Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 29 Mar 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ6186.5                           17 END     13         18       81                Unknown (protein for MGC:145793) [Xenopus tropicalis]
     2   2.0    0Xt7.1-CAAM15288.5                           7 END     6           8       85                Unknown (protein for MGC:145793) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012072641 Xt7.1-TEgg057e23.3 - 70 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TEgg057e23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGCGCTGCCAGCAGGGCGGCATTGATACCCGCGTGCGGGGCCTGGAAATCTTAGGGCCAAAGCCGACCTTCTGGCCGGTGTTTAAGGAGCAGCTGTGCCGCCGGACCTTCCTCTTCTACACGAGCAGAGCCCACAGCTGGGGGCAGGAGATTCGGGGGAAGAGGGAGAATCTATTGCAGCTCTTCAGAAGGCTGAACCGCACACTGACGCACGAACAGGAGTTTGCCGATCGCTTTCTGCCAGACGATGAGGCGGCACAGGCTCTGGGTCGGACATGTTGGGAGGCATTAATTGCCCCCCTGGTGCAGAGCATAACTACTCCAGACCCTGGAGGGATGAGCCCCCTGCACTGGCTCCTCACCAAGTACCTGGAAAATGTGCGGCTTTCTAGGCGCCCCAAGTCTCGATCCTCCGTCTTTAACTCCCGCGTGCGCAGGCTGACGCACCTCCTGGTCCACGTGGACTCCAGTCTCCCCGACACAGAGGCCCTGAAACCCCCCAGCAAAACCAATGAGAAAAGTCCAGATTCAGCCTCTTTGCCAACGAAGGGCACCGTTTCTCTCCTGAGCACCATGACGGGGATAGCCGAGTGCTGGCAGGGGGTAGTACAGAAGCAGGTGCAGAGGTTCCTGGAGGTGTCGTGGAACAACACTGATCTGGTTCCTCGGTTCTGCTCGCTGTACCTGGAGCTCAGACAGGCCATGGAGGAGCTGTTTGGGCAACAGACCCTGTTTCTCCTGTCGCTGCGCCAGGGGTTCTGTGAGGGGCTCCTTCAGCTCTCCTTCTTAACCGCACTGCATATAACGGAGCAGTTTGCTCGCTACATAGACTGCAGGATCCAGGAGATCAGCACAGATTACTATAACCTACAGGCCCTCGGCCACTTACAGCAGTTCCTGGAGTTTGTGCTTTTTCTTTCTGACCTGGAACTGGCCAATTCCTTTGAGCACTTCTACAGGCATTACCTGGCGGATCGGCTCCTCTCATTGGGCCCCTCGTGGTTGGAGAGCTCCGTGGTGGATCACATCGGGATTTGCTTCCCAAACAGATTCCCCCAACAGATGCTGAAGAACCTACAGGAGGCCAGTGATCTACAGAGGGAGCAGCACCTGTTCTGCCTGCAGGAAATGGACACCGGGCTCCTGTCTGATGAGGAGGGAGAGGACATGGAGGAGGAGGAGTCTATAGGTGTCGGCCATTTGGGGGAGGAGCCAAAAGTGCACATTTCCGTCTTGTCCCCGCGGTGCTGGGCAATACCGTCTCTTTGCTACATGAAGGATCCTACCAAATATTTCCCAGAATCCCTCTGCCGGCCGCTGAACTGTTTCAAGGACTTCTATACAAAAAGCCAGTCTCTGCAGGGATCTGATCTGACTCAGAGCCGCCGGTTGCAATGGACCTGGTTGGGAAATGCTGAGGTGCAATATGGGAGTTTAACCCTACAAGTTTCCACCCTGCAGATGTTCATTTTGCTGCAGTTTAACCAGCGGGAGGAAGTTTCATTTGAGTCCATAACCCAGGCCACCGGCCTCTCCCAGGTCCTTATTGGCCATGCACTGTCCCCACTCACTGCCAAGGGTGCCATCCTGACCCAGGAGGAGGGGTATCTGCGAGTGAATGGGGAAGCGAGGAGAGAGCCAGGGGCGGGCAGGGTCCTGCGCTTACTTCCCAGACAGACCTACCTGAATGTGGAGGAAGATGAGGGTCGGACACTGGAGAGGAAGAGGAACGTTATCTTTTGCCTCATAACCCAGATCATGAAGGAGGAGAAGGAGCTGCACATTGATAACCTAGTGTTCAGGGTGATTGAGGCCTGTCAGAAAATGGAGTCTGGGCGGAGCCTGAAGTTCCTGAGCTTTGGCTGTAGCCACACGGACGTGCTGTCCTGTATCATGCACCTGATCAGCCAGGGCTACGTGCGGCGCAGCGACGACCGCCCCCATATACTGGAGTATCTGTCCAAGGACCCGGCCACCCCACATAAGGGCAAAGCCCACATCAGCTTCCAGAGCCCGGGCAGGAAGAGACAGGGTCACGGCAGCAATCAGCCCCCCCCCAGCTCCAGTGGAGGAACGGAGCAGGGGGTTCTGGAGACTGTGCTCCTCCCCATGGGGCGGACCCTAAGCCAGGAGGATGTGCGGGCGCTGATGGGCCAGATGGTGGCGCAGGTTTCCCAAACGCTGAGTATCGACCCAGACACGGCCCAACATCTGCTCATTCACTGCAAGTGGAACGTGGACCTCCTGCTGCAGAAATACACGGAAGAACCAGAACTGCTGCTCATCTCCTCCGGCCTGCAAGTGCGGGACCCCCAGCACCCAGAGAGCCCCCAGCCTGCCTGCCCCGTGTGTGTCAGCCCCCTGAGCCCAGCGGAACATCACCCAACTCTGTGCTGCCAGCACCTGTGCTGCAAGAGCTGCTGGAAGGAATATCTGACAACACGAATTGAACAGAATCTGGCGCTGAACTGCACCTGCCCAACCACCGACTGCCTGGCACAGCCCACGTCTGACTTCATCAGCAAGATCATCACCTCCAAGGAGGTCATAGAGAAGTACGAGAAGTCTCTCCTGCGAGGTTTTGTAGAGAACTGCTCCAACCTGACGTGGTGCACAAACCCCCAGGGCTGCGACCGGGTCCTGTGTAAGGAGGGATTGGGCAGCGGCGCCGCCTGTACCAAGTGCTCGTGGCTCTCCTGCTTTAACTGCAGCTTCCCCGAGGCCCATTACCCGGCCAGCTGCAGCCACATGTCCCAGTGGATGGACGACGGGGGCTTCTATGAGGGGATGACTGTGGAGGCGCAAAGCAAACACCTGACCAAGCTGATCTCCAAGCATTGCCCCAGCTGCCAGGCGCCTATCGAGAAGAACGAGGGATGTCTGCATATGACCTGTGCCAAATGTAACCATGGATTCTGCTGGCGATGCCTAAAGCCCTGGAAACCCACCCACAAGGATTATTACAACTGTTCGGCCATGGTCAGTAAAGCCGCCCGGCAGGAGAAGCGGTTCCAGGACTACAATGAGAGATGCACGTTCCAGCACCGTGCCAAGGACTTTGCGGTGTCTCTGCGCAAGCGGCTGAGTGTTCTGAGGGAGGAGCCCCCGTTGCGCTCACTGACCTTCCTCATCACCGCGTGCCGCGTCCTGGAGCAGAGCCGCAAGGTTCTGGGGTACGCCTGTGTCTACAGTTACTACAACCAGGATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACCGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATTTATTCTGACGCTCCGGTGCAGTATGTTCTTTGGGGGGCTGGGTACCCCATTTTAGTGCCAGAGGGACCCACAGGGTGTTGCTAGCCCATTGGGCAATAAGAGAGAGGGGAGCCATGTGGTCCCTTAGCGTTTGGGCTTTTTGTACTGAGAGCTGTACAGCGTCTTTATAAATAAAGTTACAGGAATCCTTCTTGTGTAGCCC
                                                  Xt7.1-CHK-1008224407                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGCCAGCAGGGCGGCATTGATACCCGCGTGCGGGGCCTGGAAATCTTAGGGCCAAAGCCGACCTTCTGGCCGGTGTTTAAGGAGCAGCTGTGCCGCCGGACCTTCCTCTTCTACACGAGCAGAGCCCACAGCTGGGGGCAGGAGATTCGGGGGAAGAGGGAGAATCTATTGCAGCTCTTCAGAAGGCTGAACCGCACACTGACGCACGAACAGGAGTTTGCCGATCGCTTTCTGCCAGACGATGAGGCGGCACAGGCTCTGGGTCGGACATGTTGGGAGGCATTAATTGCCCCCCTGGTGCAGAGCATAACTACTCCAGACCCTGGAGGGATGAGCCCCCTGCACTGGCTCCTCACCAAGTACCTGGAAAATGTGCGGCTTTCTAGGCGCCCCAAGTCTCGATCCTCCGTCTTTAACTCCCGCGTGCGCAGGCTGACGCACCTCCTGGTCCACGTGGACTCCAGTCTCCCCGACACAGAGGCCCTGAAACCCCCCAGCAAAACCAATGAGAAAAGTCCAGATTCAGCCTCTTTGCCAACGAAGGGCACCGTTTCTCTCCTGAGCACCATGACGGGGATAGCCGAGTGCTGGCAGGGGGTAGTACAGAAGCAGGTGCAGAGGTTCCTGGAGGTGTCGTGGAACAACACTGATCTGGTTCCTCGGTTCTGCTCGCTGTACCTGGAGCTCAGACAGGCCATGGAGGAGCTGTTTGGGCAACAGACCCTGTTTCTCCTGTCGCTGCGCCAGGGGTTCTGTGAGGGGCTCCTTCAGCTCTCCTTCTTAACCGCACTGCATATAACGGAGCAGTTTGCTCGCTACATAGACTGCAGGATCCAGGAGATCAGCACAGATTACTATAACCTACAGGCCCTCGGCCACTTACAGCAGTTCCTGGAGTTTGTGCTTTTTCTTTCTGACCTGGAACTGGCCAATTCCTTTGAGCACTTCTACAGGCATTACCTGGCGGATCGGCTCCTCTCATTGGGCCCCTCGTGGTTGGAGAGCTCCGTGGTGGATCACATCGGGATTTGCTTCCCAAACAGATTCCCCCAACAGATGCTGAAGAACCTACAGGAGGCCAGTGATCTACAGAGGGAGCAGCACCTGTTCTGCCTGCAGGAAATGGACACCGGGCTCCTGTCTGATGAGGAGGGAGAGGACATGGAGGAGGAGGAGTCTATAGGTGTCGGCCATTTGGGGGAGGAGCCAAAAGTGCACATTTCCGTCTTGTCCCCGCGGTGCTGGGCAATACCGTCTCTTTGCTACATGAAGGATCCTACCAAATATTTCCCAGAATCCCTCTGCCGGCCGCTGAACTGTTTCAAGGACTTCTATACAAAAAGCCAGTCTCTGCAGGGATCTGATCTGACTCAGAGCCGCCGGTTGCAATGGACCTGGTTGGGAAATGCTGAGGTGCAATATGGGAGTTTAACCCTACAAGTTTCCACCCTGCAGATGTTCATTTTGCTGCAGTTTAACCAGCGGGAGGAAGTTTCATTTGAGTCCATAACCCAGGCCACCGGCCTCTCCCAGGTCCTTATTGGCCATGCACTGTCCCCACTCACTGCCAAGGGTGCCATCCTGACCCAGGAGGAGGGGTATCTGCGAGTGAATGGGGAAGCGAGGAGAGAGCCAGGGGCGGGCAGGGTCCTGCGCTTACTTCCCAGACAGACCTACCTGAATGTGGAGGAAGATGAGGGTCGGACACTGGAGAGGAAGAGGAACGTTATCTTTTGCCTCATAACCCAGATCATGAAGGAGGAGAAGGAGCTGCACATTGATAACCTAGTGTTCAGGGTGATTGAGGCCTGTCAGAAAATGGAGTCTGGGCGGAGCCTGAAGTTCCTGAGCTTTGGCTGTAGCCACACGGACGTGCTGTCCTGTATCATGCACCTGATCAGCCAGGGCTACGTGCGGCGCAGCGACGACCGCCCCCATATACTGGAGTATCTGTCCAAGGACCCGGCCACCCCACATAAGGGCAAAGCCCACATCAGCTTCCAGAGCCCGGGCAGGAAGAGACAGGGTCACGGCAGCAATCAGCCCCCCCCCAGCTCCAGTGGAGGAACGGAGCAGGGGGTTCTGGAGACTGTGCTCCTCCCCATGGGGCGGACCCTAAGCCAGGAGGATGTGCGGGCGCTGATGGGCCAGATGGTGGCGCAGGTTTCCCAAACGCTGAGTATCGACCCAGACACGGCCCAACATCTGCTCATTCACTGCAAGTGGAACGTGGACCTCCTGCTGCAGAAATACACGGAAGAACCAGAACTGCTGCTCATCTCCTCCGGCCTGCAAGTGCGGGACCCCCAGCACCCAGAGAGCCCCCAGCCTGCCTGCCCCGTGTGTGTCAGCCCCCTGAGCCCAGCGGAACATCACCCAACTCTGTGCTGCCAGCACCTGTGCTGCAAGAGCTGCTGGAAGGAATATCTGACAACACGAATTGAACAGAATCTGGCGCTGAACTGCACCTGCCCAACCACCGACTGCCTGGCACAGCCCACGTCTGACTTCATCAGCAAGATCATCACCTCCAAGGAGGTCATAGAGAAGTACGAGAAGTCTCTCCTGCGAGGTTTTGTAGAGAACTGCTCCAACCTGACGTGGTGCACAAACCCCCAGGGCTGCGACCGGGTCCTGTGTAAGGAGGGATTGGGCAGCGGCGCCGCCTGTACCAAGTGCTCGTGGCTCTCCTGCTTTAACTGCAGCTTCCCCGAGGCCCATTACCCGGCCAGCTGCAGCCACATGTCCCAGTGGATGGACGACGGGGGCTTCTATGAGGGGATGACTGTGGAGGCGCAAAGCAAACACCTGACCAAGCTGATCTCCAAGCATTGCCCCAGCTGCCAGGCGCCTATCGAGAAGAACGAGGGATGTCTGCATATGACCTGTGCCAAATGTAACCATGGATTCTGCTGGCGATGCCTAAAGCCCTGGAAACCCACCCACAAGGATTATTACAACTGTTCGGCCATGGTCAGTAAAGCCGCCCGGCAGGAGAAGCGGTTCCAGGACTACAATGAGAGATGCACGTTCCAGCACCGTGCCAAGGACTTTGCGGTGTCTCTGCGCAAGCGGCTGAGTGTTCTGAGGGAGGAGCCCCCGTTGCGCTCACTGACCTTCCTCATCACCGCGTGCCGCGTCCTGGAGCAGAGCCGCAAGGTTCTGGGGTACGCCTGTGTCTACAGTTACTACAACCAGGATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACCGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATTTATTCTGACGCTCCGGTGCAGTATGTTCTTTGGGGGGCTGGGTACCCCATTTTAGTGCCAGAGGGACCCACAGGGTGTTGCTAGCCCATTGGGCAATAAGAGAGAGGGGAGCCATGTGGTCCCTTAGCGTTTGGGCTTTTTGTACTGAGAGCTGTACAGCGTCTTTATAAATAAAGTTACAGGAATCCTTxTxxxG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     5     6     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     8     5     8     7     9     7     9     7     9     7     9     7     9     7     9     7     9     6     9     6     9     6     9     6     9     6     9     7    10     7    10     7    10     7    10     7     9     7     9     7     9     7     9     7     9     5     7     5     7     5     7     5     7     5     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     7     7     7     7     8     8     8     8     7     8     7     8     6     6     6     6     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     5     5     5     5     4     5     5     5     5     5     5     5     4     5     4     6     4     5     4     5     4     5     4     5     4     5     4     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     8     7     8     6     7     6     7     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     9     9     9     9    11    11    11    11    11    11    14    14    14    14    14    15    15    15    17    17    17    17    30    30    31    31    31    31    31    31    31    31    31    31    32    32    30    30    30    30    