Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN6872.3                           41 END     1           1        2                Unknown (protein for MGC:52980) [Xenopus laevis]

 This cluster: approximate FL confidence score = 86%

 1012072573 Xt7.1-XZG34810.3.5 - 100 ESTs
                                                                       ...-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZG34810.3.5                                                                                                                                                                                                                                                                                                                                                                                                          CAACTTCCGGGTCAGCGGTTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTTAGTAAAAAAAAAAAAGCAATGTTATTA
                                                  Xt7.1-CHK-1008223248                                                                                                                                                                                                                                                                                                                                                                                                                CCGGGTCAGCGGTTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGxxxAxxAAAAAAxxxxxxGCAATGTTATTAAAGGAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                               3     4     6     7     9    11    13    15    17    18    20    21    24    25    25    26    26    27    26    27    27    28    27    28    27    28    27    29    30    34    31    35    31    35    32    35    32    35    32    35    33    35    33    35    33    35    33    35    32    35    34    35    35    36    36    37    36    37    35    37    36    38    36    39    37    39    37    39    37    39    36    39    40    41    40    42    40    42    36    41    36    41    36    42    38    42    38    42    39    43    39    43    39    43    39    43    39    43    38    42    38    42    38    42    38    41    38    41    40    43    35    38    36    40    36    41    35    40    37    40    36    40    37    40    37    39    36    39    36    38    33    35    31    34    31    33    25    26    20    24    24    25    23    25    23    25    23    25    22    23    23    24    25    26    24    26    23    25    24    25    24    25    23    24    23    24    23    24    24    25    23    24    23    23    24    24    25    26    26    27    28    29    30    30    31    31    33    34    33    34    33    34    33    34    31    32    32    33    33    34    39    41    36    40    41    44    44    47    42    45    41    45    40    45    38    44    41    45    41    46    41    45    42    46    44    50    48    50    45    49    43    49    46    49    45    49    45    47    46    47    42    44    42    44    40    45    40    45    43    46    43    46    40    45    38    44    40    45    40    44    41    44    41    44    41    44    38    46    38    45    38    45    40    46    40    47    37    46    38    46    36    46    34    45    29    45    27    45    19    38    20    34    19    32    19    32    19    31    19    31    19    30    19    30    19    30    19    30    19    29    18    28    18    28    17    27    15    27    16    27    15    27     5    13     9    12     3     4
  5   1   2  SIG                                      Xt7.1-XZG34249.5                                                                                                                                                                                                                                                                                                                                                                                              TAAGTGTGAGAGCAACTTCCGGGTCAGCGGTTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACATTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTT
  5   1   2  SIG                                      Xt7.1-XZG34810.3                                                                                                                                                                                                                                                                                                                                                                                                           AACTTCCGGGTCAGCGGTTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTTAGTTAAAAAAAAAAAACAATGTTATTAAAGGACAATGAAA
  5   1   2                                           Xt7.1-CCAX9452.3                                                                                                                                                                                                                                                                                                                                                                                                                         CGGTTCCTTGATTGTTAAACAGTAGTTGAAGGTATCGATGTTGCTAAACTTGTTGGATCCGCACGGTATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAATTGATCTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTCAAACATTACATAATTAAAGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------C-T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------T---
