Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 82%

 1012072518 Xt7.1-TGas116c02.3 - 71 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas116c02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGCAGGGCAGTGACAAAATCCCAATGTGTCTGAGTTAATAGTAAAGAATTTTCCTTCTGTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCACTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTTTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAGAAGGAGCGGGAGAGCAGCAGGATGTGGAAAGATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACATGCAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224355                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGCAGTGACAAAATCCCAATGTGTCTGAGTTAATAGTAAAGAATTTTCCTTCTGTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCGCTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTCTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAGAAGGAGCGGGAGAGCAGCAGGATGTGGAAAGATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACATGCAAAAAAAAAAAAAAAAxAxAAACAGAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     3     3     4     3     4     4     5    13    14    18    19    21    22    22    22    24    24    24    24    24    24    25    25    25    25    25    25    24    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    26    26    26    26    26    26    25    26    25    26    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    22    24    22    24    22    23    21    22    21    22    20    21    20    21    20    21    20    21    19    21    19    21    17    19    18    18    17    17    17    17    18    19    19    19    19    19    18    18    15    16    16    16    14    16    14    16    14    16    13    15    12    14    14    16    15    17    15    17    16    19    19    22    19    22    21    22    26    26    23    24    25    25    25    25    25    25    25    25    25    25    29    31    31    32    33    33    34    34    36    36    36    36    36    37    36    37    36    38    38    40    39    41    37    42    41    42    42    43    42    43    42    43    42    43    41    43    42    43    42    43    41    43    42    43    42    43    44    44    42    43    43    43    41    43    43    43    43    43    43    43    42    43    43    43    43    43    43    43    41    43    41    41    40    41    39    41    39    41    40    41    40    41    39    41    40    41    26    40    26    39    25    38    24    37    23    35    23    35    22    35    22    35    21    34    21    34    18    34    18    34    18    34    18    34    17    32    17    28    15    28    14    27    11    26     6    15     2     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----A--C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------T--T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------TT
                                               BLH ATG     126      40                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     126      61                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     126      55                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               CDS MIN     126      31                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      65      31                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     126       6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ci ---- 5e-008     FAA00138.1 TPA: zinc finger protein [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 3e-008     NP_010225.1 involved intracellular protein transport, coiled-coil protein necessary forprotein transport from ER to Golgi; Uso1p [Saccharomyces cerevisiae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 1e-008     NP_001022821.1 Y111B2A.5a [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 4e-016     XP_784561.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dm ---- 4e-018     NP_001034006.1 nuclear fallout CG33991-PF, isoform F [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Xt ---- 5e-037     AAI35990.1 Unknown (protein for MGC:122328) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Gg ---- 3e-040     XP_425379.2 PREDICTED: similar to KIAA1821 protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Mm ---- 3e-041     NP_780752.1 Rab11-FIP4-like [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Dr ---- 2e-041     XP_685891.1 PREDICTED: similar to RAB11 family interacting protein 4 (class II) [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 1e-042     NP_116321.2 rab11-family interacting protein 4 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 1e-147     AAH97825.1 MGC115550 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = ?? ==== 1e-147     NP_001090052.1 hypothetical protein LOC735126 [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas116c02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGA---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------TAG------------TAA---------------------------------------------TAATGA---------------TAA---------------------TAA------------------------ATG------------------TAA---ATGTAA------------------------------TAA---------------------------------TAA------------------------------ATG---------------------------------------------------ATG---------ATGATG---------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2       bld Gas1 5g                            IMAGE:6989111                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATCCCACACCCACCCGCTGGCAGGGCAGTGACAAAATCCCAATGTGTCTGAGTTAATAGTAAAGAATTTTCCTTCTGTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAAAACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGACCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCACTATCCCTGAAGACCAATTTGAAGATTATGGGGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTCTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAAGCTTGGTGAGTGAAGTACTTNGAAACAGCCCGAGAAGTCTGGAGAAGGAGCGGGGAGAGCAGCANGGATGTGGGAAAGATGCCNCTAAATCANGAAAGAAAAAGCTTGGNCAACNTGGAGAAGGCAGGGAAGCAACCACAGNTTGG
