024     AAP91733.1 caspase-1-like [Ciona intestinalis] ---------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ce ---- 5e-034     NP_502538.1 cell death protein, Caspase, ICE-like apoptotic protease., CEll Deathabnormality CED-3 (56.6 kD) (ced-3) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 4e-050     NP_524551.2 Ice CG7788-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 8e-053     XP_001184097.1 PREDICTED: similar to Lice2 cysteine protease [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Bf ---- 5e-065     AAN45849.1 amphiCASP-3/7 [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Xt ---- 7e-078     NP_001016299.1 hypothetical protein LOC549053 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 8e-089     NP_116786.1 caspase 3 preproprotein; Yama; apopain; PARP cleavage protease; cysteineprotease CPP32; SREBP cleavage activity 1 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Dr ---- 8e-091     NP_001041531.1 hypothetical protein LOC566604 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Mm ---- 2e-091     NP_033940.1 caspase 3, apoptosis related cysteine protease [Mus musculus] ---=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Gg ==== 2e-095     NP_990056.1 caspase-3 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 8e-133     NP_001081225.1 xcpp32 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 6e-136     AAH98991.1 Unknown (protein for MGC:114987) [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABK5902.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAG---------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------TAA------------------------------ATGTAA---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------TGA------------------TGA---------------------TAGTAG---------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------ATG---------------------------------------------------------------------------------------------TAG---------------TAA------TGA------ATG------------------------TAG---ATGTAA---------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------ATG------------------------------------------TGA------------TAA------------------TGA---------------------------TAG---------------------------------------TAA------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------TGA---------------------------TGA---------------------------------------TAG---------------------------------TAA---------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------TAG---------------------------TGA------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------ATGTAG---------------------------------------------------------TAATGA------------------TGA---------------------------------------TAA---TGAATGATG---------------------------TAA---------------ATG---------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2  SIG                                      Xt7.1-XZG40554.5                                                                                                                                                                                                                                                                                                                                                                                                                     AAACACGCCAGACACAAAAGCAGCAAGGAAGGAACGGAGCAGCCTGTACTGTACTCTCCGCTATAGCCGCCTTGTCTCTGGTTCGTGGAGATATTTGACTTGTTTGGGAAGCACCCAGAACTTATTTGGAGTGTGGAGATAGATTTTGGTAGGCAAGATGGAAGAATCCCACAATGGTGTACAATATGGAGAAGATACAGCAGATGCAAAAACATATTTTACAAATCAGCAGATAAGCCTGCAAAACTGTGATATAAAAGACATGGAAAAAAAAACAAAGTTTGCTCATCTCCACAAGTACAGAACTGATTACCCTGAGATGGGAATTTGCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAATGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTTGTGGGGTTTATTTGTCAATAAATGTCCTTTACATATTCAGCAGGCAAACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTAAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTTTTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008281136                                                                                                                                                                                                                                                                                                                                                                                                                           GCCAGACACAAAAGCAGCAAGGAAGGAACGGAGCAGCCTGTACTGTACTCTCCGCTATAGCCGCCTTGTCTCTGGTTCGTGGAGATATTTGACTTGTTTGGGAAGCACCCAGAACTTATTTGGAGTGTGGAGATAGATTTTGGTAGGCAAGATGGAAGAATCCCACAATGGTGTACAATATGGAGAAGATACAGCAGATGCAAAAACATATTTTACAAATCAGCAGATAAGCCTGCAAAACTGTGATATAAAAGACATGGAAAAAAAAACAAAGTTTGCTCATCTCCACAAGTACAGAACTGATTACCCTGAGATGGGAATTTGCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAATGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTTGTGGGGTTTATTTGTCAATAAATGTCCTTTACATATTCAGCAGGCAAACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTAAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTTTTTTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   4      seed Tbd0 PIPE in                     NISC_nl23c12.y1                                                                                                                                                                                                                                                                                                                                                                                                                     AAACACGCCAGACACAAAAGCAGCAAGGAAGGAACGGAGCAGCCTGTACTGTACTCTCCGCTATAGCCGCCTTGTCTCTGGTTCGTGGAGATATTTGACTTGTTTGGGAAGCACCCAGAACTTATTTGGAGTGTGGAGATAGATTTTGGTAGGCAAGATGGAAGAATCCCACAATGGTGTACAATATGGAGAAGATACAGCAGATGCAAAAACATATTTTACAAATCAGCAGATAAGCCTGCAAAACTGTGATATAAAAGACATGGAAAAAAAAACAAAGTTTGCTCATCTCCACAAGTACAGAACTGATTACCCTGAGATGGGAATTTGCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAATGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTT
  5   1   2       ext Gas7      in                         XZG40554.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTTGTGGGGTTTATTTGTCAATAAATGTCCTTTACATATTCAGCAGGCAAACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTAAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGTACATCAAACCTTGTAAATGTTATAAATCTACAAATACTTGAAAATTCATGGCAGACATTTCCTATTTATAAACTTGAAAAAAAACAAAAAAAAAAAAAAAAAAAGG
  3   1   2       ext Gas7      in                         XZG40554.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCACTCCTTTTGTGGGGTTTATTTGTCAATAAATGTCTTTTACATATTCAGCAGGCAAACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTAAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACC
  3   1   2       ext Gas7      in                         XZG31015.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACGCGTCCGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTAAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGT
  5   1   2       ext Gas7      in                         XZG31015.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAACAACAGACATTACACACCGCGTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTAAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTAAAAAAAAAAAAAAAAAAG
  3   1   4      seed Tbd0 PIPE in                     NISC_nl23c12.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTAGGGGTAAAACCCTTATGTTGCATGTTTTTGAAGCCCCAGTTTTTCAGTAGTGTTAGAACTATATTTTTGTGGGAACGTTTTTGGTTTTTGTTTGTACATCAAACCTTGTAAATGTTATAAAATTTCCAAATTCTTGAAAATTCATGCAAGACATTTTTTTTTTTTTTAACTTGAAAAAAAATTTGAAAAAATGAAAAGGATTTTTTTAAAGGAAGGTATGTAGTTAAATGGGCTGTTGTGGTGTTTTGTGTCCCAATTTAAGATTTTTAAAGGGAAGCTTTAATGAATTAGTTGTAGAAGCCTTTGAAATGTTGATGATGAATCGTGGCCAGTAGATTTTTTTTTTTACCCTTGAATGATGAAAGGGTTTAGTAAAGCATGTTTTTTGTAAAGGGGGGTTTTAAATATGTATGTTTACAAGGGCAGGGTCATTAAAATGTTTTTTGTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  5   1   2  SIG                                      Xt7.1-CABK5902.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGTTTGTGGAGATATTTGACTTGTTTGGGAAGCACCCAGAACTTATTTGGAGTGTGGAGATAGATTTTGGTAGGCAAGATGGAAGAATCCCACAATGGTGTACAATATGGAAAAGATACAGCAGATGCAAAAACATATTTTACAAATCAGCAGATAAGCCTGCAAAACTGTGATATAAAAGACATGGAAAAAAAAACAAAGTTTGCTCATCTCCACAAGTACAGAACTGATTACCCTGAGATGGGAATTTGCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAATGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTTCATCCAGGCATGCAGGGGAACAGATCTTGATTCAGGCATTGAAACAGACAGTGGCAGTGAACCAGGGGAAGAGATTCAGCGGATTCCAGTTGAGGCTGACTTCTTATATGCCTATTCTACAGTTCCTGGGTACTATTCCTGGAGAAACACAATGAATGGTTCCTGGTTCATCCAGTCCTTGTGCGAAATGATAAAATTATATGGACCACATCTTGAACTTATCCAGATTCTGACCTGTGTAAATCATATGGTAGCTCTAGAATTTGAGTCTTGTTCAACTCAGCAAGCTTTTCATGCAAAGAAACAAATTCCTTGTGTTGTGTCCATGCTCACAAAAGCATTTTACTTTTTAAAGTAAAGAGAGGAATTTAGCACGTATATCGGCATCATGTAACAAAGGAGGATGCACCCAGCAGTCCATCGGCAATCAAATCTCATTTCATTCCATAGAAGTGGAACCTACAGTCATACTGAATCTGAAGATTTTGCAACAGACAAAAATAATAGTGAGTTCACATGCACAGTTATAGCTTTGGCAGTTTGCAGGTCAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTTACTTCTTGTTTAAATGAAGTACACTATCCAAATTCTGATTTTCAGATAATGAATCTGTTTAGTAGAAGCTGCATTTTATTGCAGTTATTGCAAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCACTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCACTCTCTTCTGCAGCTTCACATAGCTGCACTGACAGGCACAGCGCTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAATTGTACAGAACTGTGAATCCTGGTAGCTCTATATAAATAAAGTTATTCATACATCCATCCATACATCCATACATTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008281138                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTGGAGATATTTGACTTGTTTGGGAAGCACCCAGAACTTATTTGGAGTGTGGAGATAGATTTTGGTAGGCAAGATGGAAGAATCCCACAATGGTGTACAATATGGAAAAGATACAGCAGATGCAAAAACATATTTTACAAATCAGCAGATAAGCCTGCAAAACTGTGATATAAAAGACATGGAAAAAAAAACAAAGTTTGCTCATCTCCACAAGTACAGAACTGATTACCCTGAGATGGGAATTTGCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAATGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTTCATCCAGGCATGCAGGGGAACAGATCTTGATTCAGGCATTGAAACAGACAGTGGCAGTGAACCAGGGGAAGAGATTCAGCGGATTCCAGTTGAGGCTGACTTCTTATATGCCTATTCTACAGTTCCTGGGTACTATTCCTGGAGAAACACAATGAATGGTTCCTGGTTCATCCAGTCCTTGTGCGAAATGATAAAATTATATGGACCACATCTTGAACTTATCCAGATTCTGACCTGTGTAAATCATATGGTAGCTCTAGAATTTGAGTCTTGTTCAACTCAGCAAGCTTTTCATGCAAAGAAACAAATTCCTTGTGTTGTGTCCATGCTCACAAAAGCATTTTACTTTTTAAAGTAAAGAGAGGAATTTAGCACGTATATCGGCATCATGTAACAAAGGAGGATGCACCCAGCAGTCCATCGGCAATCAAATCTCATTTCATTCCATAGAAGTGGAACCTACAGTCATACTGAATCTGAAGATTTTGCAACAGACAAAAATAATAGTGAGTTCACATGCACAGTTATAGCTTTGGCAGTTTGCAGGTCAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTTACTTCTTGTTTAAATGAAGTACACTATCCAAATTCTGATTTTCAGATAATGAATCTGTTTAGTAGAAGCTGCATTTTATTGCAGTTATTGCAAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCACTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCACTCTCTTCTGCAGCTTCACATAGCTGCACTGACAGGCACAGCGCTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAATTGTACAGAACTGTGAATCCTGGTAGCTCTATATAAATAAAGTTATTCATACATCCATCCATACATCCATACATTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTAAAAAAAAAAAAAAAAAAAAAGG