                                               BLH ATG     120     371                                                                                                                                                                                                                                                                                                                                                                                                          
                                               BLH MIN     120      92                                                                                                                                                                                                                                                                                                                                                                                                          
                                               CDS MIN     120       4                                                                                                                                                                                                                                                                                                                                                                                                          
                                               EST CLI      35       4                                                                                                                                                                                                                                                                                                                                                                                                          
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xt ---- 5e-022     AAI21306.1 Nkrf (NF-kappaB repressing factor) [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dr ---- 1e-044     NP_001006085.1 zgc:101658 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PREDICTED - Gg ---- 2e-067     XP_001232632.1 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                            PREDICTED - Mm ---- 5e-070     NP_765995.1 RIKEN cDNA 4921511I16 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Hs ---- 8e-071     NP_060102.1 hypothetical protein FLJ20036 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Xl ==== 0          AAH60029.1 Unknown (protein for MGC:68690) [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = ?? ==== 0          NP_001083190.1 hypothetical protein LOC398792 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZG34810.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------TAA---------------------------------------------TAA------------------------------TAG------------------TGA---TAA---------------------TAATAA------------------TAA---------------------ATG------------------ATG---------------------------------TAA------------------------------------------------------ATG---------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   1         - Tbd1                                CBXT14750.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTATTTACAACACAACCCGATCTCCGGTTCAAAACTGTGGCTCTATCAAATTCTCTTCTGAATTTGTGTCAACATCAAATTCAGTGATGATCACGTTCCACAGTGATATTTCTATTGTAAAAAGAGGATTTAGTGCTACCTATAGATTTGTGCCACCCCAAAGTAAAGGAACTTAATCAATCTACGTTAGGAAGCCACGTGAAGGAAATCCACTGATTGAGAGGATAATATTTTGTTGATATTTCCATGTTATCATGCAATCATCTTTGAAATCTAGTATGATGATGTGTATGTTAATCTCCCCCTGAAATAAAAGCTTGATAATGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-XZG34249.5                                                                                                                                                                                                                                                                                                                                                                                              TAAGTGTGAGAGCAACTTCCGGGTCAGCGGTTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACATTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTT
                                                  Xt7.1-CHK-1008279248                                                                                                                                                                                                                                                                                                                                                                                                    TGAGAGCAACTTCCGGGTCAGCGGTTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACATTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTTAA
  5   1   4      seed TbA  5g3  in                   TTbA051k20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                              TAAGTGTGAGAGCAACTTCCGGGTCAGCGGTTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACATTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGANAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTANATCTTCCANAAGAAGCAGGATATAAACACGATGCTGCT
