Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     1 103.0    0(repeat)                                    0 REP     84       2269     2705                (no blast hit)

 This cluster: approximate FL confidence score = 64%

 1012072522 Xt7.1-TNeu112i11.3.5 - 136 ESTs
                                                                       .....-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TNeu112i11.3.5                                                                                                          GGAAGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGAATATACATTTGAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGAGAAGGAAAGGCTAATAAAGAATTAATCTCAAGCTGCAGGCATACCTTCAGTTGTCTCAATAGTGCCCTTAAGTCTCCCCATATTTCACCTGTTCAGATGATCAGAAGCCAAACAGGAAGAAAAAACGCTGAGCTGTGTAAAGAAAGTTCCCATAATGCCTCACTCCTGCACTGAGACCAGTGTACATTCTCAGTTAGTTAGACTATGAGTCAGCTTCCTGCTGATTGGCTCAGATCCACATTCCTAAGGAGGGGGTGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222516                                                                                                                TAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGAxxxxxxATTTGAAxxxCxAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAATATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGAGAAGGAAAGGCTAATAAAGAATTAATCTCAAGCTGCAGGCATACCTTCAGTTGTCTCAATAGTGCCCTTAAGTCTCCCCATATTTCACCTGTTCAGATGATCAGAAGCCAAACAGGAAGAAAAAACGCTGAGCTGTGTAAAGAAAGTTCCCATAATGCCTCACTCCTGCACTxxxxCxAGTGTACATTCTCAGTTAGTTAGACTATGAGTCAGCTTCCTGCTGATTGGCTCAGATCCACATTCCTAAGGAGGGGGTGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                               9    14    13    16    13    17    17    18    17    18    17    18    17    18    18    19    18    20    21    22    20    21    19    21    21    22    21    22    21    22    22    23    23    23    23    23    23    23    23    23    23    23    24    24    25    25    25    25    24    25    25    25    25    25    25    25    25    25    26    26    26    26    27    27    27    27    26    27    27    27    27    27    27    27    27    27    27    27    26    26    25    26    26    27    26    27    26    27    27    27    24    25    24    25    24    25    23    24    22    23    21    22    19    19    19    19    18    18    18    18    18    18    19    19    18    20    18    20    18    20    17    19    17    19    17    19    17    19    18    20    19    21    18    21    16    19    19    20    18    20    18    19    19    20    18    18    17    17    18    18    18    18    17    19    17    19    18    20    18    19    19    20    18    20    18    20    18    20    19    20    20    21    20    20    21    21    21    21    21    21    22    22    22    22    21    22    22    23    22    23    22    23    21    23    21    23    22    24    23    26    25    28    25    28    25    28    25    28    23    26    24    26    23    25    22    24    22    24    23    25    23    25    23    25    23    25    24    26    25    27    29    29    30    30    28    30    29    30    29    31    29    31    29    31    29    31    28    32    31    33    30    32    30    32    29    31    29    31    29    31    28    31    29    31    29    31    27    31    25    32    27    33    26    32    25    31    26    31    25    30    24    30    23    29    24    29    22    28    22    28    22    28    16    24    17    22    16    22    17    21    17    21    10    21     8    19     8    16     7    15     7    15     7    15     7    16     7    16     6    15     6    15     6    15     6    16    12    16    11    16    11    15    11    16    12    19    13    19    13    19    14    20    13    19    14    20    11    18    10    16    10    14     9    14     9    14     9    14     9    14     9    14     9    15     9    15     8    14     8    14     8    14     8    12     8    13     8    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     7    12     7    12     8    14     8    16     9    18     9    21    12    24    13    26    13    26    11    28    11    29    13    31    15    32    14    33    15    33    24    33    25    36    25    37    25    38    26    38    26    38    29    42    31    42    30    42    31    43    33    46    33    46    32    46    36    48    37    49    34    49    37    50    38    52    36    51    39    51    37    51    41    52    41    52    40    51    40    52    41    52    38    51    42    51    42    51    41    51    41    50    39    50    40    50    40    50    40    49    40    50    41    50    43    53    43    53    41    53    43    52    42    52    42    51    40    51    42    51    41    51    41    51    42    51    42    51    41    51    40    51    35    51    41    51    36    50    40    50    40    50    39    50    36    50    17    40    10    19     8     8     3     3
  5   1   2  SIG                                    Xt7.1-TNeu112i11.3                                                                                              AAGGAGAAGCAGGGAAGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGAATATACATTTGAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAATATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGAGAAGGAAAGGCTAATAAAGAATTAATCTCAAGCTGCAGGCATACCTTCAGTTGTCTCAATAGTGCCCTTAAGTCTCCCCATATTTCACCTGTTCAGATGATCAGAAGCCAAACAGGAAGAAAAAACGCTGGCTGTGTAAAGAAAAGTTCCCATATGCCTCACTCCTGCACTGAGACCAAGTGTACATTCTCAGTTAGTTAGACTATGAGTCAGCTTCCTGCTGATTGGCTCAGATCCACATTCCTAAGGAGGGGGTGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABI4832.3                                                                                                                           CCTCGTGCCGGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCGGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTAATACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTTCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGACCACAGTGAAATACTGCAAAGCTTTTTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGAGAAGGAAAGGCTAACAAAGAGTTAATCTCAAGCTGCAGGCTTACCTTCAGTTGTCTCAATAGTGCCCTTAAGTCTCCCCATATTTCACCTGTTCAGATGATCAGAAGCCAAACAGGAAGAAAAAACGCTGAGCTGTGTAAAGAAAGTTCCCATAATGCCTCACTCCTGCACCAAGACCGAGACCAAGTGTACATTCTCAGTTAGTTAGACTATGAGTCAGCTTCCTGCTGATTGGCTCAGATCCACATTCCTAAGGAGGGGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATATCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACA
  5   1   2                                           Xt7.1-XZT45512.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGNCACCTGGAAGACTGACTAAANGAGGCATAAATAAGATAAGTCTGTACATATAATATAGTCTCCACTGAATCTCTCTGCNGTGCCAGGACCACACTGACAATCGGTTNCAGTTTCAAGAAAAATCTGTCAGCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGGGTCTCATGATTGCAGGATTTGGTCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGAGAAGGAAAGGCTAATAAAGAATTAATCTCAAGCTGCAGGCATACCTTCAGTTGTCTCAATAGTGCCCTTAAGTCTCCCCATATTTCACCTGTTCAGATGATCAGAAGCCAAACAGGAAGAAAAAACGCTGAGCTGTGTAAAGAAAGTTCCCATAATGCCTCACTCCTGCACTGAGACCAAGTGTACATTCTCAGTTAGTTAGACTATGAGTCAGCTTCCTGCTGATTGGCTCAGATCCACATTCCTAAGGAGGGGGGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAACAAA
  5   1   2                                            Xt7.1-XZG1411.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGTCCGGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTTTTTTAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACACGTAGAGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGGTTAAAACAAAAAAAAAAAAA
  5   1   2                                         Xt7.1-TTbA046o24.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTAGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAATACTGCAAAGCTTTTTAAAGGGGATAATGCTCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTAAAAAGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACACAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTTGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTAATTAGATCAATTGGGATAGCTCAACAAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGGTGCTTTAAAG------------CAAAAAAANAAT------------AAAGGTTTTTTT------------------------TTCCATGATTAACTGGNGAAAAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATATCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGGTACATTCCCTAATTCTTCATGTCTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAACAAAAATGAAAAAAAAAAAAAAA
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTAAGGAGGGGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATATCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                      -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----CA-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---G------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------CA-