  5   1   2       bld Neu  5g3  in                   TNeu077a23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGCAGGGCAGTGACAAAATCCCAATGTGTCTGAGTTAATAGTAAAGAATTTTCCTTCTGTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCGTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCGCTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGC
  5   1   2       bld Tbd0 5g3  in                     NISC_nl20f04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGGAAGGAAAATTCCCACTCATCATTCCTGACACACAATTCTAAACTGCTGCTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAAAACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGACCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCACTATCCCTGAAGACCAATTTGAAGATTATGGGGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTT
  5   1   2   12  bld Gas7 5g3  in                         XZG38020.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGTTAATAGTAAAGAATTTTCCTTCTGTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAAAACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGACCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCACTATCCCTGAAGACCAATTTGAAGATTATGGGGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTCTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAGAAGGAGCGGG
  5   1   2       bld Neu  5g3  in                   TNeu064d04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGGGTGTGGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAAAACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGACCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCACTATCCCTGAAGACCAATTTGAAGATTATGGGGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAGGATCTAATGAAAAGATATACTCA
  5   1   2   10  bld Lun1 PIPE in                          CABD687.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTCCAGCTGCTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCGCTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTTTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAGAAGGAGCGGG
  5   1   2       bld Neu  5g3  in                   TNeu074g16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCAGCTGCTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCACTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGC
  5   1   2       bld Neu  5g3  in                   TNeu076g11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCAGCTGCTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCACTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTG
  5   1   2       bld Gas  5g                        TGas129m23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGCTGCTGTTTCGGAATCCTGCTCCCTGAAGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGACAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAAGCAGAATGGACTGAGCCATTTGAGCTTCTCGCTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAAGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTC
  5   1   2       bld Neu0 5g3  in                     NISC_ng07c03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGCTGCTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAACTCCTCACTATCCCTGAAGACCAATTTGAAGATTATGGGGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCCCAGAGAGAGTCCTGTTTCCATAAGGCCGAAAGAAAGTGGTGTCTAGAGAG
  5   1   2       bld Gas1 5g                            IMAGE:6987055                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCTGCTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAACTCCTCACTATCCCTGAAGACCAATTTGAAGATTATGGGGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCCCAGAGAGAGTCCTGTTTCCATAAGGCCGAAAGAAAGTGGTGTCTAGAGAGAGAAAAGCTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGGGTCCCTGGAAAGAAAGTCAGAGCTTGGTGAGTGAAGTACTGAAACAGCGAGAGTCTGGAGAAGAGCGGAGAGCAGCAGA
  5   1   2       bld Neu0 5g3  in                     NISC_ng04b11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCTGCTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAAAACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGACCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCACTATCCCTGAAGACCAATTTGAAGATTATGGGGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTCTAGAGAGAGAAAAGTTAAATGCACGA
  5   1   2   12  bld Gas7 5g3  in                         XZG59573.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGAAGCTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAAAACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGACCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCACTATCCCTGAAGACCAATTTGAAGATTATGGGGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTCTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTTTGGAGAAGGAGCGGG
  5   1   2       bld Neu  5g3  in                   TNeu090f14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCTGTTTCGGAATCCTGCTCCCTGAGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTGGAGGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCACTATCCCTGAAGACCAATTTGAAGATTATGGGGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGCCCATGGCAGCTGTGACCTTT
  5   1   2       bld TpA  5g                        TTpA031c09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGTTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCGCTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTTTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAGAAGGAGCGGGAGAGCAGCAGGATGTGGAAAGATGCCCTAAATC
  5   1   2       bld TbA  5x3  in                   TTbA023l07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTCGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCCGCTTTTCCAGGCCGCTCGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACCGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCACTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTCGCAGGTACAATATAGGCACTCGCAAAATTATCCAGCATTTGGGAAATAACTGGACTTTAAGAggcagaattatcaaaatgtgagactagaactcactacagaaaaatgtacccactttctattcattccgatgggatttttaaatgtgtgtttatctgtgggttaaagttagagttttccatttgatagtgggtgagttttttctgtggtaagatctagtctcacactaaatctttccctaaaggtggccatacacgcaccgatattatcgtacgaaacctcgtttcgtacgataatcggt
