Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABC8194.5                           10 END     1           1       10                G protein-coupled receptor 125 [Homo sapiens]

 This cluster: approximate FL confidence score = 97%

 1012072564 Xt7.1-TEgg066h04.3.5 - 78 ESTs
                                                                       ..-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TEgg066h04.3.5                                                                                   AATGCAACTTGTGTAGCTCTCGCTGCTGTACACGGATTGATGTATTACAGCGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGTGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAAGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224035                                                                                         ACTTGTGTAGCTCTCGCTGCTGTACACGGATTGATGTATTACAGCGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGTGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAAGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                        6     9     6    10     6    11     9    14     9    17    10    18    12    18    12    19    12    19    12    19    12    19    19    19    18    19    19    20    20    20    20    20    20    20    19    20    19    20    19    20    19    20    19    20    19    20    19    20    19    20    19    20    19    19    18    20    20    20    21    21    21    21    21    21    20    21    21    21    20    21    20    22    21    22    19    19    19    19    17    18    17    18    19    19    18    19    19    19    19    19    18    18    17    18    21    21    19    19    20    20    19    19    18    20    18    20    17    19    15    16    14    15    15    15    15    15    13    13    10    11    10    11    10    11    10    11    12    13    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    12    14    13    14    13    14    15    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    13    13    12    12    14    14    10    11     9     9    10    10    10    10    10    10    11    11    10    10    11    11    11    11    11    11    11    11    12    12    19    21    18    21    19    21    20    21    22    22    22    22    21    21    21    21    25    25    29    29    30    30    30    30    29    29    29    30    29    31    30    31    33    33    32    33    36    36    36    36    36    36    35    35    35    35    34    34    35    35    35    35    33    34    34    34    34    34    34    34    33    34    35    35    35    35    35    35    34    34    33    34    34    34    34    34    33    34    33    34    33    34    33    34    32    34    34    34    34    34    33    34    33    35    31    35    34    35    35    35    34    35    34    35    31    35    31    35    35    35    33    34    32    34    33    35    33    35    33    35    33    35    33    34    31    34    32    33    32    33    31    32    27    31    28    31    26    31    13    27    10    10
  5   1   2  SIG                                    Xt7.1-TTbA075k20.3 GACAATGGAAAGCGTGAATGCTGATTGGGTGTTCATTTAAAAGTCCACGCGGCCGATTGGATGAGCTTCTACACCGGCAAGTTCTGAAATGCAACTAGTGTAGCTCTCGCTGCTGAACACGGATTGTTGTATTACAGCGATTCCGTCGGTACAATCCGGTATTCTCATTCTGAGGATCAACTTCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAAGCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTTTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATTTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATTTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAAAAG
  5   1   2  SIG                                    Xt7.1-TEgg066h04.3                                                                                AAAAATGCAACTTGTGTAGCTCTCGCTGCTGTACACGGATTGATGTATTACAGCGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGTGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAAGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                   ATTACAGCGATTCCGTCGGTACAATCCGGTATTCTCATTCTGAGGATCAACTTCTCCGGGCGGTACAAGCAGCAGCAGCCACGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                       ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --------T---
                                               BLH ATG     140     941                                                                                   
                                               BLH MIN     140     266                                                                                   
                                               BLH MPR      56     266                                                                                   
                                               BLH OVR     140     284                                                                                   
                                               CDS MIN     140     266                                                                                   