32    32    33    33    32    33    34    34    34    36    35    35    35    35    36    36    37    37    35    37    36    37    37    38    39    39    37    39    39    39    36    38    38    38    38    38    39    39    37    39    41    41    41    42    42    42    41    42    42    42    42    42    42    42    41    42    39    42    37    42    42    42    42    42    42    42    42    42    41    43    43    43    43    43    43    43    42    42    41    41    39    41    40    41    41    41    41    41    41    41    40    40    39    40    40    40    39    40    38    38    15    19     7    12     8    11     7     9     6     9     7     9     8     9     8     9     8     9     8     9     5     9     6     9     6     9     5     8     4     7     4     6     4     6     2     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------T--T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -T-----A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --C-----G---
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 9e-017     FAA00205.1 TPA: zinc finger protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sc ---- 9e-027     NP_012942.1 Hypothetical ORF; Ykr017cp [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 1e-033     XP_787200.2 PREDICTED: similar to mKIAA1386 protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 5e-037     NP_001041060.1 Temporarily Assigned Gene name family member (tag-349) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 1e-040     NP_477374.1 CG5709-PA [Drosophila melanogaster] --------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xl ---- 3e-043     AAH79979.1 Unknown (protein for MGC:80833) [Xenopus laevis] --------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- ?? ---- 3e-043     NP_001090245.1 ariadne homolog 2 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Dr ==== 6e-068     XP_699257.1 PREDICTED: similar to p53-associated parkin-like cytoplasmic protein [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                  PREDICTED - Gg ---- 0          XP_419329.2 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_055904.1 p53-associated parkin-like cytoplasmic protein; UbcH7-associated protein 1 [Homosapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Mm ---- 0          XP_907535.1 PREDICTED: p53-associated parkin-like cytoplasmic protein isoform 8 [Mus musculus] ---------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          AAI24568.1 Unknown (protein for MGC:145793) [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TEgg057e23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------TGA---------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2       bld Te4       in                         CAAN4625.