                                               BLH ATG      10     120                                                                                                          
                                               EST CLI     -22       8                                                                                                          
                                                                                                                                                                                                         PROTEIN --- Xt ---- 3e-027     AAI35299.1 Unknown (protein for MGC:121309) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sc ---- 5e-037     NP_012241.1 Hypothetical ORF; Yil023cp [Saccharomyces cerevisiae] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dr ---- 2e-051     NP_001005306.1 si:xx-184l24.1 [Danio rerio] ---------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Gg ---- 4e-054     NP_001008471.1 similar to solute carrier family 39 (zinc transporter), member 13; solute carrier family 39 (metal ion transporter), member 13 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ==== 8e-071     XP_787748.1 PREDICTED: similar to solute carrier family 39 (zinc transporter), member 7 [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                 PROTEIN --- Ce ---- 8e-114     NP_510563.2 H13N06.5 [Caenorhabditis elegans] ----------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                          REMOVED --- Dm ---- 2e-118     NP_524931.1 PROBABLY REMOVED OR REPLACED [Drosophila melanogaster]  ---------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                PROTEIN --- Hs ---- 1e-132     NP_008910.2 solute carrier family 39, member 7 [Homo sapiens] ---========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                    PROTEIN --- Mm ---- 6e-137     NP_001071177.1 solute carrier family 39, member 7 [Mus musculus] ---------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                          PROTEIN === Xl ==== 0          AAI24939.1 Unknown (protein for MGC:154695) [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu112i11.3.5                                                                                                                    ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------TAG---------------------------------------------------------------TGA---------------------------------------------TAA---------------TAG------------TAA------------------TAG---------ATG---------------------ATG------------------------TGA---------------------------ATG------------------------TAA---------TGA---------------------------TGA---------------------------------------TAA---TAG------------------------------------------TGA------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------TAA------TAA------------------------------------------------------------------TGA---------------------------------------------------TGA------------TAG------ATG---------TAG------------------ATG---TAA---------------TAATAA------------------------------------------TAG------TAA---------------------------------------------------------TGA------TAA------------TAA---------------------------------------TAG------------------------TGA------------------------------------------------------------------------TGA------------------------------------------------TGA------ATG------------TAG---------------------TAG---------------------TAA---------------------------TAG------------TGA------------------------------------------TAA------------------------TAG------------------------------------ATG---------------------TAG------------------------------------------------------------------------------------------ATG------TGA------------------------------------------------------------------TGA---------------------------------------------------ATG------------ATG------------------------------------TAA------ATG---------------------------------------------------TAATAA---------------TGA
                                                                   ORF                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2  SIG                                    Xt7.1-TNeu112i11.3                                                                                              AAGGAGAAGCAGGGAAGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGAATATACATTTGAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAATATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGAGAAGGAAAGGCTAATAAAGAATTAATCTCAAGCTGCAGGCATACCTTCAGTTGTCTCAATAGTGCCCTTAAGTCTCCCCATATTTCACCTGTTCAGATGATCAGAAGCCAAACAGGAAGAAAAAACGCTGGCTGTGTAAAGAAAAGTTCCCATATGCCTCACTCCTGCACTGAGACCAAGTGTACATTCTCAGTTAGTTAGACTATGAGTCAGCTTCCTGCTGATTGGCTCAGATCCACATTCCTAAGGAGGGGGTGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008275520                                                                                                    AAGCAGGGAAGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGAxxxxxxATTTGAAxxxCxAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAATATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGAGAAGGAAAGGCTAATAAAGAATTAATCTCAAGCTGCAGGCATACCTTCAGTTGTCTCAATAGTGCCCTTAAGTCTCCCCATATTTCACCTGTTCAGATGATCAGAAGCCAAACAGGAAGAAAAAACGCTGxxxxxxTAAAGAAAxxTxCCxxxATGCCTCACTCCTGCACTGAGACCAAGTGTACATTCTCAGTTAGTTAGACTATGAGTCAGCTTCCTGCTGATTGGCTCAGATCCACATTCCTAAGGAGGGGGTGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Neu  FL                     TNeu122h15.FL-Sanger                                                                                                    AAGCAGGGAAGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGACACACAACTGACAAATTCCGGTTTCCAGGTTTCAAAAAAAAAAAAAAAAAA
  5   1   2       ext TbA  5g3  in                   TTbA010d01.p1kSP6 ACGTGTTTCCGGTCTGTCTTTTACGCGATATTTTGAACCGGATAATTGTGTGCCACGTAGAAGTGGGTACCGTGTTTGGCGCACAGTGGTTAAAGGAGAAGCAGGGAAGGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATG
  5   1   4      seed Neu  5g3  in                   TNeu112i11.p1cSP6                                  TTTGAACCGGATAATTGTGTGCCACGTAGAAGTGGGTACCGGTTTGGCGCACAGTGGTTAAAGGATAATCATGGAATGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCATTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGATGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCATGATCACCATGGACACAGCCATGATGAAAGCCAGCAAGGACATAATCATGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGATATGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGATAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTG
  5   1   2   12  add Gas7 5g3  in                         XZG24696.5p .............................................................TGCGGATCCATCGATTCAAATTCGTCGACCCACGCGTCCGGCAGGGAAGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGGTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTAATACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCT
  5   1   2       add Egg  5g3  in                   TEgg054f17.p1kSP6                                                                      GTAATTACACAGCGGTTATAAGCACATTGGCACGAAAGCAGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGA
  5   1   3        nb Gas       in                   TGas136l21.p1kSP6                                                                                CCGGGGAGTGGTTAAAGGAGAAGCAGGGAAGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTC
  5   1   3        nb Gas  5g                        TGas024k04.p1kSP6                                                                                    CACAGTGGTTAAAGGAGAAGCAGGGAAGGTAAAATGGGTCGGTTTTCGTTGAAAATGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTNTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGT
  5   1   3        nb Neu  5g                        TNeu018c09.p1kSP6                                                                                         CCAGTGGTTAAAGGAAACAGGAAGTAAAATGGGTCGGTTTTCGTTGAAAATGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCGGGATCATAAAGAGCAGAGTCATATATAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTAATACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATA
  5   1   3        nb Egg  5g                        TEgg134k17.p1kSP6                                                                                           TTAAAGGAGAAGCAGGGAAGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCC
  5   1   3        nb Neu0 5g3  in                     NISC_ng05h06.y1                                                                                                GGAGAAGCAGGGAAGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTC
  5   1   3        nb Neu  5g3  in                   TNeu121h19.p1cSP6                                                                                                   AAGCAGGGAAGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTGCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCT
  5   1   3        nb Neu  FL   in                   TNeu122h15.p1cSP6                                                                                                    AAGCAGGGAAGGTAAAATGGGTCGGTTTTCGTTGACAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACG
  5   1   2       add Neu  5g3  in                   TNeu073a06.p1cSP6                                                                                                      GCAGGGAAGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCGGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTAATACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTC
  5   1   2       ext Gas1 5g3  in                     NISC_mq24c12.y1                                                                                                        TGGGAAGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTG
  5   1   2       ext Tbd0 5g3  in                     NISC_nl02g10.y1                                                                                                         GGGAAGGTAAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGC
  5   1   2       ext TbA  5g3  in                   TTbA073l05.p1kSP6                                                                                                                 TAAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCGGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTAATACATGGTCATGGGTCANAAGAGAAAATGGAACCTGTGNCACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCT
  5   1   2       ext Gas8      in                          st67g09.5p                                                                                                                  AAATGGGTCGGTTTTCGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCGGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTAATACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACG
  5   1   2       ext Ovi1      in                        CABI10552.5p                                                                                                                                                                                      TGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCANAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAACGGCAAANAGGAACCCACATCAGAAATGACCGTTTCTGGCT
  5  -1   0       chi Tbd1      out                       CBXT12010.b1                                                                                                                                                                                            CAGACAGAAATAGAAGGTAATAACTTGATTTGGTTGGCTTAATCTGTTTGCATAGGTATGCGTGGGGAGGGGCCAATGAAACATGTATAATACCAAGAGGGTGTAAACAGTTATGGATACAAGTAAGAATAAATGATATAGAGAAAGTAGACTCAATGGATGCATCTGGCGCACACAATTACAACCCAGTCTCTTCTATTTGTAAATGACATTTTAATACCAAATGTATGGGTCCTTTTCATTAACAGGGGGACATGAGGGGAGTGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTAATACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAG
  5   1   3        nb Neu                            TNeu137k18.p1cSP6                                                                                                                                                                                                       AATCCCCGGGGTCCAGGGGGATGTTCATCATGGCCATAGACATGGCGCCCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAGAGCCAGCAAGGACATAATCGGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTAATACATGGGCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGGGATAGCCACTCCCAATGATGTCAGTTGGCCTTTGGGTGCTTGCTGGAATCATTGCCTTTCTT
  5   1   3        nb Gas7      in                         XZG25212.5p                                                                                                                                                                                                            CCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGGCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGA
  3   1   2       ext Gas8      in                          st67g09.3p                                                                                                                                                                                                             CCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCGGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTAATACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTTCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACCAGAGAAGGAGGAGGAAAAAGACCCTAGGGAAGGAT
  5   1   2       add Neu0      in                       IMAGE:6992180                                                                                                                                                                                                                                                   GTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGGACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTCACACACAACTTTCACTGGATGGACTANCAAATTGGAGCCCTCTTTTCTAAGTCAGCAGCCGTGT
  5   1   3        nb Te4       in                         CAAN9494.5p                                                                                                                                                                                                                                                                                        TTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAACGGCAAAAAAGGACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCT
  3   1   3        nb Gas       in                    TGas136l21.q1kT7                                                                                                                                                                                                                                                                                                                                                                  ATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCT
  5   1   3        nb Gas7      in                         XZG18291.5p                                                                                                                                                                                                                                                                                                                                                                              ATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCAGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTACTACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAGAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGC
  5   1   3        nb TbA       out                  TTbA064a11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGATAATTTAATACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGNATGTCAGTTNGGCCTTTGGGTCCTTGCTGGAATCTTGCCTTTCCTGTTGTTGGAGAAGTTTGTGAGGCATTTAANAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGC
  5   1   3        nb Gas7      in                         XZG27660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAATTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGNATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTAT
  5   1   2       add Liv1      in                          CAAR910.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTTCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGG
  5   1   3        nb Tad5      in                         XZT28234.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTCCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACT
  5   1   3        nb Gas7      in                         XZG49529.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCACGCGTCCGCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCGTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTCCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGA
  5   1   2       ext Gas7      in                         XZG54720.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAATTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGANACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTAC
  5   1   3        nb Gas       in                   TGas130b24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAAAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGA
  5   1   3        nb Neu                            TNeu015o01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTGCCTTCCTTGTTGTTGAAAAATTTGTGAGGCATTTAAAAGGANAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGT
  5   1   3        nb TpA                            TTpA076b04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCACGAAACACAGTGAAGTACTGCAAAGCTTTTAAGGG
  5   1   3        nb Ova1      in                         CABE2944.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACATGGACATGGTCATGGACACAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAA
  5   1   3        nb TpA                            TTpA043f20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTCCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCT
  3   1   2       ext Ovi1      in                        CABI10552.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAAT
  5   1   3        nb Gas7      in                         XZG46016.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCAACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGCGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCT
  3   1   3        nb Gas7      in                         XZG25212.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAAATGACCGTTTCTGGCTATTTAAATCTGGCTGCTGATTTCACACACACCTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTCCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTAC
  3   1   3        nb Gas7      in                         XZG27660.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAAAAAAAAAAT
  5   1   3        nb Tad5      in                         XZT37160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAANAGGAGGCATAAATAAAGATAAGTTCTGTACAATATANATATAGTCTCCACCTGAATCTTCTCTGCGGTTG
  5   1   3        nb Gas7      in                         XZG35042.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTCCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAANAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCCAGGTTTCAAGAAAAAAAATACATGTACA
  5   1   3        nb Gas7                                  XZG7699.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCAACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGCGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAANAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACACAACACAGACAAACTGCAATCTACACTTTAGTAGAAGTTAATATATA
  3   1   3        nb Neu  5g3  in                    TNeu121h19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATGAAGTACCTCATGAAATTGGGGACTNTGCTATCCTGGTCCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAAAAAAAAAAAAAAAA
  5   1   3        nb Neu  5x3  out                  TNeu078g06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGTGCTGTCTATATCACGCTACATTGTAATAT
  5   1   3        nb Gas0      in                         dad17c05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCGGGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCNCAGAACTCCTGAAGGGGATTCGCGCCCTTCTCAGTCCATCCCTTGAAANCTTTTGGACCCTTCTCCTTGGGGTCGCTATGATNGGTTCTTATTGCACCAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGAT
  5   1   3        nb Fat1      in                        CABC11029.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGACACACAACTGACAAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAAACTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTTGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTATTTTGGGACCAA
  3  -1   2       add Neu5      in                          ANHP115.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAACCTGGAAACCGGAATTTGTCAGTTGTGTGTCCCTGGCAACCGCAGAGAAGATTCAGGTGGAGACTATATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGGGACAGTCTACTTCTCGCAAACTGGAAGACTGAC
  3   1   2       add Gas7 5g3  in                         XZG24696.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGACACACAACTGACAAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAAT
  3   1   3        nb Neu0 5g3  in                     NISC_ng05h06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAAAAAAAAAAAAAAAG
  3   1   3        nb TpA       out                   TTpA043d18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTTTATGGATCNTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTTTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATTTTTTTTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAATTTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTGGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAAAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb TpA       in                   TTpA072i09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTGGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTATATTAAATGGTGTTTTGTTTTTCTTAAATCTGTAAATTAGATTTATTTTTAT
  5   1   3        nb Tad5      in                          XZT9572.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATCCTTGAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGACACACAACTGACAAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAAACTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTTGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTT
  3   1   3        nb Gas7      in                         XZG49529.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCACAAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTCATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTGGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGAAAAAAAAAAAAAAAGG
  3   1   3        nb Neu  FL   in                    TNeu122h15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGACACACAACTGACAAATTCCGGTTTCCAGGTTTCAAAAAAAAAAAAAAAAAA
  5   1   3        nb Tad5                                 XZT65637.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGCACAGTTTGTGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTTGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGT
  3   1   2       add Neu  5g3  in                    TNeu073a06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAATACTGCAAAGCTTTTTAAAGGGGATAATGCTCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTAAAAAGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACACAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTTGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTCTTAAAAAAAAAAAAAAAAA
  5   1   3        nb HdA       in                   THdA032b18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCACTACAAGGTCAACTTACAAGGAAACTTGTCACGGCATTATTGGGTCTTTGATATGATGAGATCATGTGTCTTTCAAGGATGTACCGTGGCCACCTATGTATTGCTACAGAAAAAGTCTTAGTTACAGATTTGTGATA
  3   1   2       ext Gas7      in                         XZG54720.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTGGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAAAAAAAAAAAAGG
  3   1   3        nb Tad5      in                          XZT9572.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCAGGGATGTACCTGGGCCCCCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGAGGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCCCGAACCCCAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTTTATATCCCGCTACATTGTAATATAGACAGTGACAGTTTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAAAATAGTTTCCCCCTGAATTTTCTCTGCGGTTGCCAGGGACACCCAACTGACAAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCCCCCAAAACACAGACCAACTGCAAACTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTTGAAATGCCAAAATAGTTTTCAGCCCTTTTTGTTTTTTTTTATTTGGGGACCAAATCCGGCAATCATGAGACCCCCCATTTCTTTTATTAGATCAATTGGGAAAGCTCAATCAATCTCCCTTTGCTAATATTAAATGTGTTTTGTTTTTC
  3   1   3        nb Gas7      in                         XZG18291.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTCATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTGGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATCTGTTTTGTTTTTCTTAAAAAAAAAGG
  3   1   3        nb Gas7      in                          XZG6369.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAAT
  5   1   3        nb HdA                            THdA053h16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACTGCAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGACACACAACTGACAAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTTGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAATATTTNGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGagaaggaaaggctaataaagaattaatctcaagctgcaggcataccttcagttgtctcaatagtgcccttaagtctccccatatttcacctgttcagatgatcagaagccaaacaggaagaaaaaacgctgagctgtgtaaagaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtca
  5   1   3        nb Gas7      in                          XZG6369.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCAAGCTTTTAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAGAAAAAAAAAAAAAAAGG
  5   1   3        nb HdA       in                   THdA005a18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGACACACAACTGACAAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACAAAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTTGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAATATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGagaaggaaaggctaataaagaattaatctcaagctgcaggcataccttcagttgtctcaatagtgcccttaagtctccccatatttcacctgttcagatgatcagaagccaaacaggaagaaaaaacgctgagctgtgtaaagaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacat
  5   1   3        nb HdA                           THdA035l02.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTTGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAATATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGagaaggaaaggctaataaagaattaatctcaagctgcaggcataccttcagttgtctcaatagtgcccttaagtctccccatatttcacctgttcagatgatcagaagccaaacaggaagaaaaaacgctgagctgtgtaaagaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagc
  5   1   3        nb Neu                            TNeu115a02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAACTAGTGTCGACGCGGCCCTTTTTTTTTTTTTTTTTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAATATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGagaaggaaaggctaataaagaattaatctcaagctgcaggcataccttcagttgtctcaatagtgcccttaagtctccccatatttcacctgttcagatgatcagaagccaaacaggaagaaaaaacgctgagctgtgtaaagaaagttcccataatgcctcactcctgcacT
  5   1   3        nb Eye                                  CCAX3138.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAATATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGAGAAGGAAAGGCTAATAAAGAATTAATCTCAAGCTGCAGGCATACCTTCAGTTGTCTCAATAGTGCCCTAAA
  5   1   2       ext Tad5      in                         XZT30739.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATgtatgctttaaaggagaaggaaaggctaataaagaattaatctcaagctgcaggcataccttcagttgtctcaatagtgcccttaagtctccccatatttcacctgttcagatgatcagaagccaaacaggaagaaaaaacgctgagctgtgtaaagaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggaggggggggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGGTTGCTGTTTTTTAT
  5   1   3        nb Spl2      in                        CBSS8882.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGAGAAGGAAAGGCTAATAAAGAATTAATCTCAAGCTGCAGGCATACCTTCAGTTGTCTCAATAGTGCCCTTAAGTCTCCCCATATTTCACCTGTTCAGATGATCAGAAGCCAAACAGGAAGAAAAAACGCTGAGCTGTGTAAAGAAAGTTCCCATAATGCCTCACTCCTGCACTGAGACCAAGTGTACATTCTCAGTTAGTTAGACTATGAGTCAGCTTCCTGCTGATTGGCTCAGATCCACATTCCTAAGGAGGGGGGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAAT
  5   1   3        nb Gas7                                 XZG31204.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATgtatgctttaaaggagaaggaaaggctaataaagaattaatctcaagctgcaggcataccttcagttgtctcaatagtgcccttaagtctccccatatttcacctgttcagatgatcagaagccaaacaggaagaaaaaacgctgagctgtgtaaagaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggagggggtgggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTG
  5   1   0       chi Tad5                                 XZT23956.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAATTATATTATGTGAAATAAAATAAAATATTAACATTGCACTTACCACTATAATCTCTTTTTTTTCTTAGAACTTTGCTGGCCCTAGGGTGTCTCATTGTTCATTCAAATCAAACAGCAGAAGAAAATCTAAAGAAAGTTAAACTTCCCAAAAAGTATGTATAGATCAGTTACATTTACTTAAGAGCAAGTAATGCTATTATGAAGCAAAAAATTAAACAAAATGGCAACTTCTGGTGTaggtataaaatctgttatccagaatgcttgggatctgggcttttctgaataagggatctttccataatttgtatcaccgtgccttaaggctgctaaataaacttataaacattaaataaacctaatagtattttgccaccaatatggattcatgcagttaacgtaccccctagtacaaagtactgttttattgttacagacaaaaagCAGATATTTAAAATTTTGAATTATTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCCTACCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCA
  5   1   3        nb Tad5      in                         XZT67520.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGAAATAGAGGGACTTTCATAAATgtatgctttaaaggagaaggaaaggctaataaagaattaatctcaagctgcaggcataccttcagttgtctcaatagtccccttaagtctccccatatttcacctgttcagatgatcagaagccaaacaggaagaaaaaacgctgagctgtgtaaagaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggagggggtgggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACC
  3   1   0       chi Neu0      in                       IMAGE:6992180                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCTCTCTGTCACGAAAAGGGGTAGATCTACCTCGCGGCAGCTCATGTGTGAtcagcttcctgctgattggctcagatccacattcctaaggagggggtggnagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCNGCCATTGCCAATTAAAG
  3   1   2       add Liv1      in                          CAAR910.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   taagtctccccatatttcacctgttcagatgatcagaagccaacagggaagaaaaaacgctgagctgtgtaaagaaagttcccataatgcctcactcctgcaccaagaccgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggaggggggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATATCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTGTAAGAAAATACCGCTAATAAAGTTTAA
  3   1   4      seed Neu  5g3  in                    TNeu112i11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             gttcagatgatcagaagccaaacaggaagaaaaaacgctgagctgtgtaaagaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggagggggtgggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAACAAAAATGAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas       in                    TGas130b24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               tcagatgatcagagcccaaacaggaagaaaaaacgctgagctgtgtaaagaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggagggggtgggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTAAAACAAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu       out                   TNeu078g08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   agatgatcagaagccaaacaggaagaaaaaacgctgagctggtaaagaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggaggggggggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAACAAAAATGAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Te4       in                         CAAN9494.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    tgatcagaagccaaacaggaagaaaaaacgctgagctgtgtaaagaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggagggggtgggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCAGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATG
  3   1   2       add Egg  5g3  in                    TEgg054f17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGGGGAGGACGCTGAGCTGTGTGGAGGGGGTTCCCATGGTGCCTCACTCCTGCACTGAGACCGGGTGTGcattctcggttggttggactgtgggtcggcttcctgctgattggctcggatccacatttctaaggagggggtgggagcagggnggagcggagggctgcgtgtctctggcgcatgggttgcggacgcgggaaatcttttgacagaagtcggtgcggcatttctgtgggtgcttgtggctgtgtttacatagacctttctgatggggcttgcttggtttttgcctttctttctcttttAACAAAAATGTGGTGTTTCTGTGTCAGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAACAAAAATGAAAAAAAAAAAAAAAAA
  3   1   3        nb Fat1      in                        CABC11029.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    gagctgtgtaaagaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggagggggtgggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGGCCTCTCGC
  3   1   3        nb Ova1      in                         CABE2944.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    gagctgtgtaaagaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggagggggtgggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTAAAAC
  3   1   2       ext Tad5      in                         XZT30739.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             taaagaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggaggggggggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAAC
  5  -1   2       add Neu5      in                          ANHP115.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                gaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggagggggtgggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTAAAACAAAAATG
  3   1   3        nb Tad5      in                         XZT37160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    gttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggagggggtgggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAAC
  3   1   3        nb Tad5      in                         XZT28234.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     caagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggaggggggggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAAC
  3   1   3        nb Tad5      out                         XZT5004.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           tacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggaggggggggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTAAAAC
  3   1   3        nb HdA       out                  THdA017c01.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    gttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggagggggtgggagcaggagagagcagagagctgcgtgtttttggcacatgaattacagacgcaagaaattttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttttgataaagcttacttagTTTTTACCTTTCTTTTTCTTTTAACAAAAATGTGGTGTTTTTGTGTCAGTGTAGCAGTATTTGGGATGACTGGGGGGGGGTTATTTATTATTTGGTACCTTTTTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTTTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTTTCCTACCCTGTTTTTTGAGTTGTTTAAACATGTCCAAATGACTACAAAGATATTGCCCCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATTTTGCTTTCAGGCAATTTTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGGTACTAAAAAACACAGTAGGGTACATTCCCTAATTTTTCATGTTTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAGCaaaaaggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       ext TbA  5g3  in                   TTbA010d01.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           agactatgagtcagcttcctgctgattggctcagatccacattcctaaggagggggtgggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaACAAAAATGTGGTGTTTCTGTGTCAGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATAAAAAAAAAAAAAAAGC
  3   1   3        nb Gas7      in                         XZG35042.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      tcagcttcctgctgattggctcagatccacattcctaaggaggggggggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGGGTGGGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTTTCCTACCCTGTTTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCCCCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTTTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACCCAGTAGGCTACATTCCCTAATTTTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATGG
  3   1   3        nb HdA       in                    THdA005a18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTTCCTGCTGATTGGTTCAGATCCACATTCTTAAGGAGGGGGTGGGAGCaggagagagcagagagctgcgtgtctttggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaACAAAAATGTGGTGTTTCTGTGTCAGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTTTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTAAA
  3   1   2       add Gas7      out                        XZG65007.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGACAGTGAGGAATCTGATGAAAAGGATACAAAGAAACCAAAAAAGGAAGGAGACTCTGCAGAAGAAGACTTtggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCGGTTTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATG
  5   1   3        nb Neu5                                  ANHP529.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCACATTCCTAAGGAGGGGGTGGGAGCaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATGANNAAAAAAAAAAAAAAANANAAA
  3   1   2       ext TbA  5g3  in                    TTbA073l05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGGAGGGGGGAGCaggagagagcagagagctgcgtgtctttggcacatgaattacagacgcaagaaattttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacCTTTTTGATAAAGCTTACTTAGTTTTTACCTTTCTTTTTCTTTTAACAAAAATGTGGTGTTTTTGTGTCGGTGTAGCAGTATTTGGGATGACTGGGGTGGGGTTATTTATTATTTGGTACCTTTTTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCCCAAATCATATTTTTCATAATGATTTTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTTTCCTACCCTGTTTTTTGAGTTGTTTAAACATGTCCAAATGACTACAAAGATACTGCACCCGCACTTGTCAGTTGGTACCTAAAAAAGTGTACCAGAGAATTTGTAGGTGAGAATTTTGCTTTCAGGCAATTTTTATAGTGACCCGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGGTACTAAAAAACACAGTAGGGTACATTCCCTAATTTTTCATGTTTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAACCAAAAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb HdA       in                    THdA032b18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGTGGGAGCaggagagagcagagagctgtgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaACAAAAATGTGGTGTTTGTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGGTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTTTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTAAGTTTTTACAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCGGTCTTTTGAGTTGTCTAAACATGTCCAAATGATTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTGGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTAGAATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGTTACATTCCCTAATTCTTCATGTCGGCCATTGCCCTTAAAGGAATTTTCAAATAGTGTGTAAGAAAATACCGCTTTAAAGTTAAAACAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Ova1      in                        CABE13245.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 cttttgacaggggtcggtgcagcatttctgtgagtgcttgtggctgtatttacgtggacctttctgatgaagcttgcttggtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTAAAAC
  5   1   3        nb Ova1      in                        CABE13245.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 cttttgacaggggtcggtgcagcatttctgtgagtgcttgtggctgtatttacgtggacctttctgatgaagcttgcttggtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAAAAAAAAAAAAAAA
  3   1   3        nb Tad5      in                         XZT67520.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGACagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTTTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTTTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTTTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATG
  3   1   3        nb Spl2      in                        CBSS8882.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAAC
  5   1   3        nb TpA       in                   TTpA046f20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaACAAAAATGTGGTGTTTCTGTGTCAGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATG
  3   1   3        nb TpA       in                    TTpA046f20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaACAAAAATGTGGTGTTTCTGTGTCAGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAACAAAAA
  3   1   3        nb Gas7      in                         XZG46016.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ctgtatttacatagacctttctgatgaagcttgcttagtttttgcctttctttctcttttaaCAAAAATGTGGTGTTTTTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGGGGTTATCTATTATTTGCTACCTTTTTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTTTTTCATAATGATTTTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGGGTGTTTTAGGGCATAGGGAGGTTTTAACCATTTTCCTACCCTGTTTTTTGAGTTGTTTAAACATGTCCAAATGACTACAAAGATACTGCCCCAGCCCTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATTTTGCTTTCAGGCAATTTTTATAGTGACCCGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACCCAGTAGGGTACATTCCCTAATTTTTCATGTTTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGGTTAAAACAAAAATGG
  3   1   3        nb TpA       in                   TTpA072i09.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAACAAAAATGAAAAAAAAAAAAAAA
  3   1   3        nb Tad5      out                         XZT8845.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTTTAACAAAAATGTGAAGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCGGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAAGGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGGCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGGTAATAAAGTTAAAACAAAAAT
  5   1   3        nb Neu                            TNeu044e24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTTTCTGTGTCAGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATG
  5   1   2       add Tbd1      in                         CBXT2156.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCAAGGTTTAAGGCTAGGCATAGTGGGGTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTTTAGGGCATGGGGAGATTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTAAATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGGTTAAAACAAAAATGAAAAAAAAAAAAAAA
  3   1   2       add Tbd1      in                         CBXT2156.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCAAGGTTTAAGGCTAGGCATAGTGGGGTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTTTAGGGCATGGGGAGATTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTAAATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGGTTAAAACAAAAATGAAAAAAAAAAAAAAA
  3   1   3        nb Gas0      in                         dad17c05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATGAAAAAANAAAAA
  3   1   2       ext Tbd0 5g3  in                     NISC_nl02g10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTAGGGTAAAGTTTACTTCCTCCCAAATCCCTTTTTCATAATGATTTTAAACCAGCCAACTCTATAGGGTTGCCGTTTTTTAAGTTTTTGCAGGGGGGTTATAGGGCATAGGGGGGTTTTAACCATTTTCCTACCCTGTTTTTTGAGTTGTTTAAACATGTCCAAATGGCTTCAAAGATTCTGCCCCAGCCCTTGTCAGTTGGTTCCTAAAAAAGTGTTCCCGAGAATTTGTAGGGGGGAATTTTGCTTTCAGGCAATTTTTTTAGTGGCCCGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGAAGTTGGGGGTTCTAAAAAACCCAGTAGGGTACCTTCCCTAATTTTTCATGTTTGCCCTTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATTCCCCTAATAAAGTTTTAAACCAAAATGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  3   1   2       ext Gas1 5g3  in                     NISC_mq24c12.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATTTTGCTTTCAGGCAATTTTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGGTACATTCCCTAATTTTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTaaaacaaaaatgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  5   1   3        nb Tbd1      in                         CBXT2817.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTAAATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGGTTAAAACAAAAATGAAAAAAAAAAAAAAA