  5   1   2   12  ext Gas7 5g3  in                         XZG34249.5p ........................................................................................................................................................................................................................................................................................................................................................................................................GCAACTTCCGGGTCAGCGGTTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACATTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCT
  5   1   2       ext Egg       in                   TEgg013c22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGGGTTCCGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACATTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTA
  3   1   4      seed TbA  5g3  in                    TTbA051k20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATATCATAATAAAAAGCTAATAATTGATCTCTTTAAAAAAAAAAAAAAAAAAGCGC
  3   1   3        nb TbA                             TTbA044d01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTTTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATTTTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATATTAATTTACCAACATTTTGCTTCAAAGGGTAAGAGCTGTTAATGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATAGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTAATTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATATCATAAAAAAAAGCTAATAATTGATCTCTTAAAAAAAAAAAAAAAAAAGC
  3   1   2       ext Gas7 5g3  in                         XZG34249.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTT
  3   1   2       ext Egg       in                    TEgg013c22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTGGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTTAAAAAAAAAAAAAAAAAAA
  3   1   3        nb HdA       out                   THdA038n16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGGAACTTGTGTAGCAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATATTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTTTGCAAAAAAATGTTGAATTTAATATCATAATAAAAAGTTAATAATTGATTTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTTAAAAAA
  5   1   2  SIG                                      Xt7.1-XZG34810.3                                                                                                                                                                                                                                                                                                                                                                                                           AACTTCCGGGTCAGCGGTTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTTAGTTAAAAAAAAAAAACAATGTTATTAAAGGACAATGAAA
                                                  Xt7.1-CHK-1008279250                                                                                                                                                                                                                                                                                                                                                                                                                 CGGGTCAGCGGTTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCxxAxxxAAAAAAxxxxxxCAATGTTATTAAAGGACAATGAAAGGTTAA
  0   1   1           Gas  FL                     TGas126e17.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   12  ext Gas7 5g3  in                         XZG38516.5p ..........................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCNTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGGATATAACACGATGCTGCTCA
  5   1   2       add TpA  5g3  in                   TTpA075d11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                          CAACTTCCGGGTCAGCGGTTCCTTGCCTTTTAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACATTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCACAGGACAGATACAAACACAGAATTTTATGANAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAG
  5   1   2   14  ext Brn4 5g3  in                        CAAL21403.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................AACTTCCGGGTCAGCGGTTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAGCAGGATATAACACGATGCTGCTCAGGAGAGAAAAAGCATT
  5   1   3   24   nb Te5  5g                              CAAO6102.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................AACTTCCGGGTCAGCGGTTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGTATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCACCACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAGAAGCAGGATAT
  5   1   3   10   nb Liv1 5g3  in                         CAAR6198.5p ............................................................................................................................................................................................................................................................................................................................................................................................................CTTCCGGGTCAGCGGTTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGANAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAANGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCA
  5   1   2       ext Te5       in                         CAAO8314.5p                                                                                                                                                                                                                                                                                                                                                                                                                         CGGTTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACATTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTANATCTT
  5   1   3        nb Egg  5g3  in                   TEgg037h23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                            TTCCTTGATTGTAAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGTATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCACCACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGT
  5   1   3        nb HdA  5g3  in                  THdA001p01.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGATTGTATACAGTCCTTGATGGTATCGTTGTTGCTGCCTTGTTGGATCCGCGCGGCTTTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACGTGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGTGCCGAAACCCTGACACTGCCGCCTGGCTGGAGCGTGTTCACGGGGAGTGCGCAGTCGGACAACTGGTGGCATCTCCGCGGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCCACCACGAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGATGCCGATCATGTCTTCCCTGGCTGCACGTACCCCCTTCCTGTTATGGAAAAAGTGCTTAAGATGGCGCAAATATTATGGTGACTGATGCACCATCCCATACAACACGTGATGAACTGGTTGCCAAGGT
  5   1   3        nb Egg  5g                        TEgg084n22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAACAGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTTACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAG
  3  -1   3        nb Brn4      out                        CAAL8400.3p                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGCGATTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGTATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCACCACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTTAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAG
  5   1   3        nb Gas8      in                          st23g06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTAGTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCTTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATA
  3  -1   3        nb Egg       in                    TEgg031f12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGTCGACCCCGGGGGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACATTCCATCTACTAGTCTAAANTAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTTATGAAAAAGTCANGGTAATCCGCCGGGCTCTCTTCCTGTGACCAAAGCTAAATCTAGC
  5   1   3   12   nb Gas7 5g3  in                         XZG52868.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTGAAGGTATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAG
  5   1   3        nb Neu  5g3  in                   TNeu110d14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTAC
  5   1   3        nb Gas  5g                        TGas003a17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACT
  5   1   3        nb Te5       in                         CAAO3579.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGTTGTTGCTAAACTTGTTGGATCCGCACGGTATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCACCACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAGAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTANATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCT
  5   1   3   12   nb Gas7 5g3  in                         XZG34810.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCANAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAGCCATTCTGTTAAAGGTCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTC
  5   1   3        nb Gas  FL   in                   TGas126e17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTA
  5   1   3        nb Egg  5g                        TEgg098p16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAA
  5   1   3   12   nb Gas7 5g3  in                         XZG44739.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTANATCTT
  5   1   4   10 seed Ovi1 5g3  in                         CABI6902.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCANGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTTACAGATTTATACAGACAGTAGCT
  5   1   3   12   nb Gas7 5g3  in                         XZG22060.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCACGGTATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCACCACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGGTACACTCCAATGCAG
  5   1   3   10   nb Ova1 5g3  in                         CABE1695.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTTCTTAACAGATATA
  5   1   3        nb TbA       in                   TTbA060i17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCCCGGGGAGTGCGAGTCGGACAAGTGGTGGCACCCACCGCAGGGAATTCATTCTCCCGGAACCCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCCTTGCCTACTCCCATGGCGTGGGCCAATCATGTCTTCCACGGGCTGCAGGTACCCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTG
  5   1   3        nb TbA       in                   TTbA079a21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGTGTGCGAGTCGGACAAGTGGTGGCACCACCGCAGGGAATTCATTCTCCGGAACCTGCGCGAAGTGTGCGGGGAAGGAGAGATTCCCGCCACCGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAGGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTAGTCGCCGTTTTCCTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTTACAGATTATACAAGACAGTAGCTTGGANACTTGTATCTGCTGGCG