  5   1   2       add Tad5      in                         XZT38931.5p                                                                                                                                                                                                                                                                                                                                                                                                         gatcttctcccgataacccccacctatgggtgggcggtatcgggcgaatccaggctaattcggtcgtAGAGTAGAGCGCTTAAATTCTGCAGTGGCTGGAAGGCTATAGCTAGGGCACTATGGATTATCTGGGGTGGCAGGTGAGTAAGGTAGGAATTTGTTCATGATAATGCAGGTAACAGGGACATCTTTAATAGTATTTTTCATAGTTTGGATTTAGCTGTATTCTTTTGTTTATAGAATACAGATGTATACAATGTTTTTATCTTTTTACAATACAGCATTATGACAGTACAGGTTCAATCAGATTTAAAGACTTGCTTGTTCCAGTTACCATGCAGCCCTGTCCATTTTTGTGCAGGGCTGTTTCGTCATTTATAAATTTGATTTGACATTAAATCGAGAAGGGGTGCATAAAATGATTTTTTTAAGTTAAAAATGTTACTAACAATTTAGCATCAAGTAAAAGTAACACAGAACCAGTGATTCATTATGTAATTTTTTTTCAGTGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTTCATCCAGGCATGCAGGGGAACAGATCTTGATTCAGGCATTGAAACAGACAGTGGCAGTGAACCAGGNGAAGAGATTCAGCGGATTCCAGTTGAGGCTGACTTCTTATATGCCTATTCTACAGTTCCTGGGTACTATTCCTGG
  5   1   2   20  ext Mus1 5g                             CABH11127.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGTACTCTCCGCTATAGCCGCCTTGTCTCTGGTTTGTGGAGATATTTGACTTGTTTGGGAAGCACCCAGAACTTATTTGGAGTGTGGAGATAGATTTTGGTAGGCAAGATGGAAGAATCCCACAATGGTGTACAATATGGAAAAGATACAGCAGATGCAAAAACATATTTTACAAATCAGCAGATAAGCCTGCAAAACTGTGATATAAAAGACATGGAAAAAAAAACAAAGTTTGCTCATCTCCACAAGTACAGAACTGATTACCCTGAGATGGGAATTTGCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAATGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTTCATCCAGGCATGCAGGGGAACAGATCTTGATTCAGGCATTGAAACAGACAGTGGCAGTGAACCAGGNGAAGAGATTCAGCGGATTCCAGTTGAGGCTGACTTCTTATATGCCTATTCTACAGTTCCTGGGTACTATTCCTGGAGAAACACAATGAATGGTTCCTGGTTCATCCAGTCCTTGTGCGAAATGATAAAATTATATGGACCACATCTTGAACTTATCCAGATTCTGACCTGTGTAAATCATATGGT
  5   1   4   10 seed Hrt1 5g3  in                          CAAQ483.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGTTTGTGGAGATATTTGACTTGTTTGGGAAGCACCCAGAACTTATTTGGAGTGTGGAGATAGATTTTGGTAGGCAAGATGGAAGAATCCCACAATGGTGTACAATATGGAGAAGATACAGCAGATGCAAAAACATATTTTACAAATCAGCAGATAAGCCTGCAAAACTGTGATATAAAAGACATGGAAAAAAAAACAAAGTTTGCTCATCTCCACAAGTACAGAACTGATTACCCTGAGATGGGAATTTGCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAATGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTTCATCCAGGCATGCAGGGGAACAGATCTTGATTCAGGCATTGAAACAGACAGTGGCAGTGAACCAGGNGAAGAGATTCAGCGGATTCCAGTTGAGGCTGACTTCTTATATGCCTATTCTACAGTTCCTGGGTACTATTCCTGGAGAAACACAATGAATGGTTCCTGGTTCATCCAGTCCTTGTGCGANATGATAAAATTATATGGACCACATCTTGAACTTATCCAGATTCTGACCTGTGTAAATCATATGGTAGCTCTAGAATTTGAGTCTTTGTCACTCAGCAGCTTTTCATGCAAAGAAACAAATTC
  5   1   2   30  add Hrt1 5x3  out                        CAAQ8269.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGATATTTGACTTGTTTGGGAAGCACCCAGAACTTATTTGGAGTGTGGAGATAGATTTTGGTAGGCAAGATGGAAGAATCCCACAATGGTGTACAATATGGAGAAGATACAGCAGATGCAAAAACATATTTTACAAATCAGCAGATAAGCCTGCAAAACTGTGATATAAAAGACATGGAAAAAAAAACAAAGTTTGCTCATCTCCACAAGTACAGAACTGATTACCCTGAGATGGGAATTTGCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAAGTAAGTGTGGGCCTCAGTTCACCAGTGTGTTACATGAATATATTCTTTTCAGCTTAGAACTCTTTGTACTGCTGATAGCCCTAGGCAGTTCTGCCTTTAGCGGTTGTGGACCTAAATGTAAAAAAAAAAATTCTGGGAATTATTATTTATATAATATATTTAACTCCAGCCTACAAGCTTTTAGCTGTTTTAACAACACCCACCTGCAGCTGCTGCTACTGCCAAAAACAACTGAAAGGAGACATGTTGGGCAACTCTCATATGTTGCAATATTAGCCTACTATAAATTTTATCCTACTGCCCCAGTCCTATCCCACGGGCTACAGCTGCTTACACATGTAAGATATATTCTGGTGCATTACTGAATGTTCTTACTCTTTCTTACCTAAAACTGGTTTCTGGCCCTGAATGTGCAGGGCTC
  5   1   2       add Gas7      in                         XZG25952.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATATTTTACAAATCAGCAGATAAGCCTGCAAAACTGTGATATAAAAGACATGGAAAAAAAAACAAAGTTTGCTCATCTCCACAAGTACAGAACTGATTACCCTGAGATGGGAATTTGCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAATGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTTCATCCAGGCATGCAGGGGAACAGATCTTGATTCAGGCATTGAAACAGACAGTGGCAGTGAACCAGGGGAAGAGATTCAGCGGATTCCAGTTGAGGCTGACTTCTTATATGCCTATTCTACAGTTCCTGGGTACTATTCCTGGAGAAACACAATGAATGGTTCCTGGTTCATCCAGTCCTTGTGCGAAATGATAAAATTATATGGACCACATCTTGAACTTATCCAGATTCTGACCTGTGTAAATCATAT
  5   1   2       add In62                            IMAGE:8952827.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAAAGTTAATTAAACCTATCTCACTCAATTCGAATTCGTCCCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAATGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTTCATCCAGGCATGCAGGGGAACAGATCTTGATTCAGGCATTGAAACAGACAGTGGCAGTGAACTAGGGGAAGAGATTCAGCGGATTCCAGTTGAGGCTGACTTCTTATATGCCTATTCTACAGTTCCTGGGTACTATTCCTGGAGAAACACAATGAATGGTTCCTGGTTCATCCAGTCCTTGTGCGAAATGATAAAATTATATGGACCACATCTTGAACTTATCCAGATTCTGACCTGTGTAAATCATATGGTAGCTCTAGAAATTTGAGTCTTGTTCAACTCAGCAAGCTTTTCATGCAAAGAAACAAATTCCTTGTGTTGTGTCCATGCTCACAAAAGCATTTTACTTTTTAAAAGTAAAGAGAGGAATTTAGCACGTATATCGGCATCATGTAACAAAGGAGGATGCACCCAGCAGTCCATCGGCAATCAATCTCATTTCATTCCATAAGAGTGAACCTACAGGTCATACTGATCTGAAGATTTTGCTACAGAAAAAAATATAATGAGTCCAATGCACAGTTATAGCCTTGGCCAGGTTTGCAGTCGGAACCTACTAGCCCATCATGTAACTAGTTAACGGTGGAGATACCATCCGAACCTTACTCCTCTTCGAAGT
  5   1   3        nb Fat1      in                         CABC7331.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAGTACAGAACTGATTACCCTGAGATGGGAATTTGCCTCATCATTAACAATAAGAATTTTCAGTCATCTACAAACATGGGAGTACGAAATGGTACTGATGTGGATGCTCGCAAGTTACATGAAACTTTCACAGGTTTGGGATACAAAGTAAAGGTTTGCAATGATCAAAAGTCTAACGACATCTTTACACTTTTGAAAAAAATGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTTCATCCAGGCATGCAGGGGAACAGATCTTGATTCAGGCATTGAAACAGACAGTGGCAGTGAACCAGGGGAAGAGATTCAGCGGATTCCAGTTGAGGCTGACTTCTTATATGCCTATTCTACAGTTCCTGGGTACTATTCCTGGAGAAACACAATGAATGGTTCCTGGTTCATCCAGTCCTTGTGCGAAATGATAAAATTATATGGACCACATCTTGAACTTATCCAGATTCTGACCTG