                                               EST CLI     -12       9                                                                                   
                                               ORF LNG     140      66                                                                                   
                                                                                                                                                                                                                 PROTEIN --- Sc ---- 3e-060     NP_011896.1 involved in rDNA replication and Ty1 transposition; Rrm3p [Saccharomycescerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                        PROTEIN --- Ce ---- 8e-110     NP_490774.2 yeast PIF1p helicase homolog (75.2 kD) (pif-1) [Caenorhabditis elegans] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 7e-149     NP_608782.1 CG3238-PA [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 8e-155     XP_785439.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Mm ---- 0          NP_766041.1 PIF1 homolog; DNA helicase-like protein [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PROTEIN --- Hs ---- 0          NP_079325.2 DNA helicase homolog PIF1 [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ==== 0          XP_426648.2 PREDICTED: hypothetical protein [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                        PROTEIN === Dr ==== 0          NP_942102.1 zgc:56161; wu:fe11d03 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 0          AAZ41379.1 PIF1 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN === ?? ==== 0          Q0R4F1 ATP-dependent DNA helicase PIF1 [(unknown)]  =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PREDICTED = Xt ==== 0          NP_001016603.1 hypothetical protein LOC549357 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TEgg066h04.3.5                                                                                                                                                                      TGA------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------TGA------------------------------ATG---------------------------TAG
                                                                   ORF                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2  SIG                                    Xt7.1-TTbA075k20.3 GACAATGGAAAGCGTGAATGCTGATTGGGTGTTCATTTAAAAGTCCACGCGGCCGATTGGATGAGCTTCTACACCGGCAAGTTCTGAAATGCAACTAGTGTAGCTCTCGCTGCTGAACACGGATTGTTGTATTACAGCGATTCCGTCGGTACAATCCGGTATTCTCATTCTGAGGATCAACTTCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAAGCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTTTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATTTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATTTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAAAAG
                                                  Xt7.1-CHK-1008282646       GGAAAGCGTGAATGCTGATTGGGTGTTCATTTAAAAGTCCACGCGGCCGATTGGATGAGCTTCTACACCGGCAAGTTCTGAAATGCAACTAGTGTAGCTCTCGCTGCTGAACACCGATTGTTGTATTACAGCGATTCCGTCGGTACAATCCGGTATTCTCATTCTGAGGATCAACTTCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAAGCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTTTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATTTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATTTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAA
  5   1   2       ext Egg  5x   in                   TEgg077e07.p1kSP6 GACAATGGAAAGCGTGAATGCTGATTGGGTGTTCATTTAAAAGTCCACGCGGCCGATTGGATGAGCTTCTACACCGGCAAGTTCTGAAATGCAACTAGTGTAGCTCTCGCTGCTGAACACCGATTGTTGTATTACAGCGATACCGGCGGGACAATCCGGTATTCTCAATCTGAGGATCAAATTCTCCGGGCGGTACAAGCAGCAGCAGCCACTGACAGGATAATGATGTTAGCACAACAATTGTCTCCAGAAATCCACAGCAGCATCACCATAAAGTATCTTACATTCTTCCGGACATACTCTGAAGCGCAAAGCAATTCGTAATGCGCTCGACTCAGTTGGGCGTAATGACTTCCGTGACCTTGTGTTGAAGGGTACTGATGGAAAGCTCCAACACAACTTT
  5   1   4      seed TbA  5g3  in                   TTbA075k20.p1kSP6                                                                       TACACCGGCAAATTCAAAAATGCAACTTGTGTAGCTCTCGCTGCTGTACCGGATCGTTGTATTACAGCGATTCCGTCGGTACAATCCGGTATTCTCATTCTGAGGATCAACTTCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAAGCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAANATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAA
  5   1   2       ext Egg  5g3  in                   TEgg051c10.p1kSP6                                                                               CCCGGGAAAAATGCAACTTGTGTAGCTCTCGCTGCTGTACACGGATTGTTGTATTACAGCGATTCCGTCGGTACAATCCGGTACTCTCATTCTGAGGATCAACTTCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAAGCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTTTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAG
  5   1   2       ext Gas  5g                        TGas029a22.p1kSP6                                                                                                                       CCCGGGGGTTGTATTACAGCGATTCCGTCGGTACAATCCGGTACTCTCATTCTGAGGATCAACTTCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAAGCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTTTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCT
  5   1   2       ext Egg  5g                        TEgg125b14.p1kSP6                                                                                                                         GGATTGTTGTATTACAGCGATTCCGTCGGTACAATCCGGTATTCTCATTCTGAGGATCAACTTCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAAGCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTTTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCT
  5   1   2       ext Egg  5g                        TEgg132l06.p1kSP6                                                                                                                                                              GGTACTCTCATTCTGAGGATCAACTTCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAAGCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTTTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATC
  3   1   2       ext Egg  5g3  in                    TEgg051c10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATTTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTATTGGTATTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAA
  3   1   4      seed TbA  5g3  in                    TTbA075k20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATTTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATTTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAAAAG
  3   1   2       ext Egg  5x   in                    TEgg077e07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACAGGTGCCTTTTTAGTTGGCATGGGATCTTTCTATCCATAAAAGCCAGGGAATGTCTTTGGTCTGAGGTGAAATATCTTTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTATGTCGCTCTATCCCGATCTCGAAATCTTGGGGGTGTGGGAGTTTTGGATTTTGACCCCAAGGTTGTTAGAGCCAATCCGTATGTTGTGCAGTTTTTCTGTCAAATGAGGAAGGA
  5   1   2  SIG                                    Xt7.1-TEgg066h04.3                                                                                AAAAATGCAACTTGTGTAGCTCTCGCTGCTGTACACGGATTGATGTATTACAGCGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGTGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAAGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008282644                                                                                      GCAACTTGTGTAGCTCTCGCTGCTGTACACGGATTGATGTATTACAGCGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGTGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAAGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg056m14.FL-Sanger                                                                                                                        TGATGTATTACAGCGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGTGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCGAGCCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAAAAAAAAAAAAAAA
  5   1   2       ext Egg  5g3  in                   TEgg050b21.p1kSP6                                                                               CAAAAATGCAACTTGTGTAGCTCTCGCTGCTGTACACGGATTGATGTATTACAGCGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATG
  5   1   2       ext Egg  5g3  in                   TEgg014g17.p1kSP6                                                                                AAAAATGCAACTTGTGTAGCTCTCGCTGCTGTACACGGATTGATGTATTACAGCGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAA
  5   1   3        nb Egg  5g3  in                   TEgg066e05.p1kSP6                                                                                AAAAATGCAACTTGTGTAGCTCTCGCTGCTGTACACGGATTGATGTATTACAGCGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGT
  5   1   4      seed Egg  5g3  in                   TEgg066h04.p1kSP6                                                                                AAAAATGCAACTTGTGTAGCTCTCGCTGCTGTACACGGATTGATGTATTACAGCGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATG
  5   1   3        nb Egg  5g                        TEgg089e16.p1kSP6                                                                                AAAAATGCAACTTGTGTAGCTCTCGCTGCTGTACACGGATTGATGTATTACAGCGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATG
  5   1   3        nb Egg  5g                        TEgg091k17.p1kSP6                                                                                 AAAATGCAACTTGTGTAGCTCTCGCTGCTGTACACGGATTGATGTATTACAGCGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGG
  5   1   2       add Egg  5g3  in                   TEgg060f21.p1kSP6                                                                                           GCAACTTGTGTAGCTCTCGCTGCTGTACACGGATTGTTGTATTACAGCGATTCCGTCGGTACAATCCGGTATTCTCATTCTGAGGATCAACTTCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAAGCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTTTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATG
  5   1   2       add Egg  5g3  in                   TEgg051b21.p1kSP6                                                                                                           CTGTACACGGAATTGATGTATTACAGCGATTCCGGCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTACCAGAACAGATGACTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACGAGAGCAAACTCTTCACCCGTTTCATCCTAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAACCCGTGAACGAGCGCACCCGACTTCTCTCTGGGCTGC
  5   1   0       chi Egg  5g3  in                   TEgg030f12.p1kSP6                                                                                                                      ATTGATGTATTACAGCGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACCGCCTAATTGCAGATCT
  5   1   2       add HdA  5g3  in                  THdA031b19.p1kaSP6                                                                                                                      ATTGATGTATTACAGCGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAGTAAGTCAGTCAGCTTTTGTGATGCGCATTCAAGTGTGACTATTGAAAATAATTCAAATAATTCACTNCTCTTGTTTGTTCTTTACCTCTATAAAAACATCAGATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGGTCCGGGCTGTCTACAGAAACAATCCCTTGGTGTTGAACACAGTTCT
  5   1   2       add Egg  5g3  in                   TEgg048g17.p1kSP6                                                                                                                         TGATGTATTACAGCGATTCCGTCGGTAAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAA
  5   1   3        nb Egg  FL   in                   TEgg056m14.p1kSP6                                                                                                                          GATGTATTACAGCGATTCCGTCGGTAAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCT
  5   1   2       add Egg  5g3  in                   TEgg027b22.p1kSP6                                                                                                                                     CGATTCCGTCGGTACAATCCGGCATTCTCATTCTGAGGATCAACATCTCCGGGCGGTACAAGCAGCAGCAGCCACGGACAGAACAGGATAATGATGTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACCTCTGAGACTCCAGTAAAGGGGAGGGGA
  5   1   3        nb Egg       in                   TEgg030l02.p1kSP6                                                                                                                                                                                                                                    GTTAGCAGAACAGTTGTCTCCAGAAATCCAGAGCAGCATCACCATAGAGTATCTTAATTCTTCCGGACAGACTCTGAAGCGCAAAGCAATTCGTAATGCTCTCGTCTCACTTGGGCGTAATGAATTCCGTGACCTTGTATTGAAGGTTAGTGATGGAAAGCTCCAACAAAACTTTGTCTTGAACCAGATCAAACTCTTCACCCGTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTA
  5   1   0       chi Egg       in                   TEgg006c16.p1kSP6                                                                                                                                                                                                                                                                                                           CCGCTTTTTTTTTTTTTTTTTTTGTTCTCTTTTTTTTTGGGTGTTTTGAATTCTTTGACTTTGTTTTGTTTGTTTTTTGTATTGGACACTTTTTCCCTATTTTGACCCTGCCCCGAAAAAAAAACACGCCCGGGGGGTCCGAGATGGGAAAGCGTCCGTTGGGCTGCTGCCACAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGAAAAATTACTGCACTTTATGAAAACCCTCCTAAGGAGACGTGAAAGCAAGAAAAACGGAAGGGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAAACATCAGCCCAGTGCAGAGGGGGGAGGGGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGACACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTT
  5   1   3        nb HdA       in                   THdA031b15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                              ACTTTGTCTTGAACCATATCACACTCTTCGCCCGTTTCATCCGAGATGGGAACGCGTCCGTTGTGATGTTGCTGGACAATGTCCAGCATTATATATCCTTCTGGCCCTCCTATGCTTGACACCACTTTATGAGAGCCGTCCTAGTTACACCTGACCTATGAAAAATGGAAAAGCTCGTGAATGACCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCGACCCAGTGGGCAATGATGATGTGGAACATGCTATTGACATGTGGGCCAAGGTCAACTCTGAGACTCCAGTAAATGGGAGGGGACTGACTAGCAAAGGGGTGAATGGAG
  5   1   3        nb Egg       in                   TEgg018f18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTTCATCCGAGATGGGAAAGCGTCCGTTGTGCTGCTGCCAGAAAATGTCCAGCTTTTAATATCCAACTGCCCCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGTGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTG
  5   1   3        nb Egg       in                   TEgg040g06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTCAGATAAGTTACAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCAGGAAAAACGGAAAAGCCCGTGAACGAGCGCACCCGCCTTCTTTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGCGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATG
  5   1   3        nb Egg                            TEgg097a15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGCCTTCTCTCTGGGCTGCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGTGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTG
  5   1   3        nb Egg                            TEgg095g21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGTGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTC
  5   1   2       ext Egg       in                  TEgg049i12.p1kSP6w                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCCGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGCGCGCTCCCACCCAAAAGTACATATGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTC
  5   1   3        nb Egg       in                   TEgg013p09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGCGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAA
  5   1   3        nb Egg                            TEgg011o05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGTGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCGAG
  5   1   2       add Egg                            TEgg095l19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCAACTCTGAGACTCCATTAAAGGGGAGGGGACTGATAACAAGGGGATGGATTAACAGATGCCACAAAAAGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCAGCTGTCTACAGAACAATCCTTGGCGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCACGCACAGGAAAGTCTTATTTATTAAAGAAACCAGTTGGCGCCCTCCCACCCAAAAGTACATATGCAACAGCAAGTACTGGACTAACTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCA
  5   1   2       ext Egg       in                   TEgg013f15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGTGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCGAGCCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAA
  5   1   3        nb Gas       in                   TGas055f19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGTGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCGAGCCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAATTAACTGAAGT
  5   1   2       ext Ova1      in                         CABE2605.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCAAGCAGGTCCAGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGCGCGCTCCCACCCAAAAGTACATATGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAAGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGC
  5   1   3        nb Gas8      in                          st95e10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAGGTCCAGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGCGCGCTCCCACCCAAAAGTACATATGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAAGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATC
  5   1   3        nb Neu                            TNeu086k10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATCCCCGGGGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGTGCGCTCCCACCCAAAAGTACATACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTGTTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCGAGCCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCT
  5   1   0       chi Gas                            TGas100a16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCCAACACTATCAATGCCCAAGCAGGTCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAATGTCTTCTTCACGGGCAGTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGATGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCGAACCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTA
  5   1   3        nb Egg       in                   TEgg055j13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACATATGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAAGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAA
  5   1   3        nb Gas7      in                          XZG4980.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACGCAACAGCAAGTACTGGAGTAGCTGCATGCCACATTGGTGGCACAACTCTACATGCGTTTGCAGGTATTGGTACTGGCAAAGCCTCAATAGAACAATGCATTGAACTGGCAAAGAGGCCCGGGGTACGCCAGCACTGGACCGGCTGCAAACATCTAATCATTGATGAGATCTCAATGGTGGAAGGAGAGTTCTTTGATAAGCTCGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCATTTGGTGGCATTCAGCTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAAGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGCAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTANATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGG
  5   1   3        nb Egg                            TEgg065e11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACCATTTGGTGGCATTCAGCTTATTGTATGTGGAGACTTCCTTCAGCTTCCTCCAGGCACTCAAGCCTCAAGCCAAACAAAGTTCTGATTCCAGGCGAGAAGGTGGAGGAAATGCATTCCTCTGAGTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCACTACCCATAAAGTTGAGCGAGATGGAATTCGGGCTACCAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGCTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGAGACCCTATGCTTGTGAGAACTATAAATGCTCAGAGGCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGCTCCT
  5   1   3        nb Gas                            TGas058j16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGGGCTTCCTTCAGCTTCCTCCAGTCACTCAAGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGCGAGAAGCTGGAGGAAATGCATTCATCTGACTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAAGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCC
  3   1   4      seed Egg  5g3  in                    TEgg066h04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAATGCATTCATCTGACTATGGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg  5g3  in                    TEgg066e05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAAAAAAAAAAAAAA
  5   1   3        nb Egg                            TEgg060g17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAATTAACTGAAGTGAGGAGACAAACTGATAAAAACTTCATCTCTCTGCTGCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCC
  3   1   0       chi Egg  5g3  in                    TEgg048g17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCACGAGTGTTTGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAGGGGACTGAGTAACAAAGGGGTGAATGGAGTTAACAGATGCCAGCAAAAACGTACACGGACAGAGTCTTCTAACAGCCTAATTGCAGATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAGCCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg  FL   in                    TEgg056m14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAAGCCATCCGACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATTTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAAAAAAAAAAAAAA
  3   1   2       add Egg  5g3  in                    TEgg060f21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAANCCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATTTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg       in                    TEgg040g06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg                             TEgg047p15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACTTGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATTTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAA
  3   1   2       ext Ova1      in                         CABE2605.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTTGGCAGATGTACAGATGATGTCTCAAGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTC
  3   1   3        nb Egg                             TEgg048h01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACGATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg  5g3  in                    TEgg050b21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTGGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas       in                    TGas055f19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCAGATGTACAGATGATGTCTCAAGGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATTTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTTTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTTTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg                             TEgg067b03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGATGTACAGATGATTCTCAAGAAGCTTCTCCAAACCAGTAGCCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAA
  3   1   2       add HdA  5g3  in                    THdA031b19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATTTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATATCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTTTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAAGC
  3   1   2       ext Egg       in                    TEgg049i12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCGTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATTTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACAATTGTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb HdA       in                    THdA031b15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATTTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTTTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTTCTAAAAATCTCAAAAAAAAAAAAAAAAAAGCG
  3   1   3        nb Gas8      in                          st95e10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCT
  3   1   2       add Egg  5g3  in                    TEgg030f12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAAAAAAAAAAAAAA
  5   1   3        nb Egg       out                  TEgg050a15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATA
  3   1   3        nb Egg  5x3  out                   TEgg063o05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGATGTGGAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg       in                    TEgg030l02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAATAACCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas8                                  st97e10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAATAACCNATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGNCAGTGACCNTATGCTTGTGAAAACTATAAATGCTCAGTGTCCNGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGNGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATNTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTNTACTCTCAAATGAGGAAGGAAAGAGCNTTGCGGCAGACTTGCCTNGAGGACTTCCNGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTNGGTCNNTGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAAC
  3   1   3        nb Gas7      in                          XZG4980.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAATGAGCGTCGCCTTCAGCAGTTACCTGGGGAATCTCATTTATATGAGGCTTTGGACAGTGACCCTATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTCACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACAATTTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAG
  3  -1   0       chi Kid1      out                       CABA10028.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGGTAAACCTTGTACATAAATCTCTCTGAACACAACTTTCGCAActtcggcaaattgcagcaccgtgtatgacatcccaatggcaatttacattgtagccggtgggatggcatttcagggagattagtcgccGGGCGACTAATCTCAGTGTGTCACTGGCCTTAGTGTGATAGTCATCAAGTAGTCATCAGATCGATACATAGCACAATCATCTTAAACAATACCTTATGTTCTTACAATAATGCAATTATTATCCTAATTACATGAACATCTGCTAGTTACTTTATTTAGAGTTCATGTATGTGACTTATGCTTATCTGTACTTTAGTTGTACTGCCTAAACTGTAGCTAAAAAATGATTGAATGCCTTATTTATTCCCCCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAATACCTGCTGTGACTGTGCTTTTTCGATAGTGGAGTTCCCTGTGTAGCATGGGTTTAGCTTTAAAAGCTATAACCGACCGCAAGCTGGTAATACATTAATAATACATAAGAGTGCAATAGATGCTAAAATATAATCATTGNGTATTGCACAAAAAAACTTTGCATTTTTGTTACTTCCAAACACTGAGTGCGTTGAAAGACACTGACACCTAA
  3   1   2       add Egg  5g3  in                    TEgg027b22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATATGAGGCTTTGGACAGTGCCCCTATGTTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTTTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCCCCAATTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTCCAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATTTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTTTATCCATAAAACCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTTTCTCCAGAGCTTGAAATATAGAGGGTTTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTCCAGTTTTATTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGCCCGTGTGTGACCTTTCCTTCATGTTGGTTTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTCCTATTTTTTTTTAAATAAAGATTCTAAAACTCTTAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg       in                    TEgg018f18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATGCTTGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATTTCAAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg       in                    TEgg013f15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAACTCTCAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg       in                    TEgg013p09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAAA
  3   1   0       chi Egg       in                    TEgg006c16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGCGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTGGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACACGGTGCGAATATCTCCGAGCTGGCAACAGTTGCCTAAAAATCCGACAGGGGGTATTTGTATCCAGAAAAACCAGGGAATGTCTTGGGAATGTGGGGAAATCTCATAGTTCTTGACTGTTTGAGAGAGCACAAGGTTCAGTTGTATCTCCAGAACTCGAAATTAAGAGGGTCTTCGAGTTATGGACTTGGACCCCAAGGTTGTTAAAGCCAACTCCAGATGTTTTCCAGTTCTACTCTAAAACGAGGAAGGAAAGCCCAAAGCGGCTGTCTTGCTTTGAGGACTTGAACGTGAGCAAAGAGAAGAGCAAACCGGTTGCGACTTTTCCTTTCATGGAAATATAAGCAACATGTATAGAGAATCGCAGGAGAACAGTAAAATTCGTGAAACCGGGTACACATGTGACTTTTTTTTTTTCGAAGAAAGAATAAAAAAAAAAAAAAAAAA
  5   1   3        nb Egg                            TEgg098f21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCACCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTC
  3   1   2       ext Egg  5g3  in                    TEgg014g17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTAAATCAACAGATTCAGCTGAAGAAAGGGGCACAGGTGATGCTGGCAAAGAATCTGGATGTGTTTCGTGGCTTGGTAAATGGAGCACGTGGTGTTGTCCCCAAGTTTGAAGAAGGAAATAAAAATTTGCCAGTTGTACGGTTCCTGTGTGGTGTTACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATTTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTTTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTTTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTTTTTCCAGAGCTCGAAATTTAGAGGGTCTCCGAGTTATGGACTTTGCCCCCAAGGTTGTTAGAGCCAATCCATATGTTTTCCAGTTTTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTCCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGCCCGTGTGTGCCCTTTCCTTCATGTTGGTCTATGACCCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAACCCTTTTACTATTTTTTTTTAAATAAAGATTTTAAAATTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add Egg  5g3  in                    TEgg051b21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCTGTGTGGTGTTACAGAGGTCATAAACCCAGACCGCTGGGTGTTCAAAGGACTTGTTGTAATTTTTCTGAGCCGGCAACAGCTCCCTTTAAAGTTGGCATGGGTTATTTCTATCCTTAAAAGCCAGGGAATTTCTTTGCACTGTGTGGAAATCTCTTTGTCTCGAGTGTTTGAGAGCGGCCTTGTTTACGTTGCTCTCTCCAGAGCTCGCATTCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTTCCCATAAAGGTGCTTTTGTTCTACAGTTCTACCCTCAAAGGGGGAAGGAAAGTGCTTTGCGGCAGACTTTCCTTGAGGTCTTCCTGGTGTCCCACGACCCTTCCTGACCTTGTGTGACCTTTCCTTCC
  3   1   3        nb Egg       in                    TEgg055j13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAGAGGTCATAAAGCCAGACCGCTGGGTGTTCAAAGGACATGGTGGAATATATCTGAGCCGGCAACAGCTGCCTTTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGAGTGTTTGAGAGCGGCCAAGCTTACGTTGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAA
  3   1   3        nb Ova1      in                          CABE389.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTC
  5   1   3        nb Ova1      in                          CABE389.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCTCTCTCCAGAGCTCGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTAGAGCCAATCCATATGTTCTACAGTTCTACTCTCAAATGAGGAAGGAAAGAGCATTGCGGCAGACTTGCCTTGAGGACTTCCTGGAGAACAAAGAGAATTGCTGACCGTGTGTGACCTTTCCTTCATGTTGGTCTATGAACCTGTATATAGTGTCCCGGTGTAAATAGTGTACAGAAACCTTTTACTATTTTTTTTTAAATAAAGATTCTAAAAATCTCAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)