Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 05 Jun 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1  2.71    0Xt7.1-CABI10709.3.5                       149 END     42         91       28                microtubule associated protein XMAP215 isoform Z [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012072563 Xt7.1-CAAM7158.5.5 - 46 ESTs
                                                                       -20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAM7158.5.5                     ATTTAAAACGACCTCCGCTGGATGGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCAAGTTTGAACAGCAGCAGCAGGCCGGAGGGGATGATGGAGGTGATGAAGGTGAAGAGGAGGTTGTACCACAGGTAGATGCCTATGAGCTGCTTGAAGCTGTTGAGATCCTTTCTAAATTGCCCAAAGACTTCTATGATAAAATTGAGGCCAAAAAGTGGCAAGAGAGGAAGGAAGCGCTGGAAGCTGTGGAGGCCCTTGTAAAAAATCCCAAGATTGAAGCAGGAGACTTCGCAGATCTTGTGAAAGCCCTGAAAAAGATTGTTGGAAAAGACACCAATGTTATGCTTGTGGCCCTGGCTGCTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAAGTTCGGATCCTATGCTGGACATATTGTGCCAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAAGAACCCAACAATAAAGCAACAAACCTCCCTTTTCTTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGCCCAAAAGCTTATTAAAACCCTTCTGTGCTGCACTACTTAAGCAAATCAATGACTCTGCCCCAGAGGTGAGAGATGCTGCTTTCGAGGCTCTTGGCACGGCACAGAAGGTGGTTGGAGAAAAGGCAGTCAACCCGTTCCTTGCAGAAGTGGATAAACTGAAGCTTGACCGGATTAAGGAATGTGCCGAAAAGGTGGAGTTGGCCAGTGGTAAGAAGGGAGGTGCTGCGGCTGGCGAGAAGAAAGAAACCAAAGCTCCAGCTGCAGCACCTGGGAAATCTGTGCCAAATCAGGGAGCAGCAGAGAAGGACACAAAGGATGCAGGGAAAGCAGCTGCAGCTCCCAAAAAAGGCCCTGCTGGCAAGCCAGGAGGACCTGTCAAGAAAGCCAAAGCTCCTGCATCCTCTGGGGCACCTGCAAAGGGCAAAAAGGCTGGGGATAATAAAGAGATAATCGAGCAGGAACTCTCTCCAGAGGCTTGTGAAGAAAGGGCAGCTGCTGTGCTCCCGGCCTCCTGCATGCAGCAACTGGATAGCAATA
                                                  Xt7.1-CHK-1008226089                           TxxGAxCTCCGCxxxxxxGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCAAGTTTGAACAGCAGCAGCAGGCCGGAGGGGATGATGGAGGTGATGAAGGTGAAGAGGAGGTTGTACCACAGGTAGATGCCTATGAGCTGCTTGAAGCTGTTGAGATCCTTTCTAAATTGCCCAAAGACTTCTATGATAAAATTGAGGCCAAAAAGTGGCAAGAGAGGAAGGAAGCGCTGGAAGCTGTGGAGGCCCTTGTAAAAAATCCCAAGATTGAAGCAGGAGACTTCGCAGATCTTGTGAAAGCCCTGAAAAAGATTGTTGGAAAAGACACCAATGTTATGCTTGTGGCCCTGGCTGCTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAAGTTCGGATCCTATGCTGGACATATTGTGCCAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAAGAACCCAACAATAAAGCAACAAACCTCCCTTTTCTTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGCCCAAAAGCTTATTAAAACCCTTCTGTGCTGCACTACTTAAGCAAATCAATGACTCTGCCCCAGAGGTGAGAGATGCTGCTTTCGAGGCTCTTGGCACGGCACAGAAGGTGGTTGGAGAAAAGGCAGTCAACCCGTTCCTTGCAGAAGTGGATAAACTGAAGCTTGACCGGATTAAGGAATGTGCCGAAAAGGTGGAGTTGGCCAGTGGTAAGAAGGGAGGTGCTGCGGCTGGCGAGAAGAAAGAAACCAAAGCTCCAGCTGCAGCACCTGGGAAATCTGTGCCAAATCAGGGAGCAGCAGAGAAGGACACAAAGGATGCAGGGAAAGCAGCTGCAGCTCCCAAAAAAGGCCCTGCTGGCAAGCCAGGAGGACCTGTCAAGAAAGCCAAAGCTCCTGCATCCTCTGGGGCACCTGCAAAGGGCAAAAAGGCTGGGGATAATAAAGAGATAATCGAGCAGGAACTCTCTCCAGAGGCTTGTGAAGAAAGGGCAGCTGCTGTGCTCCCGGCCTCCTGCATGCAGCAACTGGATAGCAATAACTGGA
                                                      consensus depths                          3     5     8    13    12    22    19    29    18    31    21    33    21    33    22    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    34    35    35    35    35    35    35    35    35    35    35    35    35    35    34    34    34    34    34    34    34    34    35    35    35    35    35    35    35    35    33    33    34    34    34    34    34    34    33    33    33    33    32    32    30    31    31    31    23    25    22    24    15    21    10    13     8    11     8     9     7     8     6     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     8     8     9     9     9     9    10    10    10    10     9     9     9     9    10    10    11    11    11    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    11    10    11    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     3     3     3     3     3     3     3     3     3     3     3