  5   1   3        nb TbA       in                   TTbA057a24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCACCACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCANAGGACAGATACNAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGNACAAAGCTAAATCTAGCTTANATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCANGAGAGAAAAGCCATTCCTGTAAAGGGTCATCACAGTCTAGCGATAATGCTTTCAAACCTAGTCGCCGTTTCACTTCAGAAGATACCANAGANAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGANACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTTGATCTTTAA
  5   1   3        nb TbA       in                   TTbA068k14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCACCACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACAGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAGGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTAGTCGCCGTTTCACTTCAGAAAATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGANACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTTGCTAACTCCTGCA
  5   1   3        nb TbA       in                   TTbA080a07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCACCACCGCAAGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTATCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCT
  5   1   2       add TbA       in                   TTbA063l14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTTGTTATTGTTTTCTGTCGTAGATCGTGTTCGCGGGGAGTGCGAGTCAGAAAATGGTGGCACCACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGATATATCCCGCCACTGCCTGACACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCCGAAAATATTAGGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTATCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCTCTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCCGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAGAGGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTAGTCGCCGT
  5   1   3        nb Te1       in                         CBWN1677.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCACCACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAAT
  5   1   3        nb Egg                            TEgg115d14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAGGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTAGTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAG
  5   1   3        nb Ova1      in                         CABE1796.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCANGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAAATGGCTGCGGGA
  3   1   3        nb Gas8      in                          st23g06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAA
  5   1   3        nb Gas7                                 XZG33473.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCT
  5   1   3        nb Neu                            TNeu019e21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGGTGAAGAAAAGAGGGATTTCAAGTAGCAATGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAA
  5   1   2       add Te5       in                        CAAO12784.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGA
  5   1   3        nb Eye       in                         CCAX5727.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGGTTGCCAAGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTG
  5   1   3        nb TpA       in                   TTpA030a11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGANAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGNCATAAGAAACCCTCANGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAAACACATTAAAGAGAACTTAGTGCTTTATACTTATTA
  3   1   3        nb Te5       in                         CAAO3579.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGTGAGGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTT
  3   1   2       ext Te5       in                         CAAO8314.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGTGATGGTAACATTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTT
  3   1   3        nb Te6       in                          CABM669.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTG
  5   1   3        nb Te6       in                          CABM669.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7      in                         XZG24119.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGGAGGTTTATTTGTTGGGCAGAAAGAACACCATTAAAGAGAACTTAGTGC
  5   1   3        nb Gas0      in                         dad29c01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGACAGATACAAACACAGACCTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCANGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGA
  5   1   3        nb TbA       in                   TTbA060c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAGAAAAAGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTACTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGG
  3   1   2       add Gas7      in                         XZG42467.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGGGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTAGTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCTTGCGTTGACCTGTCAAAAAT
  5   1   2       add Gas7      in                         XZG42467.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCCATTCTGTTAAAGGTCCATCACAGTCTAGCGATAATGCTTTCAAACCTAGTCGCCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCTTGCGTTGACCTGTCNAAAATAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAGG
  3   1   3        nb Ova1      in                         CABE1796.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGTTTCACTTCAGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGNATCTCTTAAAAAGCCTCTCGC