  5   1   2       add Tad5                                 XZT44469.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACAGAACCAGTGATTCATTATGTAATTTTTTTTCAGTGTCCGAGGAAGATCATAGCAAGAGAAGCTCCTTTGTATGTGCTATATTGAGCCATGGAGAAGATGGTTTGGTTTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTTCATCCAGGCATGCAGGGGAACAGATCTTGATTCAGGCATTGAAACAGACAGTGGCAGTGAACCAGGGGAAGAGATTCAGCGGATTCCAGTTGAGGCTGACTTCTTATATGCCTATTCTACAGTTCCTGGGTACTATTCCTGGAGAAACACAATGAATGGTTCCTGGTTCATCCAGTCCTTGTGCGAAATGATAAAATTATATGGACCACATCTTGAACTTATCCAGATTCTGACCTGTGTAAATCATATGGTAGCTCTAGAATTTGAGTCTTGTTCAACTCAGCAAGCTTTTCATGCAAAGAAACAAATTCCTTGTGTTGTGTCCATGCTCACAAAAGCATTTTACTTTTTAAAGTAAAGAGAGGAATTTAGCACGTATATCGGCATCATGTAACAAAGGAGGATGCACCCAGCAGTCCATCGGCAATCAAATCTCATTTCATTCCATAGAAGTGGAACCTACAGTCATACTGAATCTAAAGATTTTGCAACAGACAAAAATAATAGTGAGTTCACATGCACAGTTATAGCTTTGGCAGTTTGCAGGTCAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTTACTTCTT
  5   1   2       ext Ovi1      in                         CABI3883.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTATGGAGTTGATGGTCCTATACAAATAAAAAACCTAACAGATCTCTTCAGAGGAGACAGATGCAAGACTCTTGTGGGAAAGCCCAAACTATTCTTCATCCAGGCATGCAGGGGAACAGATCTTGATTCAGGCATTGAAACAGACAGTGGCAGTGAACCAGGGGAAGAGATTCAGCGGATTCCAGTTGAGGCTGACTTCTTATATGCCTATTCTACAGTTCCTGGGTACTATTCCTGGAGAAACACAATGAATGGTTCCTGGTTCATCCAGTCCTTGTGCGAAATGATAAAATTATATGGACCACATCTTGAACTTATCCAGATTCTGACCTGTGTAAATCATATGGTAGCTCTAGAATTTGAGTCTTGTTCAACTCAGCAAGCTTTTCATGCAAAGAAACAAATTCCTTGTGTTGTGTCCATGCTCACAAAAGCATTTTACTTTTTAAAGTAAAGAGAGGAATTTAGCACGTATATCGGCATCATGTAACAAAGGAGGATGCACCCAGCAGTCCATCGGCAATCAAATCTCATTTCATTCCATAGAAGTGGAACCTACAGTCATACTGAATCTGAAGATTTTGCAACAGACAAAAATAATAGTGAGTTCACATGCACAGTTATAGCTTTGGCAGTTTGCAGGTCAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTTACTTCTTGTTTAAATGAAGTACACTATCCAAATTCTGATTTTCAGATAATGAATCTGTTTAGTAGAAGCTGCATTTTATTGCAGTTATTGCAAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCACTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGC
  5   1   2       add In60                            IMAGE:8952092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAACCTCATTTACAAAAAATTATAAAAATAAAAAAACGTCCATCTTGATTCAGGCATTGAAACAGACAGTGGCAGTGAACCAGGGGAAGAGATTCAGCGGATTCCAGTTGAGGCTGACTTCTTATATGCCTATTCTACAGTTCCTGGGTACTATTCCTGGAGAAACACAATGAATGGTTCCTGGTTCATCCAGTCCTTGTGCGAAATGATAAAATTATATGGACCACATCTTGAACTTATCCAGATTCTGACCTGTGTAAATCATATGGTAGCTCTAGAATTTGAGTCTTGTTCAACTCAGCAAGCTTTTCATGCAAAGAAACAAATTCCTTGTGTTGTGTCCATGCTCACAAAAGCATTTTACTTTTTAAAGTAAAGAGAGGAATTTAGCACGTATATCGGCATCATGTAACAAAGGAGGATGCACCCAGCAGTCCATCGGCAATCAAATCTCATTTCATTCCATAGAAGTGGAACCTACAGTCATACTGAATCTGAAGATTTTGCAACAGACAAAAATAATAGTGAGTTCACATGCACAGTTATAGCTTTGTGGCAGTTTGCAGGTCAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTTACTTCTTGTTTAAATGAAGTACACTATCCAAATTCTGATTTTCAGATAATGAATCTGTTTAGTAGAAGCTGCATTTTATTGCAGTTATTGCAAAGGGAGATTGCTTTAAATAATTGCCATACCCCAGGCACTAGATCAGTTTTATTCAACTAGGCCACAGTCTCTGCTGTGTTTGTAGCAGGGGGAGAGAGCCGATTCACTCTCTTCTGCAGCTTCACATAGCCTGCACTGAACAGCACAAGCACTGGACTGCATGCAGCCTA
  3  -1   2       ext Ski1      in                         CABJ7184.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAGTTCCTGGGTACTATTCCTGGAGAAACACAATGAATGGTTCCTGGTTCATCCAGTCCTTGTGCGAAATGATAAAATTATATGGACCACATCTTGAACTTATCCAGATTCTGACCTGTGTAAATCATATGGTAGCTCTAGAATTTGAGTCTTGTTCAACTCAGCAAGCTTTTCATGCAAAGAAACAAATTCCTTGTGTTGTGTCCATGCTCACAAAAGCATTTTACTTTTTAAAGTAAAGAGAGGAATTTAGCACGTATATCGGCATCATGTAACAAAGGAGGATGCACCCAGCAGTCCATCGGCAATCAAATCTCATTTCATTCCATAGAAGTGGAACCTACAGTCATACTGAATCTGAAGATTTTGCAACAGACAAAAATAATAGTGAGTTCACATGCACAGTTATAGCTTTGGCAGTTTGCAGGTCAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTTACTTCTTGTTTAAATGAAGTACACTATCCAAATTCTGATTTTCAGATAATGAATCTGTTTAGTAGAAGCTGCATTTTATTGCAGTTATTGCAAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCACTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCACTCTCTTCTGCAGCTTCACATAGCTGCACTGACAGGCACAGCGCTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGC
  3   1   2       add Gas       in                    TGas120l22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACTGAATCTGAAGATTTTGCAACAGACAAAAATAATAGTGAGTTCACATGCACAGTTATAGCTTTGGCAGTTTGCAGGTCAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTTACTTCTTGTTTAAATGAAGTACACTATCCAAATTCTGATTTTCAGATAATGAATCTGTTTAGTAGAAGCTGCATTTTATTGCAGTTATTGCAAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCACTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGCCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCAC
  5   1   2       add Gas       in                   TGas120l22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACTGAATCTGAAGATTTTGCAACAGACAAAAATAATAGTGAGTTCACATGCACAGTTATAGCTTTGGCAGTTTGCAGGTCAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTTACTTCTTGTTTAAATGAAGTACACTATCCAAATTCTGATTTTCAGATAATGAATCTGTTTAGTAGAAGCTGCATTTTATTGCAGTTATTGCAAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCACTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCACTCTCTTCTGCAGCTTCA
  5   1   3        nb Neu                            TNeu134b15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAACCTACAGTCATACTGAATCTGAAGATGGGGGGCGGGCAAAAATATAGTGAGTTCACATGCACAGTTATAGCTTTGGCAGTTTGCAGGTGAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTTACTTCTTGTGTAAATGAAGTACACTATCCAAATGGTGAGTGTCAGATAATGAATCTGTTTAGTAGAAGCTGCATTTTATTGCGGTTATTGCGAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCGCTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGCCTGTGTTTTGTAGGCGGGGGGAGAGAACAATCCACTCTCTTCTGCAGCTTCACATACTGCACTGACAGGCACAGCGCTGGCCTGCATGCAGCTACACAGAGCACAGATGCGAATGCATTTTTTTCCACATTTT
  5   1   3        nb Gas7      in                         XZG57090.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACATGCACAGTTATAGCTTTGGCAGTTTGCAGGTCAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTTACTTCTTGTTTAAATGAAGTACACTATCCAAATTCTGATTTTCAGATAATGAATCTGTTTAGTAGAAGCTGCATTTTATTGCAGTTATTGCAAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCACTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCACTCTCTTCTGCAGCTTCACATAGCTGCACTGACAGGCACAGCGCTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATNCAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAATTGTACAGAACTGTGAATCCTGGTAGCTCTATA