  5   1   2  SIG                                      Xt7.1-CAAM7158.5                   CGATTTAAAACGACATAGACGTCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCAAGTTTGAACAGCAGCAGCAGGCCGGAGGGGATGATGGAGGTGATGAAGGTGAAGAGGAGGTTGTACCACAGGTAGATGCCTATGAGCTGCTTGAAGCTGTTGAGATCCTTTCTAAATTGCCCAAAGACTTCTATGATAAAATTGAGGCCAAAAAGTGGCAAGAGAGGAAGGAAGCGCTGGAAGCTGTGGAGGCCCTTGTAAAAAATCCCAAGATTGAAGCAGGAGACTTCGCAGATCTTGTGAAAGCCCTGAAAAAGATTGTTGGAAAAGACACCAATGTTATGCTTGTGGCCCTGGCTGCTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAAGTTCGGATCCTATGCTGGACATATTGTGCCAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAAGAACCCAACAATAAAGCAACAAACCTCCCTTTTCTTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGCCCAAAAGCTTATTAAAACCCTTCTGTGCTGCACTACTTAAGCAAATCAATGACTCTGCCCCAGAGGTGAGAGATGCTGCTTTCGAGGCTCTTGGCACGGCACAGAAGGTGGTTGGAGAAAAGGCAGTCAACCCGTTCCTTGCAGAAGTGGATAAACTGAAGCTTGACCGGATTAAGGAATGTGCCGAAAAGGTGGAGTTGGCCAGTGGTAAGAAGGGAGGTGCTGCGGCTGGCGAGAAGAAAGAAACCAAAGCTCCAGCTGCAGCACCTGGGAAATCTGTGCCAAATCAGGGAGCAGCAGAGAAGGACACAAAGGATGCAGGGAAAGCAGCTGCAGCTCCCAAAAAAGGCCCTGCTGGCAAGCCAGGAGGACCTGTCAAGAAAGCCAAAGCTCCTGCATCCTCTGGGGCACCTGCAAAGGGCAAAAAGGCTGGGGATAATAAAGAGATAATCGAGCAGGAACTCTCTCCAGAGGCTTGTGAAGAAAGGGCAGCTGCTGTGCTCCCGGCCTCCTGCATGCAGCAACTGGATAGCAA
  5   1   2  SIG                                      Xt7.1-CAAM5775.5                    TTAAAGGTGTGAGCTCCGCTGGATGCGCTTGGGCCCTTTGTGCTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCTGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCAAGTTTGAACAGCAGCAGCAG
                                                                   VAR                                 ATAGACGTCGGA
                                                                   VAR                                             CGCTTGGGCCCTTTGTGCTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCTGCTCCGCA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     A-----------
                                               BLH ATG     134    1888                     
                                               BLH MIN     134     200                     
                                               BLH MPR     101     200                     
                                               BLH OVR     134      77                     
                                               CDS MIN     134     200                     
                                               EST CLI      12      48                     
                                               ORF LNG     134      15                     
                                                                                                                                                                                                                           PROTEIN --- Sc ==== 7e-039     NP_013146.1 Microtubule-associated protein (MAP) of the XMAP215/Dis1 family; regulates microtubule dynamics during spindle orientation and metaphase chromosome alignment; interacts with spindle pole body component Spc72p [Saccharomyces cerevisiae] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                PROTEIN --- Ce ---- 9e-054     NP_495784.1 Component of the meiotic and mitotic spindle poles, ZYGote defective : embryoniclethal ZYG-9 (156.2 kD) (zyg-9) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                 PREDICTED = Dr ==== 6e-068     NP_001032756.1 hypothetical protein LOC492614 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 2e-109     XP_790495.2 PREDICTED: similar to Microtubule Associated Protein 215 kDa (XMAP215) [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                 PROTEIN === Dm ==== 3e-160     NP_732105.1 CG5000-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                 