  3   1   3        nb Neu  5g3  in                    TNeu110d14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAAGATACCAAAGAAAGGCAGCCTTTCTTTAACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Ova1      in                        CABE13297.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAGATTATACAAGACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTACATTGTAACCAAACAGTGGTT
  3   1   2       ext Gas7 5g3  in                         XZG38516.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACAGTAGCTTGGAAACTTGTATCTGCTGGCGGGTTTAATGCCAACCTTAACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTT
  5   1   3        nb Gas7      in                           XZG802.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGCCACCTTACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAANAGCTAATAATTGATCTCTTTAACATGTAACCAACAGTGGTTAATTTTCATGCTGCATGCAGGTTGGCATGGAAAAGAAAATGTGTTTTG
  3   1   3        nb Gas7 5g3  in                         XZG44739.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCATGAAGAACTGCTTAACTCCTGCATTGAATCTTTAAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGGCTAATAATTGATCTCTTTAAAAAAAAAAAAAAAAGG
  3   1   3        nb TbA                             TTbA021l15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGGCCACACTAGACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTAGGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCGATCCATAAGTGTATTGCATACATTTTGTTAGTTAGGGGTTAGGTTTCTGCAAAAAAAATGTTGAATTTAATTTAAAATCATGGTAGGGAGCTAATAATTGATCTCTTTAACATGTAACCAAAAAAAAAAAAAAAAA
  5  -1   3        nb Egg       in                   TEgg031f12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTGTTCCACTGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTATGCAA
  3   1   3        nb Ova1      in                        CABE13297.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAGGACCTGGCAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCANATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATG
  3   1   4      seed Ovi1 5g3  in                         CABI6902.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTTAGTTCTTGATTTGCTGCAATGTTATTAAAGGACAATGAAAGGTTAAATAAATTAAAAGCCTCTCGCCCA
  3   1   3        nb Gas7 5g3  in                         XZG34810.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGATTTACCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTTAAAAAAAAAAAAAAAGG
  5   1   0       chi HdA                            THdA011o17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCTTAGAAATTTGGAAAAGCTATTTCTATGTTAGGGAAAATTTAAATCTGTATTTCGATCTAAAGAGATTGGTGCCTTTTCAGAGAATATACACCAGCAGAAATGTTACGGCACTATGGATACCATTTTGATATGCCTGTGTTTGCTGTTGTTGAACAGATATCTCTGAATATAAGCGACTTTGAACTTGAGAATAATCGCTACTGCATGTATGACTATGTGATTATTTACAACACAACCCGAACTCCGGTTCCATACTGTGGCTCTATCAAATTCTCTTCTGAATTTGTGTCAACATCAAATTCAGTGATGATCACGTTCCACAGTGATATTTCTATTGTAAAAAGAGGATTTAGTGCTACCTATAGATTTGTGCCACCCCAAAGTAAAGGAACTTAATCAATCTACGTTAGGAAGCCACGTGAAGGAAATCCACTGATTGAGAGGATAATATTTTGTTGATATTTCCATGTTATCATGCAATCATC
  3   1   2       add Te5       in                        CAAO12784.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCTCAGGAGAATATAGTTTGTGATTTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCAAAATGTCAAACATTACATTATTAAAGGTTTTTACATTTTGCTT
  3   1   3        nb Te1       in                         CBWN1677.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAAAAAAAAAAAAAAA
  3   1   2       add TbA                             TTbA066j09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAATATAGTTTGTGAATTAAGGTGCAAATAGGTGTATTTAGGAATAGGGTGCGGGAAGACAAAGGAGTCCGCCAAAGCTGTGGCTTTCAGGGAAGCAGTAAAACTGTTTGTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTTGTGATGTGGAGGATTTGGTTTTTTATGAGGAGGAATCTTGACCGGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACATTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTATTTTTCAGTTTTACCAGGGACATACCACATAGTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTATTGGATTGCCTTAAATTGATTTATGTGGTTTTATGGAAAGAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACATTGTAAGAGATTGCAATCCATAAGTGTATTGCATACATTTTGTTAATTAGGGTTAGGTTTCTGCAAAAAAAATGTTGAATTTAATATCATAATAAAAAGCATAATAATTGATCTCTTAACAATGTAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Gas  FL   in                    TGas126e17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTTTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTTTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTTTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGGCTAATAATTGATCTCTTTTAAAGGGAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Ova1 5g3  in                         CABE1695.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTTAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTT
  3   1   3        nb Gas7 5g3  in                         XZG52868.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTTAGTTCTTGATTTGCTGCAATGTTATTAAAGG
  3   1   3        nb Gas0      in                         dad29c01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGAAATCTTTAACATTGTAAAAAAAAAA
  3   1   3        nb HdA  5g3  in                    THdA001p01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCATGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTTTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATTTTTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCTGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Gas7      in                         XZG24119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTT
  3   1   3        nb Gas7 5g3  in                         XZG22060.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGGAAGCTGTAAAACTGTCTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCAAAATGTCAAACATTACATTATTAAAGGTTTTTACATTTTGCTT