  5   1   2       add In62                            IMAGE:8953986.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCCAGAAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTTACTTCTTGTTTAAATGAAGTACACTATCCAAATTCTGATTTTCAGATAATGAATCTGTTTAGTAGAAGCTGCATTTTATTGCAGTTATTGCAAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCACTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCACTCTCTTCTGCAGCTTCACATAGCTGCACTGACAGGCACAGCGCTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATACATATATTCATACATTAAATTGTACAGAACTGTGATCCTGTAGCTCTATATAAATAAGTTATCATACATCATCATCATACTACATACTACATTACTCTACGATTTTCTCATAGAATCATGACTGATACACAGCACAATAATAACCTAAGCTGGCACTGTCAGTTTGACCGGAAGCCGGTTTTGGGAAAAGGCTAAC
  5   1   2       add Tad5                                 XZT38886.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCCGACTTTACTTCTTGTTTAAATGAAGTACACTATCCAAATTCTGATTTTCAGATAATGAATCTGTTTAGTAGAAGCTGCATTTTATTGCAGTTATTGCAAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCACTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCACTCTCTTCTGCAGCTTCACATAGCTGCACTGACAGGCACAGCACTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCGCCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTAAAATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAATTGTACAGAACTGTGAATCCTGGTAGCTCTATATAAATAAATTTATTCATACATCCATCAATCCATACATTACTCTACAGATTTTCTCCATA
  5   1   2       add In62                            IMAGE:8956928.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTTTTTTTTAAAGCTAATAATGCAATTATTTTAAATATACCCTTTTTTGCGTTATTGAAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCACTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCACTCTCTTCTGCAGCTTCACATAGCTGCACTGACAGGCACAGCGCTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAATTGTACAGAACTGTGAATCCTGTAGCTCTATATAAATAAGTTATTCATACATCCATCAATCCATACATACATACATACATTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATTATTAAACTAGGGTTGCACTTGTCAGATTTGACCCGGACGCCGGTTTTTGAAAGCTACTTGCTTCAAGCAGTAACATCTCAGTACATTACCTGGGTGATCGGTGAGAGTACTTGTGTTTCTC
  5   1   2       add Gas7      in                         XZG42354.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTATTGCAGTTATTGCAAAGGAGATTGCTTTAAAATAATTGCCATACCCCCAGGCACTAGATCAGTTTTATTCAAACTTAGGCCACAGTCTCTGCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCACTCTCTTCTGCAGCTTCACATAGCTGCACTGACAGGCACAGCGCTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAATtgtacagaactgtgaatcctggtagctctatataaataaagttattcatacatccatcaatccatacatacatacATACATTACTCTACAGATTTTCTCCATAAGANACCATGACTGTATACCAACAG
  5   1   2       ext Spl1      in                         CABK5902.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAACTTAGGCCACAGTCTCTGCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCACTCTCTTCTGCAGCTTCACATAGCTGCACTGACAGGCACAGCGCTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAattgtacagaactgtgaatcctggtagctctatataaataaagttattcatacatccatccatacatccatacatTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAG
  5   1   3        nb Tad5      in                         XZT24117.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGTCTCTGCCTGTGTTTTGTAGGCAGGGGGAGAGAAGCAGATCCACTCTCTTCTGCAGCTTCACATAGCTGCACTGACAGGCACAGCGCTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAattgtacagaactgtgaatcctggtagctctatataaataaagttattcatacatccatccatacatccatacatTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGA
  5   1   2       ext Lun1      in                        CABD13831.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCGCTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTAGAACATATATTCATACATTAAattgtacagaactgtgaatcctggtagctctatataaataaagttattcatacatccatccatacatccatacatTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGT
  3  -1   3        nb Sto1      in                         CABG8826.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGCCTGGCCTGCATGCAGCTACACAGAGCAGAGATGCAAATGCATTTTTTTCCACATTTTTCTGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTAGAACATATATTCATACATTAAattgtacagaactgtgaatcctggtagctctatataaataaagttattcatacatccatccatacatccatacatTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAA
  5   1   2       add Neu                            TNeu011h18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGGGAACGGAGCAGCCTGTACTGTACTCTCCGCTATAGCCGCCTTGTCTCTGGTTCGTGGAGATATTTGACTTGTTTGGGAAGCACCCAGAACTTATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAATTGTACAGAACTGTGAATCCTGGTAGCTCTATATAAATAAAGTTATTCATACATCCATCAATCCATACATACATACATACATTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAGCCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCTCCCCCCACCCCACAACGC
  3  -1   3        nb Tad5      out                        XZT47221.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGCCGATTTCCATTTATTTTAGCTGCATTCAGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAattgtacagaactgtgaatcctggtagctctatataaataaagttattcatacatccatccatacatccatacatTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAAATCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGA
  5   1   2       add Gas7      in                          XZG6878.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGCCAATGCTGTGCCTGTACACCACGTGTGTGGAGAGTACGCCACATTTGACTGTGGCTAAAGGATTTACATGTTCCTTAGCACACATATACCATTTCACTTAGTCACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAATTGTACAGAACTGTGAATCCTGGTAGCTCTATATAAATAAAGTTATTCATACATCCATCAATCCATACATACATACATACATACATACATACATTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAGCCAGTAACAATCTCAGTAACATTAACCTGGTGATTGGTGATGACTTTGCTCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTTGTGGGGTTTATTTGTCAATAAAAATCCCTTTACATATTCAGCANGCAAACAGAGCAGTCCACGG