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTGAACATCTCCAGCACCGCCGGCCGGGTCCTACTGCTTGAGAATGTGACCCGATTCTGGCCCATCATCCAGATCAAGATCAAGCGCTGCCAGCAGGGCGGCATTGATACCCGCGTGCGGGGCCTGGAAATCTTAGGGCCAAAGCCGACCTTCTGGCCGGTGTTTAAGGAGCAGCTGTGCCGCCGGACCTTCCTCTTCTACACGAGCAGAGCCCACAGCTGGGGGCAGGAGATTCGGGGGAAGAGGGAGAATCTATTGCAGCTCTTCAGAAGGCTGAACCGCACACTGACGCACGAACAGGAGTTTGCCGATCGCTTTCTGCCAGACGATGAGGCGGCACAGGCTCTGGGTCGGACATGTTGGGAGGCATTAATTGCCCCCCTGGTGCAGAGCATAACTACTCCAGACCCTGGAGGGATGAGCCCCCTGCACTGGCTCCTCACCAAGTACCTGGAAAATGTGCGGCTTTCTAGGCGCCCCAAGTCTCGATCCTCCGTCTTTAACTCCCGCGTGCGCAGGCTGACGCACCTCCTGGTCCACGTGGACTCCAGTCTCCCCGAAACAGAGGCCCTGAAACCCCCCAGCAAAACCAATGAGAAAAGTCCAGATTCAGCCTCTTTGCCAACGAAGGGCACCGTTTCTCTCCTGAGCACCATGACGGGGATAGCCGAGTGCTGGCAGGGGGTAGTACAGAAGCAGGTGCAGAGGTTCCTGGAGGTGTCGTGGAACAACACTGATCTGGTTCCTCGGTTCTGCTCGCTGTACCTGGAGCTCAGACAGGCCATGGAGGAGCTGTTTGGCCAACAGACCCTGTTTCTCCTGTCGCTGCGCCA
  5   1   2       bld Te3                                  CAAM9012.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGCGCTGCCAGCAGGGCGGCATTGATACCCGCGTGCGGGGCCTGGAAATCTTAGGGCCAAAGCCGACCTTCTGGCCGGTGTTTAAGGAGCAGCTGTGCCGCCGGACCTTCCTCTTCTACACGAGCAGAGCCCACAGCTGGGGGCAGGAGATTCGGGGGAAGAGGGAGAATCTATTGCAGCTCTTCAGAAGGCTGAACCGCACACTGACGCACGAACAGGAGTTTGCCGATCGCTTTCTGCCAGACGATGAGGCGGCACAGGCTCTGGGTCGGACATGTTGGGAGGCATTAATTGCCCCCCTGGTGCAGAGCATAACTACTCCAGACCCTGGAGGGATGAGCCCCCTGCACTGGCTCCTCACCAAGTACCTGGAAAATGTGCGGCTTTCTAGGCGCCCCAAGTCTCGATCCTCCGTCTTTAACTCCCGCGTGCGCAGGCTGACGCACCTCCTGGTCCACGTGGACTCCAGTCTCCCCGAAACAGAGGCCCTGAAACCCCCCAGCAAAACCAATGAGAAAAGTCCAGATTCAGCCTCTTTGCCAACGAAGGGCACCGTTTCTCTCCTGAGCACCATGACGGGGATAGCCGAGTGCTGGCAGGGGGTAGTACAGAAGCAGGTGCAGAGGTTCCTGGAGGTGTCGTGGAACAACACTGATCTGGTTCCTCGGTTCTGCTCGCTGTACCTGGAGCTCAGACAGGCCATGGAGGAGCTGTTTGGCCAACAGACCCTGTTTCTCCTGTCGCTGCGCCAGGGGTTCTGTGAGGGGCTCCTTCAGCTCTCCTTCTTAACCGCACTGCATATAACGGAGCAGTTTGCTCGCTACATAGACTGCAGGATC
  5   1   2       bld Te3       in                        CAAM14028.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGCGTGCGGGGCCTGGAAATCTTAGGGCCAAAGCCGACCTTCTGGCCGGTGTTTAAGGAGCAGCTGTGCCGCCGGACCTTCCTCTTCTACACGAGCAGAGCCCACAGCTGGGGGCAGGAGATTCGGGGGAAGAGGGAGAATCTATTGCAGCTCTTCAGAAGGCTGAACCGCACACTGACGCACGAACAGGAGTTTGCCGATCGCTTTCTGCCAGACGATGAGGCGGCACAGGCTCTGGGTCGGACATGTTGGGAGGCATTAATTGCCCCCCTGGTGCAGAGCATAACTACTCCAGACCCTGGAGGGATGAGCCCCCTGCACTGGCTCCTCACCAAGTACCTGGAAAATGTGCGGCTTTCTAGGCGCCCCAAGTCTCGATCCTCCGTCTTTAACTCCCGCGTGCGCAGGCTGACGCACCTCCTGGTCCACGTGGACTCCAGTCTCCCCGACACAGAGGCCCTGAAACCCCCCAGCAAAACCAATGAGAAAAGTCCAGATTCAGCCTCTTTGCCAACGAAGGGCACCGTTTCTCTCCTGAGCACCATGACGGGGATAGCCGAGTGCTGGCAGGGGGTAGTACAGAAGCAGGTGCAGAGGTTCCTGGAGGTGTCGTGGAACAACACTGATCTGGTTCCTCGGTTCTGCTCGCTGTACCTGGAGCTCAGACAGGCCATGGAGGAGCTGTTTGGGCAACAGACCCTGTTTCTCCTGTCGCTGCGCC
  5   1   2       bld Neu                            TNeu080f17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGATTCGGGGGAAGAGGGAGAATCTATTGCAGCTCTTCAGAAGGCTGAACCGCACACTGACGCACGAACAGGAGTTTGCCGATCGCTTTCTGCCAGACGATGAGGCGGCACAGGCTCTGGGTCGGACATGTTGGGAGGCATTAATTGCCCCCCTGGTGCAGAGCATAACTACTCCAGACCCTGGAGGGATGAGCCCCCTGCACTGGCTCCTCACCAAGTACCTGGAAAATGTGCGGCTTTCTAGGCGCCCCAAGTCTCGATCCTCCGTCTTTAACTCCCGCGTGCGCAGGCTGACGCACCTCCTGGTCCACGTGGACTCCAGTCTCCCCGACACAGAGGCCCTGAAACCCCCCAGCAAAACCAATGAGAAAAGTCCAGATTCAGCCTCTTTGCCAACGAAGGGCACCGTTTCTCTCCTGAGCACCATGACGGGATAGCCGAGTGCTGGCAGGGGGTAGTACAGAAGCAGGTGCAGAGGTTCCTGGGAGTGTCGTGGAACAACACTGATCTGGTTCCTCGGTTCTGCTCGCTGTACCTGGAGCT