  3   1   3        nb Liv1 5g3  in                         CAAR6198.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTTAGTTCTTGATTTGCTGCAATGTTATTAAAGGACAATGAAAGGTTAATAT
  3   1   3        nb TbA       in                    TTbA057a24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTTTGCAAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGGTAATAATTGATCTTTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTTCATGCCAACACTTCCTCAAAATGTCAAACATTACATTATTAAAGGTTTTTACATTTTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Brn4 5g3  in                        CAAL21403.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTT
  3   1   3        nb TbA                             TTbA067k13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTTTTGAAAAAGAAAGTTGTAGTTAGAATTTGCAGAAGAAAATACAATGGTCTTGATGTGGAGGATTTGGTTTTTTTTGATGAGGAATCTTGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTTACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTTAAGAGAACTTAGTGCTTTATAATTTTTTAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTTCCAGGGGCATACCACATACTAATTTTCCAACATTTTGCTTCAAAGCATAAGAGATGTTTTTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTTTAATTTTTAATTGAAACAATTTTTTTCCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTAATTATGCTTAGGTTTTTGCAAAAAAAATTGTTGAATTTAATTTAAAATCATAATAAAAAGGTTATAATTGATTTTTTTAACATTGTAACCAAACAGAGGATTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACGCGGTAATTGGATTATTTTCATGCCAACACTTCCTAAAAAAGTCAAACAATACATTATTAAAGGTTTTTACATTTGAAAAAAAAAAAAAAAANAAAAAGC
  3   1   2       add TbA       in                    TTbA063l14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAAGAAAGTTGTAGTTAGAATATGCTGAAGAAAATACAATGGTAGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATGTAGCCCTGTAAATTTACTTCCGGCGATAAGAAACCTCTCAGGAAATTGTGTAACAGAGGTTTATTTTTTGGGCAGAAAGAACAACATTAAAGGGAATTTAGTGCTTTATAATTATTAAAACATCAGGGTTATTTTATTGGAAATATTTGTACTTTTCAGTTTTACCAGGGGCATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGTTGTTACTGGATGGCTTTAAAATGGATTATGTGGTTTTTTGGAAAAAACATTGGTATGATTTTGGTATAATTTTTAATTGACACAATTTTTAACCTTGTAAATGTTTTCGATCCATAAGTGTAAAGCATACATTTTGTTAATTATGATTAGGTTTGTGCAAAAAAAATGTTGAATTTAATTTAGAATCATAATAAAAAGTTAGTAATTGATCTTTTTTACATGGTTACCAAACAGTGGTTTTATTTTTATGCTGCAATGCAGGTTGGCCAGGGAAAAAGGAAAGGTTGTTTTTAGTTTTATAAACATAAGGTTTTGGGTGCATTGCATTT
  3   1   3        nb Gas7      in                           XZG802.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTAAAAAAAAAAAAAAAAGG
  3   1   3        nb Egg  5g3  in                    TEgg037h23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCAAAATGTCAAACATTACATTATTAAAGGTTTTTACATTTTGCTAAAAAAAAAAAAAAAAA
  3   1   3        nb TbA       in                    TTbA068k14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTTTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTTAAGAATGTCAAACCATTACATTATTAAAGGTTTTTACATTTGAAAAAAAAAAAAAAAAAAAAAAGGC
  3   1   3        nb TbA       in                    TTbA079a21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAAATTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTTTGCAAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGGTAATAATTGATCTTTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAAAGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCAAAATGTCAAACATTACATTATTAAAGGTTTTTACATTTGAAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Spl2                               CBSS10660.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCT
  3   1   0       chi HdA       out                   THdA002a11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATGTGGAGGATTTAATTTTTTATGATGAGGAATCTGGACCTGCAAATTTCCCTCCAGCAGTAGGAAACCCTCAGGAATTTGTGTAACAGAGGCTTATATATTGGGCCGAAAGTTCGGCATTAAATAGAACTTAGTGCTTTATGCTTATTAAAACATCAGGTTTATTTTATATGAAACATTTGTACTTGTCAGTTTTGCCAGGGACTTTCCACATACTAATTTACCAACATTTTGCTTTAAAGCATACGAGCTGTTAGTGGATTGCCTTAAATTGCTTTAGGTGGTTGGATGGAAAAACCATTGGGATGATTTTCCGTATAATTTTTAAATGAAACAATCTTTAACGTTGTAAATGATTGCAATCCATATAGTGTATTGCATACATTTGGTTAATTATGCTTACGTTTCGTGCAAAAAAATGTTGAATTTAAGTTTGAAATCATCCTAAAAAGCTAATAATTGATCTCTTTAACATGGTAACCAACCAGAGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAAATGTTGTTTTTTTTTTATAAACATAAGTTTTTAGGTGCATAACATAAACAAAAAAAGAAAAAAGGAAAATGAATTATTTCCAAACCAACAAATCCTAAAAATGTCAAACAAAACACAAAAAAAGGATTTTACATTTAAAAAAAAAAAAAAAAA
  3   1   3        nb Eye       in                         CCAX5727.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGTAAATTTACCTCCAGCAATAAGAAACCTTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTTA
  3   1   3        nb TpA       in                    TTpA030a11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCGGAAAGAACACCATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTACCCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTTTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATTTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTCCATTTTGCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add TpA  5g3  in                   TTpA075d11.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGAATTTGTGTAACAGGGGTTTATTTGTTGGGCAGAAAGAACAACCTTAAAGGGAACTTGGTGTTTTCTATTTTTTAAAACATCAGGTTTATTTTATTTGAAAAATTTGGACTTTTCAGTTTTACCAGGGGCGTTCCCCATATTAATTTACCCCCCTTTTGTTTCAAAGCTTAAGAGGGGTTATTGGATTCCCTAAAATTGCTTTATGGGGTTTTGGGGAAAAAACATTGGTATGATTTTGGTTTAATTTTTAATGGAAACAATTTTTACCCTTGTAAAGGATTGCAATCCAAAGGGGTATGGCATACATTTTGTTTCTTAAGCTGGGGTTTTTGCAAAAAAATGTTGAATTTATTTTCCTAATAAAAACGCTAAAAATGGATTTTTTTTCCATTGTGAAAAGAAAAAAAAAAAAGAATAAAATTATAGGAAAAAAAAAAAA