PROTEIN === Mm ==== 0          NP_083713.1 cytoskeleton associated protein 5 [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                 PROTEIN === Hs ==== 0          NP_001008938.1 colonic and hepatic tumor over-expressed protein isoform a [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                 PREDICTED = Gg ==== 0          XP_421115.2 PREDICTED: similar to colonic and hepatic tumor over-expressed protein isoform 2 [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          CAB61894.1 Microtubule Associated Protein 215 kDa (XMAP215) [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                 PROTEIN === ?? ==== 0          NP_001090169.1 Microtubule Associated Protein 215 kDa (XMAP215) [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAM7158.5.5                             TGA------------------------------------------TAA------------TGA---------------------------------------TGA---------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
  5   1   2  SIG                                      Xt7.1-CAAM7158.5                   CGATTTAAAACGACATAGACGTCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCAAGTTTGAACAGCAGCAGCAGGCCGGAGGGGATGATGGAGGTGATGAAGGTGAAGAGGAGGTTGTACCACAGGTAGATGCCTATGAGCTGCTTGAAGCTGTTGAGATCCTTTCTAAATTGCCCAAAGACTTCTATGATAAAATTGAGGCCAAAAAGTGGCAAGAGAGGAAGGAAGCGCTGGAAGCTGTGGAGGCCCTTGTAAAAAATCCCAAGATTGAAGCAGGAGACTTCGCAGATCTTGTGAAAGCCCTGAAAAAGATTGTTGGAAAAGACACCAATGTTATGCTTGTGGCCCTGGCTGCTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAAGTTCGGATCCTATGCTGGACATATTGTGCCAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAAGAACCCAACAATAAAGCAACAAACCTCCCTTTTCTTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGCCCAAAAGCTTATTAAAACCCTTCTGTGCTGCACTACTTAAGCAAATCAATGACTCTGCCCCAGAGGTGAGAGATGCTGCTTTCGAGGCTCTTGGCACGGCACAGAAGGTGGTTGGAGAAAAGGCAGTCAACCCGTTCCTTGCAGAAGTGGATAAACTGAAGCTTGACCGGATTAAGGAATGTGCCGAAAAGGTGGAGTTGGCCAGTGGTAAGAAGGGAGGTGCTGCGGCTGGCGAGAAGAAAGAAACCAAAGCTCCAGCTGCAGCACCTGGGAAATCTGTGCCAAATCAGGGAGCAGCAGAGAAGGACACAAAGGATGCAGGGAAAGCAGCTGCAGCTCCCAAAAAAGGCCCTGCTGGCAAGCCAGGAGGACCTGTCAAGAAAGCCAAAGCTCCTGCATCCTCTGGGGCACCTGCAAAGGGCAAAAAGGCTGGGGATAATAAAGAGATAATCGAGCAGGAACTCTCTCCAGAGGCTTGTGAAGAAAGGGCAGCTGCTGTGCTCCCGGCCTCCTGCATGCAGCAACTGGATAGCAA
                                                  Xt7.1-CHK-1008289380                         AAAACGACATAGACGTCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCAAGTTTGAACAGCAGCAGCAGGCCGGAGGGGATGATGGAGGTGATGAAGGTGAAGAGGAGGTTGTACCACAGGTAGATGCCTATGAGCTGCTTGAAGCTGTTGAGATCCTTTCTAAATTGCCCAAAGACTTCTATGATAAAATTGAGGCCAAAAAGTGGCAAGAGAGGAAGGAAGCGCTGGAAGCTGTGGAGGCCCTTGTAAAAAATCCCAAGATTGAAGCAGGAGACTTCGCAGATCTTGTGAAAGCCCTGAAAAAGATTGTTGGAAAAGACACCAATGTTATGCTTGTGGCCCTGGCTGCTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAAGTTCGGATCCTATGCTGGACATATTGTGCCAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAAGAACCCAACAATAAAGCAACAAACCTCCCTTTTCTTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGCCCAAAAGCTTATTAAAACCCTTCTGTGCTGCACTACTTAAGCAAATCAATGACTCTGCCCCAGAGGTGAGAGATGCTGCTTTCGAGGCTCTTGGCACGGCACAGAAGGTGGTTGGAGAAAAGGCAGTCAACCCGTTCCTTGCAGAAGTGGATAAACTGAAGCTTGACCGGATTAAGGAATGTGCCGAAAAGGTGGAGTTGGCCAGTGGTAAGAAGGGAGGTGCTGCGGCTGGCGAGAAGAAAGAAACCAAAGCTCCAGCTGCAGCACCTGGGAAATCTGTGCCAAATCAGGGAGCAGCAGAGAAGGACACAAAGGATGCAGGGAAAGCAGCTGCAGCTCCCAAAAAAGGCCCTGCTGGCAAGCCAGGAGGACCTGTCAAGAAAGCCAAAGCTCCTGCATCCTCTGGGGCACCTGCAAAGGGCAAAAAGGCTGGGGATAATAAAGAGATAATCGAGCAGGAACTCTCTCCAGAGGCTTGTGAAGAAAGGGCAGCTGCTGTGCTCCCGGCCTCCTGCATGCAGCAACTGGATAGCAATAACTG
  5   1   2   14  ext Brn2 5g3  out                       CAAJ11506.5p AGAATACTGCGCTGTGAGCGATTTAAAACGACATAGACGTCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTG
  5   1   2   14  ext Te3  5g3  out                         CAAM406.5p ..................CGATTTAAAACGACATAGACGTCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTA
  5   1   3   14   nb Te3  5g3  out                        CAAM2299.5p ....................ATTTAAAACGACATAGACGTCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCCTGAGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCCAAGAGTTAG
  5   1   2   14  ext Te3  5g3  out                        CAAM6722.5p ..........................AAACGACTAGACGTCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGAGAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTG
  5   1   2   14  ext Brn2 5g3  out                       CAAJ11844.5p ...........................ACGACATAGACGTCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCAAAGAGTTAGAAGAGGAATGGGTGAAGCTTTCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCCAGCAGATCTGAAGGCCAAGTTTGAACAGCAGCAGCAGGC
  5   1   2   14  ext Te3  5g3  out                        CAAM4044.5p .................................TAGACGTCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCC
  5   1   3   14   nb Te3  5g3  out                        CAAM8121.5p ..................................AGACGTCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTTCACAGTCTGC
  5   1   3   14   nb Te3  5g3  out                        CAAM9285.5p ..................................AGACGTCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCCAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAA
  5   1   3   14   nb Brn2 5g3  out                       CAAJ11796.5p .....................................CGTCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCAAAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTTCCAGCAAGATCTGAGGGCCAAGTTTGAACAGCAGCAGCAGGCCGGAGGGGATGATGGAGGTGA
  5   1   2   14  ext Te3  5g3  out                        CAAM7158.5p .....................................CGTCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGCCAAGTTTGAACAGCAGCAGCAGGCCGGAGGGGATGATGGAGGTGATGA
  5   1   3   14   nb Brn3 5g3  out                         CAAK528.5p .......................................TCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTG
  5   1   3   14   nb Te3  5g3  out                        CAAM7335.5p .......................................TCGGAGGGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGNTCCCCAGCAGATCT
  5   1   3        nb Egg0 5g3  out                        dad74d03.y1                                         CCGGGGGGAAGCGCCCGGTGTAACCGGGNGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATT
  5   1   3   14   nb Te3  5g3  out                        CAAM8869.5p .............................................GGTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGNGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGC
  5   1   3   14   nb Te3  5g3  out                        CAAM1593.5p ..............................................GTGGAAGCGCCCGGAGAACCGGGGCGATAACCCTATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAG
  5   1   3   22   nb Gas7 PIPE                            XZG48287.5p ..............................................GTGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGTCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAACAATTGCTGA
  5   1   3   14   nb Brn2 5g3  out                       CAAJ20365.5p ...............................................TGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGATCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTTCCGCTTTCT
  5   1   3   14   nb Brn2 5g3  out                         CAAJ477.5p ...............................................TGGAAGCGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCAAACAGTCC
  5   1   3   14   nb Te3  5g3  out                        CAAM6306.5p .....................................................CGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTG
  5   1   3   14   nb Te3  5g3  out                        CAAM6602.5p .....................................................CGCCCGGAGAACCGGGGCGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCCGCTTCTTGCGTTCCCAGCAAGATCTGAA