  5   1   2       bld Brn2      in                        CAAJ12795.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGACGCGTGGGGGCCAACCAGGCCGGGGGTTCTGTGAGGGGCCCTTCAGCTCTCCTTCCTAACCGCACTGCATGTAAGTCTGGGGCCAACCAGGCCGGGGGTTCTGTGAGGGGCCCTTCAGCTCTCCTTCCTAACCGCACTGCATGTAAGTCTGGGGCCAGCCGGGCCGGGGGTTCTGTGAGGGGCTCCTTCAGCTCTCCTTCCTAACCGCACTGCATGTAAGTCTGGGGCCAGCCGGGCCGGGGGTTCTGTGAGGGGCTCCTTCAGCTCTCCTTCCTAACCGCACTGCATGTAAGTCTGGGGCCAGCCGGGCCGGGGGTTCTGTGAGGGGCCCTTCAGCTCTCCTTCCTAACCGCACTGCATGTAAGTCTGGGGCCAGCCGGGCCGGGGGTTCTGTGAGGGGCCCTTCAGCTCTCCTTCCTAACCGCACTGCATGTAAGTCTGGGGCCAGCCGGGCCGGGGGTTTGGGTTGCTCCTGCCTCTGGGCCCCGTTGGCTGTATATTGGGGTGTCAGGGTTCTGATGGTTCTGATGGCAGCTGTGTGTTACTTGCAGATAACGGAGCAGTTTGCTCGCTACATAGACTGCAGGATCCAGGAGATCAGCACAGATTACTATAACCTACAGGCCCTCGGCCACTTACAGCAGTTCCTGGAGTTTGTGCTTTTTCTTTCTGACCTGGAACTGGCCAATTCCTTTGAGCACTTCTACAGGCATTACCTGGCGGATCGGCTCCTCTCATTGGGCCCCTCGTGGTTGGAGAGCTCCGTGGTGGATCACATCGGGATTTGCTTCCCAAACAGATTCCCCCAACAGATGCT
  5   1   2       bld Brn3      in                         CAAK7716.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGGGAGGCATTAATTGCCCCCCTGGTGCAGAGCATAACTACTCCAGACCCTGGAGGGATGAGCCCCCTGCACTGGCTCCTCACCAAGTACCTGGAAAATGTGCGGCTTTCTAGGCGCCCCAAGTCTCGATCCTCCGTCTTTAACTCCCGCGTGCGCAGGCTGACGCACCTCCTGGTCCACGTGGACTCCAGTCTCCCCGACACAGAGGCCCTGAAACCCCCCAGCAAAACCAATGAGAAAAGTCCAGATTCAGCCTCTTTGCCAACGAAGGGCACCGTTTCTCTCCTGAGCACCATGACGGGGATAGCCGAGTGCTGGCAGGGGGTAGTACAGAAGCAGGTGCAGAGGTTCCTGGAGGTGTCGTGGAACAACACTGATCTGGTTCCTCGGTTCTGCTCGCTGTACCTGGAGCTCAGACAGGCCATGGAGGAGCTGTTTGGGCAACAGACCCTGTTTCTCCTGTCGCTGCGCCAGGGGTTCTGTGAGGGGCTCCTTCAGCTCTCCTTCTTAACCGCACTGCATATAACGGAGCAGTTTGCTCGCTACATAGACTGCAGGATCCAGGAGATCAGCACAGATTACTATAACCTACAGGCCCTCGGCCACTTACAGCAGTTCCTGGAGTTTGTGCTTTTTCTTTCTGACCTGGAACTGGCCAATTCCTTTGAGCACTTCTACAGGCATTACCTGGCGGATCGGCTCCTCTCATTGGGCCCCTCGTGGTTGGAGAGCTCCGTGGTGGATCACATCGGGATTTGCTTCCCAAACAGATTCCCCCAACAGATGCTGAAGAACCTACAGGAGGCCAGTGATCTACAGAGGGAGCAGCACCTGTTCTGCCTGCAGGA
  5   1   2       bld Brn2      in                        CAAJ16050.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTCAGCTCTCCTTCCTAACCGCACTGCATGTAAGTCTGGGGCCAACCAGGCCGGGGGTTCTGTGAGGGGCCCTTCAGCTCTCCTTCCTAACCGCACTGCATGTAAGTCTGGGGCCAGCCGGGCCGGGGGTTCTGTGAGGGGCTCCTTCAGCTCTCCTTCCTAACCGCACTGCATGTAAGTCTGGGGCCAGCCGGGCCGGGGGTTCTGTGAGGGGCTCCTTCAGCTCTCCTTCCTAACCGCACTGCATGTAAGTCTGGGGCCAGCCGGGCCGGGGGTTCTGTGAGGGGCCCTTCAGCTCTCCTTCCTAACCGCACTGCATGTAAGTCTGGGGCCAGCCGGGCCGGGGGTTCTGTGAGGGGCCCTTCAGCTCTCCTTCCTAACCGCACTGCATGTAAGTCTGGGGCCAGCCGGGCCGGGGGTTTGGGTTGCTCCTGCCTCTGGGCCCCGTTGGCTGTATATTGGGGTGTCAGGGTTCTGATGGTTCTGATGGCAGCTGTGTGTTACTTGCAGATAACGGAGCAGTTTGCTCGCTACATAGACTGCAGGATCCAGGAGATCAGCACAGATTACTATAACCTACAGGCCCTCGGCCACTTACAGCAGTTCCTGGAGTTTGTGCTTTTTCTTTCTGACCTGGAACTGGCCAATTCCTTTGAGCACTTCTACAGGCATTACCTGGCGGATCGGCTCCTCTCATTGGGCCCCTCGTGGTTGGAGAGCTCCGTGGTGGATCACATCGGGATTTGCTTCCCAACAGATTCCCCCAACAGATGCTGAAGAACCTACA