  3   1   3        nb TbA       in                    TTbA080a07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAACTTGTGTAACAGAGGTTTATTTGTTGGGCCGAAAGAACCACATTTAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTTCCTGGGACGTGCCACATAGTAATTTACCAACATTTTGCTTCAAAGCATAAGAGTTGTTACTGGATTGCCTTAAAATGCTTTAAGTGGTTTTATGGAGAAAAACATTGGTGTGATTTTTGTGTAATTTTTAATTGGAACAATTTTTAACTTTGTAAATGGTTGCAATCCATAAGTGTATTGCATACTTTTTGTTATTTATGATTAGGGTTGTGCAAAAAAAATGGTGGGTTTAATTTTAAATCATAGTAAAAAGCTGGTAATTGATTTTTTTCACATTGTAACCAAACAGTGGTTTAATTTTTCTGATGCAAGGCAGGTTGGCCAGGAAAAAGAAAATGGCGTTTTTGTTTGATATACATAAGGTTTTAGGAGCCCTGCTTTTTCAATTTTGGACACGCGGTAATTGGATTATTTTCATTCCAACACTTCCTTAAAATGTCAAACATTACATTATTAAAGGTTTTTACATTTGAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb TbA       in                    TTbA060c11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACTTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGAAATGTCAAACATTACATAATTAAAGGTTTTTACATTTTGCTTAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb TbA       in                    TTbA060i17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTGCTTTATACTTATTAAAACATCAGGTGTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATAACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATTTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTTTGCAAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATTTTTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCTAAAATGTCTAAACTATTACTATTATTAAGAGGTTTTTACATTTTGAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Gas0                                 dad49c06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTAGGTTAGGTTTCTGCAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTTAACATTGTAACCAAACAGTGGTTTAATTTTCATGCTGCAATGCAGGTTGGCCATGGAAAAAGAAAATGTTGTTTTTGTTTTATATACATAAGGTTTTAGGTGCATTGCATTTGCAATTTTGGACACCGGTAATTGGATTATTTCCATGCCAACACTTCCTCGGAATGTCAAACATTACATAATTAAAGGATTTTACTTTCGCTTAAAAAAA
  5   1   2                                           Xt7.1-CCAX9452.3                                                                                                                                                                                                                                                                                                                                                                                                                         CGGTTCCTTGATTGTTAAACAGTAGTTGAAGGTATCGATGTTGCTAAACTTGTTGGATCCGCACGGTATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATC
                                                  Xt7.1-CHK-1008279252                                                                                                                                                                                                                                                                                                                                                                                                                               CTTGATTGTTAAACAGTAGTTGAAGGTATCGATGTTGCTAAACTTGTTGGATCCGCACGGTATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTTTGTTCCACTGAAGGACCTGGCAGATTTACCCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAA
  5   1   2       ext Neu  5x                        TNeu138k14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                         CGGTTCCTTGATTGTTAAACAGTAGTTGAAGGTATCGATGTTGCTAAACTTGTTGGATCCGCACGGTATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCACCACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTGCCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACT
  5   1   4      seed Eye       in                         CCAX9452.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCGTTGTTGCTAAACTTGTTGGATCCGCACGGCATTTGTGCCCCTTGGGGCTCCCTGTATCCGTGCCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAGCTTAAATCTTCCAAAAGAAGCAGGATATAAACACGATGCTGCTCAGGAGAG
  5   1   3        nb Gas  5x3  out                  TGas113j09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGGACATGGGGTCTGAGTGCGAGGTGAGCGAGTTCCTGGGCCAGAACCCTGAGACTGCCGCCTGGCTGGAGCGTGTTCGCGGGGAGTGCGAGTCGGACAAGTGGTGGCAACACCGCAGGGAATTCATTCTCCGGAACCTGCGCGATGTGTGCGGGGAAGGAGAGATCCCGCCACTGCCTGAGACCAACCACAAGGAGTTGGACCGGCTTCTTGCCTACTCCATGGCGTGGGCCAATCATGTCTTCACGGGCTGCAGGTACCCCCTTCCAGTTATGGAAAAAGTGCTTAAAATGGCAGAAAATATTAAGGTGACTGATGCACCAACCCATACAACACGTGATGAACTGGTTGCCAAGAAGGGGTAGAAGAGGAGCCATGCAAGAAGCAAAAATCCACTGAAGATCATGGGGCAAGAAAAACCTCGAATGTTAATGACAGAGTAGAAAACAGGAACCAGCCAAGTGACACAATGGAGAGCTCATCAGGGAAAATCTGTGATGGTAACGTTCCATCTACTAGTCTAAATAAGAGAGAGGTACACTCAAATGCAGCGCAAAGGACAGATACAAACACAGAATTTTATGAAAAGTCAGGTAATCGCCGGCCTCTTCCTGTGACCAAAGCTAAATCTAG
  3   1   4      seed Eye       in                         CCAX9452.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACATTGCTTTTGTTCCACTGAAGGACCTGGCAGATTTACCCACAAAATAAAACATCTCAGGAGAATATAGTTTGTGAATTAAGGTGCAAATCTGTGTATTTAGGAATGGGCTGCGGGAAGACAAAGGAGACCGCCAAAGCTGTGGCTTCCAGGGAAGCTGTAAAACTGTTTCTGAAAAAGAAAGTTGTAGTTAGAATATGCAGAAGAAAATACAATGGTCGTGATGTGGAGGATTTGGTTCTTTATGATGAGGAATCTCGACCTGTAAATTTACCTCCAGCAATAAGAAACCCTCAGGAACTTGTGTAACAGAGGTTTATTTGTTGGGCAGAAAGAACAACATTAAAGAGAACTTAGTGCTTTATACTTATTAAAACATCAGGTTTATTTTATTTGAAATATTTGTACTTTTCAGTTTTACCAGGGACATACCACATACTAATTTACCAACATTTTGCTTCAAAGCATAAGAGCTGTTACTGGATTGCCTTAAATTGCTTTATGTGGTTTTATGGAAAAAACATTGGTATGATTTTAGTATAATTTTTAATTGAAACAATCTTTAACCTTGTAAATGATTGCAATCCATAAGTGTATTGCATACATTTTGTTACTTATGCTTAGGTTTCTGCAAAAAAATGTTGAATTTAATTTAAAATCATAATAAAAAGCTAATAATTGATCTCTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)