  3   1   3        nb Tbd1      in                         CBXT2817.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTAAATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGGTTAAAACAAAAATGAAAAAAAAAAAAAAA
  5   1   3        nb Neu                            TNeu011g22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTANCTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATG
  5   1   2  SIG                                      Xt7.1-CABI4832.3                                                                                                                           CCTCGTGCCGGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCGGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTAATACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTTCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGACCACAGTGAAATACTGCAAAGCTTTTTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGAGAAGGAAAGGCTAACAAAGAGTTAATCTCAAGCTGCAGGCTTACCTTCAGTTGTCTCAATAGTGCCCTTAAGTCTCCCCATATTTCACCTGTTCAGATGATCAGAAGCCAAACAGGAAGAAAAAACGCTGAGCTGTGTAAAGAAAGTTCCCATAATGCCTCACTCCTGCACCAAGACCGAGACCAAGTGTACATTCTCAGTTAGTTAGACTATGAGTCAGCTTCCTGCTGATTGGCTCAGATCCACATTCCTAAGGAGGGGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATATCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACA
                                                  Xt7.1-CHK-1008275532                                                                                                                                 GCCGGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCGGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTAATACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTTCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGACCACAGTGAAATACTGCAAAGCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGAGAAGGAAAGGCTAACAAAGAGTTAATCTCAAGCTGCAGGCTTACCTTCAGTTGTCTCAATAGTGCCCTTAAGTCTCCCCATATTTCACCTGTTCAGATGATCAGAAGCCAAACAGGAAGAAAAAACGCTGAGCTGTGTAAAGAAAGTTCCCATAATGCCTCACTCCTGCACCAAGACCGAGACCAAGTGTACATTCTCAGTTAGTTAGACTATGAGTCAGCTTCCTGCTGATTGGCTCAGATCCACATTCCTAAGGAGGGGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATATCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATG
  5   1   4      seed Ski1      in                        CABJ10641.5p                                                                                                                           CCTCGTGCCGGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCGGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTAATACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTTCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCANAGGANAGCTTAGTGGATAATGCAACAGAGAAGGAGG
  5   1   3        nb Fat1      in                         CABC5325.5p                                                                                                                                   TTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCCATTTTGATGTTCTGTTGTTTGGCGCACACAGTCTTATCCCAGTCACAGGGGGATTTTCATCATGGCCATAGTCATGGTCACCATGGACATGGCCATAGTCATCATGGACATGATTGCCATGGACACAGTCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGCCATAGCCATGTTCATCATGGGCATAGCCATCAGGATCACCATGGACACAGCCATGAGGAAAGCCAGCAAGGACATAATCGGGATCATAAAGAGCAGAGTCATATAGAAGTGGAGCGCACCAAAAGAGAGGCAGCAGCTGGAGATAATTTAATACATGGTCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTCTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATACTCTTCCTGATACCTGTACAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAACTACTTCTGAGCTTTGCCTCAGGTGGGCTTCTTGGAGACGCCTTCTTGCACCTTATCCCTCATGCACTTGAGCCACATTCTGTACACGAGGCAGTTGAAGAGCCTGAAGAATCACATGGTCATGGACACTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTTCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGC
  5   1   2       ext Liv1      in                         CAAR8421.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTCATGGTCATAGCCACTCCCAGATGATGTCAGTTGGCCTTTGGGTCCTTGCTGGAATCATTGCCTTTCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTANCAGGTCAACAAACAGGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCT
  5   1   2       ext Ovi1      in                         CABI4832.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAAGCTTAGTGGATAATGCAACAGAGAAGGAGGAGGAAAAAGACCTAGGGAAGGATGGTGTGAGACACAGAAAGAAAGGAAGTAGTAATGTGCAGAAAGGAAAAAACGGCAAAAAGGAACCACAATCAGAAATGACCGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGACTAGCAATTGGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGACCACAGTGAAATACTGCAAAGCTTTTTAA
  5   1   2       ext Bone      in                        CBTC6541.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGAGAAGGAAAGGCTAACAAAGAGTTAATCTCAAGCTGCAGGCTTACCTTCAGTTGTCTCAATAGTGCCCTTAAGTCTCCCCATATTTCACCTGTTCAGATGATCAGAAGCCAAACAGGAAGAAAAAACGCTGAGCTGTGTAAAGAAAGTTCCCATAATGCCTCACTCCTGCACCAAGACCGAGACCAAGTGTACATTCTCAGTTAGTTAGACTATGAGTCAGCTTCCTGCTGATTGGCTCAGATCCACATTCCTAAGGAGGGGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACT
  3   1   3        nb Fat1      in                         CABC5325.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 cagatgatcagaagccaaacaggaagaaaaaacgctgagctgtgtaaagaaagttcccataatgcctcactcctgcaccaagaccgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggaggggggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATATCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAAC
  3   1   4      seed Ski1      in                        CABJ10641.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   acaggaagaaaaaacgctgagctgtgtaaagaaagttcccataatgcctcactcctgcaccaagaccgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggaggggggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATATCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAAC
  3   1   2       ext Liv1      in                         CAAR8421.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            aaaacgctgagctgtgtaaagaaagttccccataatgcctcactcctgcaccaagaccgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggaggggggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATATCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTAAAAC
  3   1   2       ext Ovi1      in                         CABI4832.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ataatgcctcactcctgcaccaagaccgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggaggggggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATATCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAAACAAAAATG
  3   1   2       ext Bone      in                        CBTC6541.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCACCAAGACCGAGACCAAGTGTACATTCTCAGTTAGTTAGACTATGAGTCAGCTTCCTGCTGATTGGCTCAGATCCACATTCCTAAGGAGGGGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATATCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTAAAAC
  5   1   2                                           Xt7.1-XZT45512.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGNCACCTGGAAGACTGACTAAANGAGGCATAAATAAGATAAGTCTGTACATATAATATAGTCTCCACTGAATCTCTCTGCNGTGCCAGGACCACACTGACAATCGGTTNCAGTTTCAAGAAAAATCTGTCAGCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTGGGTCTCATGATTGCAGGATTTGGTCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGAGAAGGAAAGGCTAATAAAGAATTAATCTCAAGCTGCAGGCATACCTTCAGTTGTCTCAATAGTGCCCTTAAGTCTCCCCATATTTCACCTGTTCAGATGATCAGAAGCCAAACAGGAAGAAAAAACGCTGAGCTGTGTAAAGAAAGTTCCCATAATGCCTCACTCCTGCACTGAGACCAAGTGTACATTCTCAGTTAGTTAGACTATGAGTCAGCTTCCTGCTGATTGGCTCAGATCCACATTCCTAAGGAGGGGGGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAACAAA
                                                  Xt7.1-CHK-1008275522                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGNCACCTGGAAGACTGACTAAANGAGGCATAAATAAGATAAGTCTGTACATATAATATAGTCTCCACTGAATCTCTCTGCNGTGCCAGGACCACACTGACAATCGGTTNCAGTTTCAAGAAAAATCTGTCA------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTTATTTTGGGTCTCATGATTGCAGGATTTGGTCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGTATGCTTTAAAGGAGAAGGAAAGGCTAATAAAGAATTAATCTCAAGCTGCAGGCATACCTTCAGTTGTCTCAATAGTGCCCTTAAGTCTCCCCATATTTCACCTGTTCAGATGATCAGAAGCCAAACAGGAAGAAAAAACGCTGAGCTGTGTAAAGAAAGTTCCCATAATGCCTCACTCCTGCACTGAGACCAAGTGTACATTCTCAGTTAGTTAGACTATGAGTCAGCTTCCTGCTGATTGGCTCAGATCCACATTCCTAAGGAGGGGGGGGAGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTA
  5   1   4      seed Gas1 5g3  in                       IMAGE:6989851                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGCCTCGTTCCTAGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCTTACATGAAGTACCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACGAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGNCACCTGGAAGACTGACTAAANGAGGCATAAATAAGATAAGTCTGTACATATAATATAGTCTCCACTGAATCTCTCTGCNGTGCCAGGACCACACTGACAATCGGTTNCAGTTTCAAGAAAAATCTGTCAGCCCAA
  5   1   2   12  ext Tad5 5g3  in                         XZT45512.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTTTTTTTATTTTGGGTCTCATGATTGCAGGATTTGGTCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATgtatgctttaaaggagaaggaaaggctaataaagaattaatctcaagctgcaggcataccttcagttgtctcaatagtgcccttaagtctccccatatttcacctgttcagatgatcagaagccaaacaggaagaaaaaacgctgagctgtgtaaagaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggaggggggggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAG
  3   1   4      seed Gas1 5g3  in                       IMAGE:6989851                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        NGTGTNAAgaaagttcccataatgcctcactcctgcactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggagggggtgggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTCANNNCNNGACATTNN
  3   1   2       ext Tad5 5g3  in                         XZT45512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTGCactgagaccaagtgtacattctcagttagttagactatgagtcagcttcctgctgattggctcagatccacattcctaaggaggggggggagcaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaacAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAACAAAAATG
  5   1   2                                            Xt7.1-XZG1411.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGTCCGGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTTTTTTAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACACGTAGAGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGGTTAAAACAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008275536                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGCAGGAGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTTTTTTAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACACGTAGAGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGGTTAAAACAAAAAAAAAAAAAAAAAAG
  5   1   4      seed Gas7      in                          XZG1411.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGCAGGCACCGCTTGCTCACTCTTGGCAGAAGGAATTGGGGAAGCTGCGACTTTATGGATCCTGCCATTTACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGATTCGCGCCCTTCTCAGTCCATCCTTGAAACTTTTGGACTTCTCCTTGGGGTCGCTATGATGGTTCTTATTGCACAGTTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAGTACTGCAAAGCTTTTAAAGGGGATAATGCGCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTGACTAAAAGGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACA
  3   1   2       ext Gas7      in                          XZG4066.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACGCGTCCGGCaggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTTTTTTAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACACGTAGAGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGGTAAAAC
  5   1   2       ext Gas7      in                          XZG4066.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          gagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTTTTTTAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACACGTAGAGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGGTTAAAACAAAAAAAAAAAAAAAAAAGG
  3   1   4      seed Gas7      in                          XZG1411.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      agtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctCTTTTAACAAAAATGTGGAGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCACTCTTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTTTAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACACGTAGAGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGCTACATTCCCTAATTCTTCATGTCTGCCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGGGTTAAACAAAAGGGG
  5   1   2                                         Xt7.1-TTbA046o24.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTAGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAATACTGCAAAGCTTTTTAAAGGGGATAATGCTCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTAAAAAGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACACAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTTGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTAATTAGATCAATTGGGATAGCTCAACAAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGGTGCTTTAAAG------------CAAAAAAANAAT------------AAAGGTTTTTTT------------------------TTCCATGATTAACTGGNGAAAAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATATCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGGTACATTCCCTAATTCTTCATGTCTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAACAAAAATGAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008275526                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTAGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAATACTGCAAAGCTTTTTAAAGGGGATAATGCTCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTAAAAAGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACACAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTTGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCxxxxxATTAGATCAATTGGGATAGCTCAAxxAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGGTGCT------------GAAAGCCAAAAA------------CAAAGAAAAGGT------------CCCAGGGGACGG------------GATTAACTGGNG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGAGAGCAGAGAGCTGCGTGTCTCTGGCACATGAATTACAGACGCAAGAAATCTTTTGACAGAAGTCAGTGCAGCATTTCTGTGAGTGCTTATGGCTGTATTTACATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTTTCTTTCTCTTTTAACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATATCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGGTACATTCCCTAATTCTTCATGTCTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAACAAAAATGAAAAAAAAA
  5   1   4      seed TbA       in                   TTbA046o24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTGAGTAGTCACTCACTACAAGGTCAACAAACAGGGAAACATGTCATGGCATTTTTGGGTCTTTGTTAGGATGAGATCATGTGTCTTTCAGGGATGTACCTAGGCCACCTATATTTTGCTAAAGATTATGTCTTAGTTAGAGATTTGTGATATAACATTTTACTGCCATTAACTAGGCAGTTTTGATGTCTTTATACTGCAATACTTTTATGTCCTTTGGCTTCCACGAACCACAGTGAAATACTGCAAAGCTTTTTAAAGGGGATAATGCTCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTAAAAAGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACACAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTTGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTANATCAATTGGGATAGCTCAATCAAATCTGCCTTTGCTAATA
  5   1   2       ext Gas                            TGas037a06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACCACAGTGAATACTGCAAAGCTTTTTAAGGGGATAATGCTCTGTCTATATCACGCTACATTGTAATATAGACAGTGACAGTCTACTTCTCGCAACCTGGAAGACTAAAAAGAGGCATAAATAAAGATAAGTTCTGTACAATATAAATATAGTCTCCACCTGAATCTTCTCTGCGGTTGCCAGGGAAACACAACTGACAAATTCCGGTTTCCAGGTTTCAAAGAAAAAAAATACATGTACAGGCACACACAACACAGACCAACTGCAATCTACACTTTAGTAGAAGTTAATATCATAGAACTCTATGATATACATTTGAAATGCCAAGATAGTTTTCAGCCCTTTTTGTTTTTTTTTTATTTTGGGACCAAATCCTGCAATCATGAGACCCACCATTTCTTTTATTAGATCAATTGGGATAGCTCAATCAAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGG
  3   1   2       ext Egg0      in                         dad62f03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGCCCGGGGATTAGATCAATTGGGATAGCTCAATCAATCTGCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCAGATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATAAATGGTGCTTTAAAGNANAAGGAAAGCCAAAAAAANAATTATNCNCAAAGAAAAGGTTTTTTTNNNCGCCCCAGGGGACGGCATGNNTTCCATGATTAACTGGNGAAAAAGACGGA
  5   1   2       ext Egg0      in                         dad62f03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGGCCCGGGGATTATTTTAATTGGGATAGCTCAATCAATCTCCCTTTGCTAATATTAAATGTGTTTTGTTTTTCTTAAATTCTGTAAATTAGATTTATTTTTATAATAAGATTTGGGGGTTACACGAAAGTAAATGCTGGAACTTTTATCAGATGAGTGAACTACATTATTGGGATCAGAGCANATGTGTTTATATCTGAGCAAAAATGAAAATTGTATAACTAGTATGTAATGGGAAGAAAATAGAGGGACTTTCATA
  3   1   4      seed TbA       in                    TTbA046o24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ggagagagcagagagctgcgtgtctctggcacatgaattacagacgcaagaaatcttttgacagaagtcagtgcagcatttctgtgagtgcttatggctgtatttacatagacctttctgataaagcttacttagtttttacctttctttctcttttaACAAAAATGTGGTGTTTCTGTGTCGGTGTAGCAGTATTTGGGATGACTGGTGTGTGGTTATCTATTATTTGCTACCTTTCTGCATTCCTAAATATCAGGAGTCATTGTTACAGATTAGTGTAATGTTTACTTCCTCACAAATCATATCTTTCATAATGATTCTAAACCAGCAAACTCTATAGGTTTGCTGTTTTTTATGTTTTTGCAGGTGTGTTATAGGGCATAGGGAGGTTTTAACCATTCTCCTACCCTGTCTTTTGAGTTGTCTAAACATGTCCAAATGACTACAAAGATACTGCACCAGCACTTGTCAGTTGGTACCTAAAAATGTGTACCAGAGAATTTGTAGGTGAGAATCTTGCTTTCAGGCAATTCTTATAGTGACCAGTAGAGGGCAGTTTTGTATGTGTTGGTCCTGGATGTTGGGGCTACTAAAAAACACAGTAGGGTACATTCCCTAATTCTTCATGTCTGTCATTGCCCTTAAAGGATTTTTCAAATTGTTTGTAAGAAAATACCGCTAATAAAGTTTAAACAAAAATGAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)