  5   1   2       bld Neu                            TNeu026l24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGACTCCAGTCTCCCCGACACAGNAGGCCGCTGAAACCCCCCAGCAAAACCAATGAGAAAAGTCCAGATTCAGCCTCTTTGCCAACGAAGGGCACCGTTTCTCTCCTGAGCACCATGACGGGGATAGCCGAGTGCTGGCAGGGGGTAGTACAGAAGCAGGTGCAGAGGTTCCTGGAGGTGTCGTGGAACAACACTGATCTGGTTCCTCGGTTCTGCTCGCTGTACCTGGAGCTCAGACAGGCCATGGAGGAGCTGTTTGGGCAACAGACCCTGTTTCTCCTGTCGCTGCGCCAGGGGTTCTGTGAGGGGCTCCTTCAGCTCTCCTTCTTAACCGCACTGCATATAACGGAGCAGTTTGCTCGCTACATAGACTGCAGGATCCAGGAGATCAGCACAGATTACTATAACCTACAGGCCCTCGGCCACTTACAGCAGTTCCTGGAGTTTGTGCTTTTTCTTTCTGACCTGGAACTGGCCAATTCCTTTGAGCACTTCTACAGGCATTACCTGGCGGATCGGCTCCTCTCATTGGGCCCCTCGTGGTTGGAGAGCTCCGTGGTGGATCACATCGGGATTTGCTTCCCAAACAGATTCCCCCAACAGATGCTGAAGAACCTACAGGAGGCCAGTGATCTAC
  5   1   2       bld Te4       in                        CAAN10937.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGAGGCCCTGAAACCCCCCAGCAAAACCAATGAGAAAAGTCCAGATTCAGCCTCTTTGCCAACGAAGGGCACCGTTTCTCTCCTGAGCACCATGACGGGGATAGCCGAGTGCTGGCAGGGGGTAGTACAGAAGCAGGTGCAGAGGTTCCTGGAGGTGTCGTGGAACAACACTGATCTGGTTCCTCGGTTCTGCTCGCTGTACCTGGAGCTCAGACAGGCCATGGAGGAGCTGTTTGGGCAACAGACCCTGTTTCTCCTGTCGCTGCGCCAGGGGTTCTGTGAGGGGCTCCTTCAGCTCTCCTTCTTAACCGCACTGCATATAACGGAGCAGTTTGCTCGCTACATAGACTGCAGGATCCAGGAGATCAGCACAGATTACTATAACCTACAGGCCCTCGGCCACTTACAGCAGTTCCTGGAGTTTGTGCTTTTTCTTTCTGACCTGGAACTGGCCAATTCCTTTGAGCACTTCTACAGGCATTACCTGGCGGATCGGCTCCTCTCATTGGGCCCCTCGTGGTTGGAGAGCTCCGTGGTGGATCACATCGGGATTTGCTTCCCAAACAGATTCCCCCAACAGATGCTGAAGAACCTACAGGAGGCCAGTGATCTACAGAGGGAGCAGCACCTGTTCTGCCTGCAGGAAATGGACACCGGGCTCCTGTCTGATGAGGAGGGAGAGGACATGGAGGAGGAGGAGTCTATAGGTGTCGGCCATTTGGGGGAGGAG
  5   1   2       bld Brn2      in                        CAAJ13684.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTCCTGGAGGTGTCGTGGAACAACACTGATCTGGTTCCTCGGTTCTGCTCGCTGTACCTGGAGCTCAGACAGGCCATGGAGGAGCTGTTTGGGCAACAGACCCTGTTTCTCCTGTCGCTGCGCCAGGGGTTCTGTGAGGGGCTCCTTCAGCTCTCCTTCTTAACCGCACTGCATATAACGGAGCAGTTTGCTCGCTACATAGACTGCAGGATCCAGGAGATCAGCACAGATTACTATAACCTACAGGCCCTCGGCCACTTACAGCAGTTCCTGGAGTTTGTGCTTTTTCTTTCTGACCTGGAACTGGCCAATTCCTTTGAGCACTTCTACAGGCATTACCTGGCGGATCGGCTCCTCTCATTGGGCCCCTCGTGGTTGGAGAGCTCCGTGGTGGATCACATCGGGATTTGCTTCCCAAACAGATTCCCCCAACAGATGCTGAAGAACCTACAGGAGGCCAGTGATCTACAGAGGGAGCAGCACCTGTTCTGCCTGCAGGAAATGGACACCGGGCTCCTGTCTGATGAGGAGGGAGAGGACATGGAGGAGGAGGAGTCTATAGGTGTCGGCCATTTGGGGGAGGAGCCAAAAGTGCACATTTCCGTCTTGTCCCCGCGGTGCTGGGCAATACCGTCTCTTTGCTACATGAAGGATCCTACCAAATATTTCCCAGAATCCCTCTGCCGGCCGCTGAACTGTTTCAAGGACTTCTATACAAAAAGCCAGTCTCTGCAGGGATCTGATCTGACTCAGAGCCGCCGGTTGCAATGGACCTGGTTGGGAAATGCTGAGGTGCAATATGGGAGTTTAACCCCTACAGTTTCCACCCTGCAGATGTTCATTTTGCTGCAGTTTACCAGCGGGAGGAGTTTCATTTGAGTCCATAAC