  5   1   3   14   nb Te3  5g3  out                        CAAM1473.5p ......................................................................CGATAACAATATAAATCGTGAAGGGCCCGGAGCCGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGANAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTA
  5   1   4   14 seed Te3  5g3  out                        CAAM6697.5p .......................................................................................................CGGGAAGGAAACAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGA
  5   1   2       ext Brn2      out                       CAAJ23048.5p                                                                                                                                                                                                                                                                                                                                                      TCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCAAAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCAAGTTTGAACAGCAGCAGCAGGCCGGAGGGGATGATGGAGGTGATGAAGGTGAAGAGGAGGTTGTACCACAGGTAGATGCCTATGAGCTGCTTGAAGCTGTTGAGATCCTTTCTAAATTGCCCAAAGACTTCTATGATAAAATTGAGGCCAAAAAGTGGCAAGAGAGGAAGGAAGCGCTGGAAGCTGTGGAGGCCCTTGTAAAAAATCCCAAGATTGAAGCAGGAGACTTCGCAGATCTTGTGAAAGCCCTGAAAAAGATTGTTGGAAAAGACACCCATGTTATGCTTGTGGCCCTGGCTGCTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAG
  5   1   2       add Te3       out                       CAAM15294.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCAAAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCAAGTTTGAACAGCAGCAGCAGGCCGGAGGGGATGATGGAGGTGATGAAGGTGAAGAGGAGGTTGTACCACAGGTAGATGCCTATGAGCTGCTTGAAGCTGTTGAGATCCTTTCTAAATTGCCCAAAGACTTCTATGATAAAATTGAGGCCAAAAAGTGGCAAGAGAGGAAGGAAGCGCTGGAAGCTGTGGAGGCCCTTGTAAAAAATCCCAAGATTGAAGCAGGAGACTTCGCAGATCTTGTGAAAGCCCTGAAAAAGATTGTTGGAAAAGACACCAATGTTATGCTTGTGGCCCTGGCTGCTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAAGTTCGGATCCTATGCTGGACATATTGTGCCAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGNNACACAGAACCTCACAATAAAGCAACAAACCTCCCCTTTTCTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGC
  5   1   2       ext Te3       out                        CAAM2519.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGCTGTTTGCGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCAAAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCAAGTTTGAACAGCAGCAGCAGGCCGGAGGGGATGATGGAGGTGATGAAGGTGAAGAGGAGGTTGTACCACAGGTAGATGCCTATGAGCTGCTTGAAGCTGTTGAGATCCTTTCTAAATTGCCCAAAGACTTCTATGATAAAATTGAGGCCAAAAAGTGGCAAGAGAGGAAGGAAGCGCTGGAAGCTGTGGAGGCCCTTGTAAAAAATCCCAAGATTGAAGCAGGAGACTTCGCAGATCTTGTGAAAGCCCTGAAAAAGATTGTTGGAAAAGACACCAATGTTATGCTTGTGGCCCTGGCTGCTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAAGTTCGGATCCTATGCTGGACATATTGTGCCAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAAGAACCCAACAATAAAGCAACAAACCTCCCTTTTCTTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGCCCAAAAGCTTATTAAAACCCTTCTGTGCTGCACTACTTAAGGCAAATCATGACTCTGCCCCAGAGGTGAGAGATGCTGCT
  5   1   3        nb Te3       out                       CAAM16114.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCAAAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCAAGTTTGAACAGCAGCAGCAGGCCGGAGGGGATGATGGAGGTGATGAAGGTGAAGAGGAGGTTGTACCACAGGTAGATGCCTATGAGCTGCTTGAAGCTGTTGAGATCCTTTCTAAATTGCCCAAAGACTTCTATGATAAAATTGAGGCCAAAAAGTGGCAAGAGAGGAAGGAAGCGCTGGAAGCTGTGGAGGCCCTTGTAAAAAATCCCAAGATTGAAGCAGGAGACTTCGCAGATCTTGTGAAAGCCCTGAAAAAGATTGTTGGAAAAGACACCAATGTTATGCTTGTGGCCCTGGCTGCTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAAGTTCGGATCCTATGCTGGACATATTGTGCCAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAAGAACCCAACAATAAAGCAACAAACCTCCCTTTTCTTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGCCCAAAAGCTTATTAAAACCCTTCTGTGCTGCACTACTTAAGCAAATCAATGACTCTGCCC