  3   1   2       add Gas7      in                         XZG42354.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGTCCCCCAGGGGTGGGGGGAGTCCCCCCCATTGGACGGGGGCTAAGGGATTTACATGTTCCTTGGCACACATATCCCATTTCATTTAGTCCCCTTCGGGATTTTAAAAGTAGGGTTCCTTTATATCCAACCGGGCGGGCTGGGGGGTTTTTAGGGTTATTTGGAAATTTAAAGCCCCGGATTTTATTTCCCGGTTGCTTTGTTTAAAGCCAAATGGGGTATGTAAAGGCCCCCCCGGGTAATTTTTTTTCCCGGTTGGCAAAACACCCTTATTTCAAGTAAATTTTTTTTTCGGGGTTTCCGGTATAACATATTTTCATCCATTAAATTGTCCAGAACGGGGAACCCGGGTAGCTCTATATAAAAAAAGTTTTTCATAC
  5   1   3        nb Ova1      in                          CABE507.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCTTCTGGATTTTAAAAGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTAGAACATATATTCATACATTAAattgtacagaactgtgaatcctggtagctctatataaataaagttattcatacatccatccatacatccatacatTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCA
  5   1   3        nb Egg       in                   TEgg021o10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGGGGTAAGGTTCCTTTATATACAAGCAGGCTGGCTTGTGTGTTTTTAGTGTTATTTTGTAATTTAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAATTGTACAGAACTGTGAATCCTGGTAGCTCTATATAAATAAAGTTATTCATACATCCATCCATACATCCATACATTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACA
  3   1   0       chi Gas7      in                         XZG25952.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGTTTTTAGGGTTTTTTTGAAATTTAAACCCCCGGATTTTTTTTCCCCGTTGCTTTGTTTAAAGCCAAATGGGGTTTGTAAAAGCCCCCCCCGGTAATTTTTTTTCCCTGTTTGCAAAACACCCTTTTTTCAAGTAAATTTTTTTTTCGGGGTTTCCGGTTTACCATTTTTTCTTCCCTTAAATTGTCCAGAACTGGGAACCCGGGGGGCCCTATAAAAAAAAAGTTTTTTATACATCCCCCCAAACACCCATCCATTTCTTTCCAGATTTTCCCCATAAGAACCCCGGCCTGTTTCCCCCCCCCCCCAAATAATAAAACTGGGGTTTCCCCCCTGCCCATTTTTGCCCCGGCCCCCCCGGTTTTTGGAAAAGCTTTGGGGTCAAACCCCGTACCATTTTCGGTACCATTACCCTGGGGTTGGGGGAGGCCTTTGCCCCCCCCCCCCGAAATTATCCCTTTCCTTCCCCTTATGGGCTTCATTCCGGGTTTCATTTTTGGGGTCCCTTGCGAAATCTTTAAGGAAAAAAAGGTTTGGCCTTTCCTAATAACCGGCCTTTAAAGGGT
  5   1   2       ext Lun1      in                        CABD12377.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTAGTGTTATTTTGTAATTCAAAGCCACTGATATTATATGCCAGTTGCTTTGTTTAAAGACAAATAGAGTATGTAAAAGACACTCCAGGTAATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTATAACATATATTCATACATTAAattgtacagaactgtgaatcctggtagctctatataaataaagttattcatacatccatccatacatccatacatTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGGAACTTTTCCGACTTCTTGAAACTCAGGCCTTTCATTTGGG
  5   1   2       ext Ovi1      in                        CABI13293.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTTTCTTTCCCTGTTTGCAAAACATCCTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTAGAACATATATTCATACATTAAattgtacagaactgtgaatcctggtagctctatataaataaagttattcatacatccatccatacatccatacatTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAA
  5   1   3        nb Sto1      in                         CABG6937.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTATATCAAGTAAATATTTTATTCAGAGTTTCCAGTAGAACATATATTCATACATTAAattgtacagaactgtgaatcctggtagctctatataaataaagttattcatacatccatccatacatccatacatTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGACCCCCCTTNTAGCCTATAACAAGATTGCAGATGA
  5   1   3        nb Sto1      in                         CABG4363.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            attgtacagaactgtgaatcctggtagctctatataaataaagttattcatacatccatccatacatccatacatTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCNCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTG
  5   1   2       ext Tad5      in                         XZT26047.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAATcctggtagctctatataaataaagttattcatacatccatccatacatccatacatTACTCTACAGATTTTCTCCATAAGAAACCATGACTGTATACCAACAGCACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAANCAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTANGC
  5   1   3        nb Egg                            TEgg107a19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACGCCCACCTATACTTATGATATACAGTATATATCCTGGGAGCAGAATACAGCAAAACCACTCACTCCTTTGTGGGGTTTATTT
  5   1   3        nb Egg                            TEgg107b19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCAAATAATAAAACTAGGGTTTGCCACCTGTCCAGTTTTGACCCGGACAGCCCGGTTTTTGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAG
  5   1   2       add BrSp      in                    EC0CBA004CC12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGAAAAGCTACTGGGTCAAAACCAGTAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCTCCCCCCACCCCAGAACGCCATATCCCCACACCTATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTTTTTGTCAATAAAAATCCTTTACATATTCAGCAAGCAAACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTTTCATAAAACACAAGGCAGGAACTTTTCCTACTTCTTGAACTCAGGCCTTTCATTTGCGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCAC
  5   1   3        nb Gas7      in                         XZG39026.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAACAATCTCAGTAACATTAACCTGGTGATCGGTGATGACTTTGCGCCCCCCACCCCACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCANACCCTTGTAATGTTATAAAATCTACAAATACTTGAAAATTTCATGCAGACATTTCT
  3   1   2       add Tad5      in                         XZT38931.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAACGCCATATCCCCACACCCATGATGTCACCCTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCGTATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAAACATGCAGAATAACAGCAGTGCTTTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTGATCACCACTGCTGGTACTACTGAATTACACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTG
  5   1   3        nb Gas7      in                         XZG56586.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTAAATAAAACACACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACATAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGA
  5   1   3        nb Sto1      in                         CABG9029.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGGCACACATATACTTATGATATACAGTATATATCCTGGGAGCAGAATAGAGCAAGACCACTCACTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTGCTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAG
  5   1   2       ext Ova1      in                          CABE680.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTTTGTGGGGTTTATTTGTCAATAAAAATCCTTTACATTTTCAGCCGGCACACAGAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATGAATGATGAAAGTGTAT
  5   1   3        nb Gas                            TGas025k06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTACATTTTCAGCCGGCACACANAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAA
  3   1   2       ext Lun1      in                        CABD13831.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGCAGTCCACGGGTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGT
  5  -1   2       ext Ski1      in                         CABJ7184.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTGAACTTGCTACTGCAGTATAGATGTGATAAAAGCATTTTGTTGTACCTGAACACTAATATTATACNATCATATGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTAG
  5   1   3        nb Spl1      in                          CABK792.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGAACTTGCTACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTCTAATATGTATGTT
  3   1   2       ext Lun1      in                        CABD12377.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGT
  3   1   2       ext Ovi1      in                        CABI13293.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTGCAGTATAGATGTGATAAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATGTAAAAAAAAAACCTCTCGCCCTAT
  3   1   2       ext Ovi1      in                         CABI3883.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAA
  3   1   2       ext Ova1      in                          CABE680.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGTATAGATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATACATCATATTTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTATTG
  5  -1   3        nb Sto1      in                         CABG8826.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGTATAGATGTGATTAAAGCATTTTGTTGTACNTGAACACTAATATTATACNATCATATTGGGAAAACAACAGACATTACACACCGCTAAATATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTG
  3   1   3        nb Egg       in                    TEgg021o10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGTATAGATGTGATTAAAGCATTTTGTGGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTGGAAAAAAAATTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTGGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTCTGTAAAACAAAAA
  3   1   2       ext Spl1      in                         CABK5902.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGTGATTAAAGCATTTTGTTGTACCTGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTATTG
  3   1   3        nb Sto1      in                         CABG6937.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAACACTAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATGT
  5   1   3        nb Tad5                                 XZT24587.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACTAATATTATAACATCGTATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAAACATGCAGAATAACAGCAGTGCTTTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGANATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   4      seed Hrt1 5g3  in                          CAAQ483.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAATATTATAACATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGT
  3   1   3        nb Sto1      in                         CABG4363.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACNATCATATTGGGAAAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTATTG
  3   1   3        nb Ova1      in                          CABE507.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACAACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTATTT
  5   1   3        nb Tad5      in                          XZT3518.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACAGACATTACACACCGCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGAAAAAAAACATGCAGAATAACAGCAGTGCTTTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTATT
  3   1   3        nb Tad5      in                          XZT3518.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTAAACATTACCTTTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGAAAAAAAACATGCAGAATAACAGCAGTGCTTTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGNGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTATTG
  3   1   3        nb Tad5      in                         XZT24117.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTNTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTAAAAAAAAAAAAAAAAGG
  3   1   2       ext Tad5      in                         XZT26047.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTTATTGTATTTG
  3   1   3        nb Spl1      in                          CABK792.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTACCTGTATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTATTC
  3   1   3        nb Sto1      in                         CABG9029.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATAAGTGAGTATATTGCTTGTACTTCTTTTATTTCTGACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTGCTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTATTGAAAAAAA
  3   1   3        nb Gas                             TGas068f05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATATTGCTTGTACTTCTTTTATTTTTGACACCATCAAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTATTGAAAAAAAAAAAAAAAAA
  3   1   0       chi Gas7      in                          XZG5239.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         NCACGCGTCCGAGATTTTGCAACAGACAAAAATAATAGTGAGTTCACATGCACAGTTATAGCTTTGGCAGTTTGCAGGTCAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTAAAACACTTATGTTGCATGCTACTGAAGCTACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGNGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTC
  3   1   2       add Gas7      in                          XZG6878.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACACCATCAACAGTTCTATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTTTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTAAAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTACAGCATGTTTTCTGTAAAGGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATGTAAAAAAAAAAAAAAAG
  5   1   0       chi Gas7      in                          XZG5239.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATATAGTGAGTTCACATGCACAGTTATAGCTTTGGCAGTTTGCAGGTCAGAAAACACCAGAGCAATCAATTGTTACTTATGTTTACGTTGAAGAATTACCATCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTAAAACACTTATGTTGCATGCTACTGAAGCTACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTAAAAAAAAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas7      in                         XZG56586.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATCATACTTTATGGCAGGGATTATAGGAAAAAACATGCAGAATAACAGCAGTGCTCTCATAAAACATAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATGTAAAAAAAAAAAAAAAGG
  3   1   2       ext Tad5      in                          XZT9931.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCATATTTTATGGCAGGGATTGTGGGAAAAAAACATGCAGAATAACAGCAGTGCTTTCATAAATCACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATATCAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAACGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTA
  5   1   2       ext Tad5      in                          XZT9931.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTATGGCAGNNGGATTATAGGAAAAAAACATGCAGAATAACAGCAGTGCTTTCATAAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTTGTGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTAATAAAAAAAAAAAAAAAAAAGGGC
  5   1   2       add HeRe      in                     EC2CAA37AE05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAATAACAGCAGTGCTTTCATAAAACACAAGGCAGGAACTTTTCCTACTTCTTGAACTCAGGCCTTTCATTTGCGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTATAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG39026.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAACACAAGGCAGGAACTTTTCCGACTTCTTGAACTCAGGCCTTTCATTGGGGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTTTTGTAGCCCTCCCTATAAGTACATACATTTTTTTTTGATCACCCCTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCCCAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGGGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTTTTTTTTTTTAAACTTGAAAAAAAACTGGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGGGGTGTTTTGTGTCCCAATTTAAGATTTTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGCCAGTAGATTTTTTTTTTTACCATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGGGCAGGGTCATTAAAATGTCTTTTGT
  3   1   2       add HeRe      in                     EC2CAA37AE05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTTTCCTATTTCTTGAACTCAGGCCTTTCATTTGCGTTCTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGT
  3   1   3        nb Gas7      in                         XZG57090.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTATCTATTGTCAGAACCCCCTTTTAGCTTATAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGCCAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGT
  3   1   3        nb Fat1      in                         CABC7331.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAACAAGATTGCAGATGAATAAACACATTATTGTAGCACTCACTATAAGTACATACATTTTTTTTTGATCACCACTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATGT
  3   1   2       add BrSp      in                    EC0CBA004CC12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTGATCACCCCTGCTGGTACTACTGAATTATACCATTTTTAGGCGTTAAACACTTATGTTGCATGCTACTGAAGCCACAGTTTTACAGTAGTGCTAGAACTATATATTTGTGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACACATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCCCAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGTATTTGAGAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Egg                            TEgg092l08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTCGCATAGAACTATATATTTGTCGGGAACGTTCTTGGTTCTTGTTTGGTGTTAACTTTTGTTATGTACATCAAACCTTGTAAATGTTATAAAATCTACAAATACTTGAAAATTCATGCAAGACATTTCTTATTTTATAAACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGT
  5   1   3        nb Bone      in                        CBTC6106.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTATGTAGTTAAATGGACTGTTGTGGTGTTTTGTGTCACAATTTAAGATTCTTAAAGGGAAGCTATAATGAATTAGTTGTAGAAGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTCTTTTTTTTAACATTGAATGATGAAAGTGTATAGTAAAGCATGTTTTCTGTAAAGGGGTGTTCTAAATATGTATGTTTACAAGTGCAGTGTCATTAAAATGTCTATTGT
  3   1   3        nb Bone      in                        CBTC6106.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACTTGAAAAAAAACTAGAAAAAATGAAAAGGATATGTTTAAAGGAAGGTAGGTAGTTAAATGGACGGTTGTGGGGTTTTGTGTCACAATTTAAGATTTTTAAAGGGAAGCTATAATGAATTAGTTGTAGAGGCATTTGAAATGTTGATGATGAATCGTGGACAGTAGATTTTTTTTTTTAACATTGAATGATGAAAGGGTGTAGTAAAGCATGTTTTTTGTAAAGGGGGGTTCTAAATATGTATGTTTCCAAGTGCAGTGTCAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)