  5   1   2       bld Egg  5g3  in                   TEgg078k22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCGCTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTTTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAAT
  5   1   2       bld TpA  5g3  in                   TTpA053a03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCGGAATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCGCTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTTTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTNCATGCCCAGAACAGAGTCCT
  5   1   2   12  bld Gas7 PIPE in                         XZG16034.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AATCCTGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCGCTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTTTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAAC
  5   1   2       bld Gas  5g3  in                   TGas116a24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCGCTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTT
  5   1   2       bld Gas  5g3  in                   TGas116c02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCGCTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGAGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACTCAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTG
  5   1   2       bld Gas  5g                        TGas032g14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCCCTGAGGGACTTCTTTGTGCTGGACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCGCTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTTTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGC
  5   1   2   10  bld Ova1 5g3  in                        CABE10045.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAACTCCTCACTATCCCTGAAGACCAATTTGAAGATTATGGGGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCCCAGAGAGAGTCCTGTTTCCATAAGGCCGAAAGAAAGTGGTGTCTAGAGAGAGAAAAGCTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGGGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAGAAGGAGCGGGAGAGCAGCAGGATGTGGAAAGATGCCCTANATCAGGAAAGAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCC
  5   1   2   10  bld Ova1 5g3  in                        CABE11709.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACATCATCATCATGGGCCCCATAGAAACACAACAGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAGCTTCTCGCTATCCCTGAAGACCAATTTGAAGATTATGGTGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTTTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAGAAGGAGCGGGAGAGCAGCANGATGTGGAAAGATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAAG
  5   1   2       bld Gas8      out                         st17b08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCCCCATTCTTTGTCAAGAAAGGATGAAAAGGAAGAACCATATAAACCTGCTTTTCCAGGCTGCTTGATTACTGAAGATCCAGTTTCTGACCTAAGCCCACTGGAGTCAACTCGTGTAGATGAGAGCTTTCAGGCAGAATGGACTGAGCCATTTGAACTCCTCACTATCCCTGAAGACCAATTTGAAGATTATGGGGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCCCAGAGAGAGTCCTGTTTCCATAAGGCCGAAAGAAAGTGGTGTCTAGAGAGAGAAAAGCTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGGGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAG
  5   1   2       bld Gas7      in                         XZG46815.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGAGGTGGTGAGTTCGTGCAGCATGCGGAGCAGCAACTGCAGGGTCCATGGCAGCTGTGACCTTTCCAGCATGGACCCAGAGGTGTCCTCTTGCAGTGAATCTGTGGAAAAGTTGAGCTTTCTGGAGGATCGAATCTTGGAATTAGAAGGGGAGAACACACAGAGAGAAGAGACAGAGCAGAAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTCTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAGAAGGAGCGGGAGAGCAGCAGGATGTGGAAAGATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGTGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGNGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGA
  5   1   2       bld Gas7                                 XZG10686.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAACTGCGCCAGCTTAATAAGGATCTAATGAAAAAGATATACTCATTAGAAGAGCAGATGCAGGACCAGAAACTCCAACTGGAGGAAGAGAAACAGGAAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTTTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAGAAGGAGCGGGAGAGCAGCAGGATGTGGAAAGATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCT
  5   1   2       bld Gas7      in                         XZG39304.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATTATTTCTCAGAGAGACTCCTGTTTCCATAAGGCAGAAAGGAAGTGGTGTTTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAGAAGGAGCGGGAGAGCAGCAGGATGTGGAAAGATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCAT
  5   1   2       bld Gas7      in                         XZG46963.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATCGATTCNGATTCGTCGACCCCGCGTCCGGTTTAGAGAGAGAAAAGTTAAATGCACGAATAAAAGTGCTACAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGAGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAGAAGGAGCGGGAGAGCAGCAGGATGTGGAAAGATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCA
  5   1   2       bld Gas6      in                         ANBT2992.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGGATGATAATGGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGGGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAGAAGGAGCGGGAGAGCAGCAGGATGTGGAAAGATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCCTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAGAATGCAATTTAATGTCTGTCCGTAAAAAAT
  5   1   2       bld Gas6      in                          ANBT304.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAGGATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGGGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAGAAGGAGCGGGAGAGCAGCAGGATGTGGAAAGATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCCTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTTAATTA
  5   1   2       bld TbA       in                   TTbA079f13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGATAATGTCCAGTTTTCTCAGTCTGTCTCAACTCTCAATGCCCAGAACAGGGTCCTGGAAAAGAAAGTCCAGAGCTTGGTGAGTGAAGTACTTGAAACAGCCGAGAGTCTGGAGAAGGAGCGGGAGAGCAGCAGGATGTGGAAAGATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCCTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTANAAAATGTAATTTATTTTTTTTATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCCTATAATCCCAA
  3   1   2       bld Ova1 5g3  in                        CABE10045.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAAGGAGCGGAGGAGCAGCAGGATGTGGAAAGATGCCCTAATCAGGGAAAGAGAAGCTTGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCCTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTGTGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACGTGAAA
  3   1   2       bld Neu  5g3  in                    TNeu074g16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGAGCGGGAGAGCAGCAGGATGTGGAAAGATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATGAACATGACAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas8      in                          st12a22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGCGGGAGAGCAGCAGGATGTGGAAAGATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAAT
  3   1   2       bld TbA  5x3  in                    TTbA023l07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGCAGCAGGATGTGGAAAGATGCCCTAAATCAGGAAAGAGAAGCTTGCAAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATGAACA
  5   1   2       bld Gas8      in                          st11a22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCAGGATGTGGAAAGATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTT
  5   1   2       bld Gas8      in                          st93b10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTTAATTATTTGTGCATTTTTGTAAGTCACT
  5   1   2       bld Gas7                                 XZG40996.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGCCCTAAATCAGGAAAGAGAAGCTTGGCAACGTGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAAGAGACTTANATTGTATGTGTGTGGAAATGATGCCCAGGATATTCTGTGAATATGCTACT
  3   1   2       bld Egg  5g3  in                    TEgg078k22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAGGACCATGGATATTAAATACATATGAACA
  3   1   2       bld Neu  5g3  in                    TNeu076g11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGAAGCTTGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATGAACATGACAAAAAAAAAAAAAAAA
  3   1   2      seed Gas  5g3  in                    TGas116c02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGCAACGCGAGAGGCAGGAAGCAGCACAGTTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACATGCAAAAAGGAAAAACACATAGAAACAGATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas116a24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGAGAGGCAGGAAGCAGCACAGTGGTTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACATGCAAAAAGGAAAAACACATAGAAACAGATAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA  5x3  out                   TTpA031c11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGAGAGGCAGGAAGCAGCACAGTTGGTGAAGATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATGAACATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8                                  st17a08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCTGCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCCTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTGTGTGTGTGGAAATGATGCCCAAGGATATTCTGTGAATATG
  3   1   2       bld Gas6      in                          ANBT304.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCCTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTGTGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACGTGC
  3   1   2       bld Lun1 PIPE in                          CABD687.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGCTGTGAGCTGAGCAGATTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACATGC
  3   1   2       bld Ova1 5g3  in                        CABE11709.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGCTGTGAGCTGAGCAGGTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACATGC
  3   1   2       bld Gas7 5g3  in                         XZG38020.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGCTGTGAGCTGAGCAGNTTCCAGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACATGCAAAAAAAAAAAAAAAGG
  3   1   2       bld Neu  5g3  in                    TNeu077a23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGGACAGACTGTGAGCTGCCATGCTGTAATGATAGGAGAAGTACTCACAGCCTATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACCATGGATATTAAATACATATGAACA
  3   1   2       bld Gas8      in                          st11a22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTATGGGAAGAGTGTGAAAGGGAGAANGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCT
  3   1   2       bld Gas8                                  st57b24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTATGGGAAGAGTGTGAAANGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCCTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTGTGTGTGTGGAAATGATGCCAAGGATATTCT
  3   1   2       bld Gas6      in                         ANBT2992.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCCTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTGTGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACGTGC
  3   1   2       bld TbA       in                    TTbA079f13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTTCGAGAAATAAATGAAGATTTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTTTGCTTCCCACACAGCATCCACAGGGAAAACTCACCCTCCAAACCAGGTTTTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATTTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTTTTTTTGAAATCAAGCCATCTTTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTTTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTTTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAAAGTAATTTATTTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTTTGAAGGAGACTTAAATTGTGTGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATGAACGGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ovi1                                 CABI7075.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGAAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTTTGCTTCCCACACAGCATCCACAGGGAAAACTCACCCTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTTAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATTTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTTTTTTTGAAATCAAGCCATCTTTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTTTGAAGGAGACTTAAATTGTGTGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACGTGG
  3   1   2       bld Gas7 5g3  in                         XZG59573.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGAGTGTGAAAGGGAGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTTCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACATGC
  3   1   2       bld Gas7      in                         XZG46815.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTGTGAAAGGGAGAAGCACAGACTGCCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACATGCAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7      in                         XZG46963.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAAGCACAGACTGGCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACATGCAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas8      in                          st93b10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAGAGGAGAACCAAAGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTG
  3   1   2       bld Gas7      in                         XZG39304.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTCTACGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACATGCAAAAAAAAAAAAAAAGG
  5   1   2       bld Neu                            TNeu141o14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAGAAATAAATGAAGATCTGCAGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGCATCCACAGGGAAAACTCACCTTGCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCGAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTGTCATCCTTTAATTACTCACTACTCACACTGTGTGAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTGTGTCCGTAAAAAATGTGATTTATTTTTTTAATTATTTGTGCATTTTTGTGAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTGCAGCAT
  3   1   2       bld Neu  5x   ?                     TNeu081m11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGATGCTCTGCTTGTACAAAATGGGTCCCTCTGCTTCCCACACAGNCATCCACAGGGAAAACTCACCCCTCCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTGTGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACGTGAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 PIPE in                         XZG16034.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCTTTTGCTTCCCACCCAGCATCCCCAGGGAAAACTCCCCTTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGCCATGGATATTAAATACATATTGAAACAG
  3   1   2       bld Neu  5g3  in                    TNeu090f14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACACAGCATCCACAGGGAAAACTCACCCTCCAAACCAGGTTCTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACGACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACGTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8                                  st95a14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACACAGCATCCACAGGGAAAACTCACCTTGCAAACCAGGTTNTCCAGTTCACTNTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGNCAGTATCCTAGATCGCGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACNTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTNTTNTAATTATNNGTGCNTTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATNTAATACATAGCCACTTNTTACTTTCGCCTAAAAATGNACAGCATAAAGGNGAGGAGAGGCATTGTCTCTGAAGNAGACNTAAANANTGGNGTGTGTGGAAATGATGCCAAGGATATTCTGTGAAT
  3   1   2       bld Gas8      in                          st12a22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACACAGCATCCACAGGGAAAACTCACNTTACAAACCAGGTTCTCCAGTTCACTCTATNGNTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCCTAATGAGCAGAAAGAAGTCAATAGACGCGTGCGCCAGTATCTAGATCGTGTTNTCCTCACTGTNTTNGAAAAAGACCCCGCTGTTCTTGAANTCAAGCCATCTATGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAANCNNTTTATTCACTGAGGGATATAGGCCTAATTATATATNGCCAATAATGAGCTGGTGTCATCCTNTAATTACTCACTNCTCACACNGTGTAAGCCTGTGGTAATTCTTTGAAAAGAATGCAATTTAATGTCNGTCCGTAAAAAATGTAATTTATTTTNCTAATTATTTGTGCATTCNTTGTAAGTCNCTANTGANCNCA
  3   1   2       bld TpA  5g3  in                    TTpA053a03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAAAACTCACCTTCCAAACCAGGTTTTCCAGTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATTTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTTTTTTTGAAATCAAGCCATTTTTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTTTCATCCTTTAATTACTCACTACTCCCCCTGTGTAAGCCTGTGCTAATTTTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAAAGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCCCTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTTTTTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTTTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGGCCCTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu0 5g3  in                     NISC_ng04b11.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTCACTCTATTGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACATGAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tbd0 5g3  in                     NISC_nl20f04.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCTGAAGAGATTGACGTGTGTACACAAGAGCAGATTTCAGCCCTTAATGAGCAGAAAGAAGTCAATAGACGCCTGCGCCAGTATCTAGATCGTGTTATCCTCACTGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACATGAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Neu0 5g3  in                     NISC_ng07c03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTTTTAGAAAAAGACCCCGCTCTTCTTGAAATCAAGCCATCTCTGAGTCATTGACTGTTGGGAAGGCTATAGGAGGGTAGTAAATAAACTTTTTATTCACTGAGGGATATAGGCCTAATTATATATTGCCAATAATGAGCTGGTCTCATCCTTTAATTACTCACTACTCACACTGTGTAAGCCTGTGCTAATTCTTTGAAAAGAATGCAATTTAATGTCTGTCCGTAAAAAATGTAATTTATTTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTGTGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACATGGATATTAAATACATATTGAACGTGAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Neu  5g3  in                    TNeu064d04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAATGTAATTTATTTTTTTAATTATTTGTGCATTTTTGTAAGTCACTATTGAACACAACCCTATAATCCCAATTTAATACATAGCCACTTTTTACTTTCGCCTAAAAATGTACAGCATAAAGGTGAGGAGAGGCATTGTCTCTGAAGGAGACTTAAATTGTATGTGTGTGGAAATGATGCCAAGGATATTCTGTGAATATGCTACTCAGGGCAAGACCATGGATATTAAATACCATATTGAACATGCAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)