  5   1   3        nb Te3       out                       CAAM14417.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGGAAGCGCCGGAAGCTGTGGAGGCCCTTGTAAAAAATCCCAAGATTGAAGCAGGAGACTTCGCAGATCTTGTGAAAGCCCTGAAAAAGATTGTTGGAAAAGACACCAATGTTATGCTTGTGGCCCTGGCTGCTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAAGTTCGGATCCTATGCTGGACATATTGTGCCAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAAGAACCCAACAATAAAGCAACAAACCTCCCTTTTCTTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGCCCAAAAGCTTATTAAAACCCTTCTGTGCTGCACTACTTAAGCAAATCAATGACTCTGCCCCAGAGGTGAGAGATGCTGCTTTCGAGGCTCTTGGCACGGCACAGAAGGTGGTTGGAGAAAAGGCAGTCAACCCGTTCCTTGCAGAAGTGGATAAACTGAAGCTTGACCGGATTAAGGAATGTGCCGAAAAGGTGGAGTTGGCCAGTGGTAAGAAGGGAGGTGCTGCGGCTGGCGAGAAGAAAGAAACCAAAGCTCCAGCTGCAGCACCTGGGAAATCTGTGCCAAATCAGGGAGCAGCAGAGAAGGACACAAAGGATGCAGGGAAAGCAGCTGCAGCTCCCAAAAAAGGCCCTGCTGGCAAGCCA
  5   1   2       ext Te3       out                       CAAM15620.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCAGGAGACTTCGCAGATCTTGTGAAAGCCCTGAAAAAGATTGTTGGAAAAGACACCAATGTTATGCTTGTGGCCCTGGCTGCTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAAGTTCGGATCCTATGCTGGACATATTGTGCCAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAAGAACCCAACAATAAAGCAACAAACCTCCCTTTTCTTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGCCCAAAAGCTTATTAAAACCCTTCTGTGCTGCACTACTTAAGCAAATCAATGACTCTGCCCCAGAGGTGAGAGATGCTGCTTTCGAGGCTCTTGGCACGGCACAGAAGGTGGTTGGAGAAAAGGCAGTCAACCCGTTCCTTGCAGAAGTGGATAAACTGAAGCTTGACCGGATTAAGGAATGTGCCGAAAAGGTGGAGTTGGCCAGTGGTAAGAAGGGAGGTGCTGCGGCTGGCGAGAAGAAAGAAACCAAAGCTCCAGCTGCAGCACCTGGGAAATCTGTGCCAAATCAGGGAGCAGCAGAGAAGGACACAAAGGATGCAGGGAAAGCAGCTGCAGCTCCCAAAAAAGGCCCTGCTGGCAAGCCAGGAGGACCTGTCAAGAAAGCCAAAGCTCCTGCATCCTCTGGGGCACCTGCAAAGGGCAAAAAGGCTGGNGATAATAAAGAGATAATCGAGCAGGAACTCTC
  5   1   3        nb Te3                                 CAAM16057.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGACACCAATGTTATGCTTGTGGCCCTGGCTGCTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAAGTTCGGATCCTATGCTGGACATATTGTGCCAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAAGAACCCAACAATAAAGCAACAAACCTCCCTTTTCTTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGCCCAAAAGCTTATTAAAACCCTTCTGTGCTGCACTACTTAAGCAAATCAATGACTCTGCCCCAGAGGTGAGAGATGCTGCTTTCGAGGCTCTTGGCACGGCACAGAAGGTGGTTGGAGAAAAGGCAGTCAACCCGTTCCTTGCAGAAGTGGATAAACTGAAGCTTGACCGGATTAAGGAATGTGCCGAAAAGGTGGAGTTGGCCAGTGGTAAGAAGGGAGGTGCTGCGGCTGGCGAGAAGAAAGAAACCAAAGCTCCAGCTGCAGCACCTGGGAAATCTGTGCCAAATCAGGGAGCAGCAGAGAAGGACACAAAGGATGCAGGGAAAGCAGCTGCAGCTCCCAAAAAAGGCCCTGCTGGCAAGCCAGGAGGACCTGTCAAGAAAGCCAAAGCTCCTGCATCCTCTGGGGCACCTGCAAAGGGCAAAAAGGCTGGGGATAATAAAGAGATAATCGAGCAGGAACTCTC
  5   1   2       ext Te3       out                        CAAM8179.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTGTGGCCCTGGCTGCTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAAGTTCGGATCCTATGCTGGACATATTGTGCCAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAAGAACCCAACAATAAAGCAACAAACCTCCCTTTTCTTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGCCCAAAAGCTTATTAAAACCCTTCTGTGCTGCACTACTTAAGCAAATCAATGACTCTGCCCCAGAGGTGAGAGATGCTGCTTTCGAGGCTCTTGGCACGGCACAGAAGGTGGTTGGAGAAAAGGCAGTCAACCCGTTCCTTGCAGAAGTGGATAAACTGAAGCTTGACCGGATTAAGGAATGTGCCGAAAAGGTGGAGTTGGCCAGTGGTAAGAAGGGAGGTGCTGCGGCTGGCGAGAAGAAAGAAACCAAAGCTCCAGCTGCAGCACCTGGGAAATCTGTGCCAAATCAGGGAGCAGCAGAGAAGGACACAAAGGATGCAGGGAAAGCAGCTGCAGCTCCCAAAAAAGGCCCTGCTGGCAAGCCAGGAGGACCTGTCAAGAAAGCCAAAGCTCCTGCATCCTCTGGGGCACCTGCAAAGGGCAAAAAGGCTGGGGATAATAAAGAGATAATCGAGCAGGAACTCTCTCCAGAGGCTTGTGAAGAAAGGGCAGCTGCTGTGCTCCCGGCCTCCTGCATGCAGCAACTGGATAGCAATAACTGGA
  5   1   3        nb Te3       out                        CAAM5228.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAAGTTCGGATCCTATGCTGGACATATTGTGCCAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAAGAACCCAACAATAAAGCAACAAACCTCCCTTTTCTTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGCCCAAAAGCTTATTAAAACCCTTCTGTGCTGCACTACTTAAGCAAATCAATGACTCTGCCCCAGAGGTGAGAGATGCTGCTTTCGAGGCTCTTGGCACGGCACAGAAGGTGGTTGGAGAAAAGGCAGTCAACCCGTTCCTTGCAGAAGTGGATAAACTGAAGCTTGACCGGATTAAGGAATGTGCCGAAAAGGTGGAGTTGGCCAGTGGTAAGAAGGGAGGTGCTGCGGCTGGCGAGAAGAAAGAAACCAAAGCTCCAGCTGCAGCACCTGGGAAATCTGTGCCAAATCAGGGAGCAGCAGAGAAGGACACAAAGGATGCAGGGAAAGCAGCTGCAGCTCCCAAAAAAGGCCCTGCTGGCAAGCCAGGAGGACCTGTCAAGAAAGCCAAAGCTCCTGCATCCTCTGGGGCACCTGCAAAGGGCAAAAAGGCTGGGGATAATAAAGAGATAATCGAGCAGGAACTCTCTCCAGAGGCTTGTGAAGAAAGGGCAGCTGCTGTGCTCCCGGCCTCCTGCATGCAGCAACTGGATAGCAATAACT
  5   1   2       ext Te3       out                       CAAM13973.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGACATATTGTGCCAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAAGAACCCAACAATAAAGCAACAAACCTCCCTTTTCTTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGCCCAAAAGCTTATTAAAACCCTTCTGTGCTGCACTACTTAAGCAAATCAATGACTCTGCCCCAGAGGTGAGAGATGCTGCTTTCGAGGCTCTTGGCACGGCACAGAAGGTGGTTGGAGAAAAGGCAGTCAACCCGTTCCTTGCAGAAGTGGATAAACTGAAGCTTGACCGGATTAAGGAATGTGCCGAAAAGGTGGAGTTGGCCAGTGGTAAGAAGGGAGGTGCTGCGGCTGGCGAGAAGAAAGAAACCAAAGCTCCAGCTGCAGCACCTGGGAAATCTGTGCCAAATCAGGGAGCAGCAGAGAAGGACACAAAGGATGCAGGGAAAGCAGCTGCAGCTCCCAAAAAAGGCCCTGCTGGCAAGCCAGGAGGACCTGTCAAGAAAGCCAAAGCTCCTGCATCCTCTGGGGCACCTGCAAAGGGCAAAAAGGCTGGGGATAATAAAGAGATAATCGAGCAGGAACTCTCTCCAGAGGCTTGTGAAGAAAGGGCAGCTGCTGTGCTCCCGGCCTCCTGCATGCAGCAACTGGATAGCAATAACTGGAAGGAAAGACTGGCCAGCATGGAG
  5   1   0       chi Te3                                 CAAM10233.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACGATATTGGAGAAGTTTAAGGAGAAGAAGCCTCAGGTTGTTCAGGCCCTTCAAGAAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAAGAACCCAACAATAAAGCAACAAACCTCCCTTTTCTTAGCCAGAAGCTTCCGTCACTGCACTCCTTCCACCCTGCCCAAAAGCTTATTAAAACCCTTCTGTGCTGCACTACTTAAGCAAATCAATGACTCTGCCCCAGAGGTGAGAGATGCTGCTTTCGAGGCTCTTGGCACGGCACAGAAGGTGGTTGGAGAAAAGGCAGTCAACCCGTTCCTTGCAGAAGTGGATAAACTGAAGCTTGACCGGGTATGTGTCAGTATAACTGGGGGCTGAGTGGAAAATAATTTGGTTGGGGAATAGGAGCAAGCTCTGGTCTAGTAATCCATAACAGAGATGGTGCTGCTATATGAAAACTTTTAGTTGTTGCTATAGGTAATAAGACCTGAAGCAGACTGCATTTGATGTTATATATTTGATAATGTTATGTTTTGTCCCCAGATTAAGGAATGTGCCGAAAAGGTGGAGTTGGCCAGTGGTAAGAAGGGAGGTGCTGCGGCTGGCGAGAAGAAAGAAACCAAAGCTCCAGCTGCAGCACCTGGGAAATCTGTGCCAAATCAGGGAGCAGCAGAGAAGGACACAAAGGATGCAGGGAAAGCAGCTGCAGCTCCCA
  5   1   2  SIG                                      Xt7.1-CAAM5775.5                    TTAAAGGTGTGAGCTCCGCTGGATGCGCTTGGGCCCTTTGTGCTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCTGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCAAGTTTGAACAGCAGCAGCAG
                                                  Xt7.1-CHK-1008289378                          GTGTGAGCTCCGCTGGATGCGCTTGGGCCCTTTGTGCTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCTGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCAAGTTTGAACAGCAGCAGCAGGCCGGA
  5   1   2   14  ext Te3  5g3  out                        CAAM5775.5p ........CCGGAGCGATGTTAAAGGTGTGAGCTCCGCTGGATGCGCTTGGGCCCTTTGTGCTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCTGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGC
  5   1   3   14   nb Brn2 5g3  out                       CAAJ13651.5p ...................TTAAAGGTGTGAGCTCCGCTGGATGCGCTTGGGCCCTTTGTGCTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCTGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCAAACAGTCCCGCTTCTGCGTTCCCGCAAGATCTG
  5   1   3   14   nb Brn2 5g3  out                       CAAJ11568.5p .....................AAAGGTGTGAGCTCCGCTGGATGCGCTTGGGCCCTTTGTGCTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCTGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGGATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCNGTCCCAGCAAGATCTGA
  5   1   3   14   nb Te3  5g3  out                       CAAM10324.5p ..........................TGTGAGCTCCGCTGGATGCGCTTGGGCCCTTTGTGCTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCTGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCAAAGAGTTAGAAGAGGAATGNGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTTGCGTTCCCAGCAGATCT
  5   1   2   24  ext Te3  5g                              CAAM8337.5p ..........................TGTGAGCTCCGCTGGATGCGCTTGGGCCCTTTGTGCTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCTGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCCAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCT
  5   1   4   14 seed Brn2 5g3  out                       CAAJ13499.5p ................................CTCCGCTGGATGCGCTTGGGCCCTTTGTGCTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCTGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCNAGTTTGAACAGCAGCAGCAGGCCGAAGGGGATGATGNAGGTGATGAAAGTG
  5   1   3        nb Brn3      out                        CAAK5488.5p                                 CTCCGCTGGATGCGCTTGGGCCCTTTGTGCTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCTGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAAGGCAAGTTTGAACAGC
  5   1   3   14   nb Te3  5g3  out                        CAAM3735.5p ................................CTCCGCTGGATGCGCTTGGGCCCTTTGTGCTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCTGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCCAAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGC
  5   1   3   14   nb Brn2 5g3  out                       CAAJ11668.5p ...................................CGCTGGATGCGCTTGGGCCCTTTGTGCTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCTGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCCAGTTTGAACAGCAGCAGC
  5   1   3   14   nb Te3  5g3  out                       CAAM15744.5p ............................................................CTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCGTGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCAAAGAGTTAGAAGAGGAATGGGTG
  5   1   3   14   nb Te3  5g3  out                       CAAM15743.5p .............................................................CTTGGGAGAGGGTTAAGGGCCCTGCGGACCCCGACGGTACCGATCCGGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGC
  5   1   3   14   nb Te3  5g3  out                       CAAM16472.5p ..............................................................................GGCCCTGCGGACCCCGACGGTACCGATCCTGCTCCGCAGAACATCAGGTTGCTGAAGCAGGGCCGGGGCCGTCACCATGGGGGATGACAGTGAGTGGATGAAACTTCCTGTTGACCAGAAATGCGAACACAAGGTTTGGAAAGCCAGGTTAAATGGTTATGAAGAGGCTGTAAAACTTTTCCAGAAGATTGTGGATGAGAAGAGCCCAGAATGGTCAAAATACCTGGGACTCATAAAAAAATTTGTGACAGAATCCAATGCAGTCGCACAGTTAAAGGGCCTGGAAGCGGCACTGGTTTACGTAGAAAATGCTCACGTGGCGGGAAAGACAACTGGGGAAGTGGTCTCTGGAGTAGTAAACAAAGTATTTAATCAGCCAAAAGCGAGAGCGAAGGAACTGGGAGCAGATATCTGCCTGATGTACGTAGAGATCGAGAAAGCCGAAGCCGTTCAAGAAGAATTGCTGAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCANAGAGTTAGAAGAGGAATGNGTGAAGCTTCCACAGTCTGC
  5   1   2       ext Te3       out                        CAAM2327.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAATTGCTCAAAGGTCTTGATAACAAGAACCCAAAAATCGTAGTAGCCTGTGTGGAAACGCTAAGAAAAGCCCTGAGTGAATTTGGCTCCAAAATTATGACCCTCAAGCCAATTATTAAAGTGTTGCCAAAGCTGTTTGAGTCTCGAGAGAAGGCAGTTCGAGATGAAGCCAAATTGCTGGCGGTTGAGATTTACCGCTGGATCCGAGATGCCCTGAGGCCTCCCTTACAGAACATTAACCCGGTGCAGCTCAAAGAGTTAGAAGAGGAATGGGTGAAGCTTCCACAGTCTGCACCCAAACAGTCCCGCTTCTTGCGTTCCCAGCAAGATCTGAAGGCCAAGTTTGAACAGCAGCAGCAGGCCGGAGGGGATGATGGAGGTGATGAAGGTGAAGAGGAGGTTGTACCACAGGTAGATGCCTATGAGCTGCTTGAAGCTGTTGAGATCCTTTCTAAATTGCCCAAAGACTTCTATGATAAAATTGAGGCCAAAAAGTGGCAAGAGAGGAAGGAAGCGCTGGAAGCTGTGGAGGCCCTTGTAAAAAATCCCAAGATTGAAGCAGGAGACTTCGCAGATCTTGTGAAAGCCCTGAAAAAGATTGTTGGAAAAGACACCAATGTTATGCTTGTGGCCCTGGCTGCTAAATGCATTGCCGGCCTTGCTGCTGGGCTCAGGAAGAAGTTCGGATCCTGTGCTGGACATATTGTGCCAACGATATTGGAGAAGTTAAGGAGAAGAGCCTCAGGTTGTTCAGGCCCTTNCAGAGCCATTGACGCAGTCTTTCTTACCACTACACTGCAAAACATCAGTGAAGACGTCTTGGCTGTTATGGACAACAGAACCCAACAATAAGGCACAAACTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)