  5   1   2       bld Te3                                 CAAM15092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTCGGATTCCGGGATTCGTCGACCCCGCGTCCGGTGGTTGGAGAGCTCCGTGGTGGATCACATCGGGATTTGCTTCCCAAACAGATTCCCCCAACAGATGCTGAAGAACCTACAGGAGGCCAGTGATCTACAGAGGGAGCAGCACCTGTTCTGCCTGCAGGAAATGGACACCGGCCTCCTGTCTGATGAGGAGGGAGAGGACATGGAGGAGGAGAAGTCTATAGGTGTCGGCCATTTGGGGGAGGAGCCAAAAGTGCACATTTCCGTCTTGTCCCCGCGGTGCTGGGCAATACCGTCTCTTTGCTACATGAAGGATCCTACCAAATATTTCCCAGAATCCCTCTGCCGGCCGCTGAACTGTTTCAAGGACTTCTATACAAAAAGCCAGTCTCTGCAGGGATCTGATCTGACTCAGAGCCGCCGGTTGCAATGGACCTGGTTGGGAAATGCTGAGGTGCAATATGGGAGTTTAACCCTACAAGTTTCCACCCTGCAGATGTTCATTTTGCTGCAGTTTAACCAGCGGGAGGAAGTTTCATTTGAGTCCATAACCCAGGCCACCGGCCTCTCCCAGGTCCTTATTGGCCATGCACTGTCCCCACTCACTGCCAAGGGTGCCATCCTGACCCAGGAGGAGGGGTATCTGCGAGTGAATGGGGAAGCGAGGAGCGAGCCAGGGGCGGGCAGGGTCCTGCGCTTACTTCCCAGACAGACCTACCTGAATGTGGAGGAAGATGAGGGTCGGACACTGGAGAGGAAGAGGAACGTTATCTTTTGCCTCATAACCCAGATCATGAAGGAGGAGAAGGAGCTGCACATTGATAACCTAGTGTTCAGGGTGATTGAGGCCTGTC
  5   1   2       bld Brn2      in                        CAAJ22954.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGTGGATCACATCGGGATTTGCTTCCCAAACAGATTCCCCCAACAGATGCTGAAGAACCTACAGGAGGCCAGTGATCTACAGAGGGAGCAGCACCTGTTCTGCCTGCAGGAAATGGACACCGGGCTCCTGTCTGATGAGGAGGGAGAGGACATGGAGGAGGAGGAGTCTATAGGTGTCGGCCATTTGGGGGAGGAGCCAAAAGTGCACATTTCCGTCTTGTCCCCGCGGTGCTGGGCAATACCGTCTCTTTGCTACATGAAGGATCCTACCAAATATTTCCCAGAATCCCTCTGCCGGCCGCTGAACTGTTTCAAGGACTTCTATACAAAAAGCCAGTCTCTGCAGGGATCTGATCTGACTCAGAGCCGCCGGTTGCAATGGACCTGGTTGGGAAATGCTGAGGTGCAATATGGGAGTTTAACCCTACAAGTTTCCACCCTGCAGATGTTCATTTTGCTGCAGTTTAACCAGCGGGAGGAAGTTTCATTTGAGTCCATAACCCAGGCCACCGGCCTCTCCCAGGTCCTTATTGGCCATGCACTGTCCCCACTCACTGCCAAGGGTGCCATCCTGACCCAGGAGGAGGGGTATCTGCGAGTGAATGGGGAAGCGAGGAGAGAGCCAGGGGCGGGCAGGGTCCTGCGCTTACTTCCCAGACAGACCTACCTGAATGTGGAGGAAGATGAGGGTCGGACACTGGAGAGGAAGAGGAACGTTATCTTTTGCCTCATAACCCAGATCATGAAGGAGG
  5   1   2       bld Egg       in                  TEgg057e23.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGACCTGGTTGGGAAATGCTGAGGTGCAATATGGGAGTTTAACCCTACAAGTTTCCACCCTGCAGATGTTCATTTTGCTGCAGTTTAACCAGCGGGAGGAAGTTTCATTTGAGTCCATAACCCAGGCCACCGGCCTCTCCCAGGTCCTTATTGGCCATGCACTGTCCCCACTCACTGCCAAGGGTGCCATCCTGACCCAGGAGGAGGGGTATCTGCGAGTGAATGGGGAAGCGAGGAGAGAGCCAGGGGCGGGCAGGGTCCTGCGCTTACTTCCCAGACAGACCTACCTGAATGTGGAGGAAGATGAGGGTCGGACACTGGAGAGGAAGAGGAACGTTATCTTTTGCCTCATAACCCAGATCATGAAGGAGGAGAAGGAGCTGCACATTGATAACCTAGTGTTCAGGGTGATTGAGGCCTGTCAGAAAATGGAGTCTGGGCGGAGCCTGAAGTTCCTGAGCTTTGGCTGTAGCCACACGGACGTGCTGTCCTGTATCATGCACCTGATCAGCCAGGGCTACGTGCGGCGCAGCGACGACCGCCCCCATATACTGGAGTATCTGTCCAAGGACCCGGCCACCCCACATAAGGGCAAAGCCCACATCAGCTTCCAGAGCCCGGGCAGGAAGAGACAGGGTCACGGCAGCAAT
  5   1   2       bld Brn2                                CAAJ12720.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAATGCTGAGGTGCAATATGGGAGTTTAACCCTACAAGTTTCCACCCTGCAGATGTTCATTTTGCTGCAGTTTAACCAGCGGGAGGAAGTTTCATTTGAGTCCATAACCCAGGCCACCGGCCTCTCCCAGGTCCTTATTGGCCATGCACTGTCCCCACTCACTGCCAAGGGTGCCATCCTGACCCAGGAGGAGGGGTATCTGCGAGTGAATGGGGAAGCGAGGAGCGAGCCAGGGGCGGGCAGGGTCCTGCGCTTACTTCCCAGACAGACCTACCTGAATGTGGAGGAAGATGAGGGTCGGACACTGGAGAGGAAGAGGAACGTTATCTTTTGCCTCATAACCCAGATCATGAAGGAGGAGAAGGAGCTGCACATTGATAACCTAGTGTTCAGGGTGATTGAGGCCTGTCAGAAAATGGAGTCTGGGCGGAGCCTGAAGTTCCTGAGCTTTGGCTGTAGCCACACGGACGTGCTGTCCTGTATCATGCACCTGATCAGCCAGGGCTACGTGCGGCGCAGCGACGACCGCCCCCATATACTGGAGTATCTGTCCAAGGACCCGGCCACCCCACATAAGGGCAAAGCCCACATCAGCTTCCAGAGCCCGGGCAGGAAGAGACAGGGTCACGGCAGCAATCAGCCCCCCCCTAGCTCCAGTGGAGGAACGGAGCAGGGGGTTCTGGAGACTGTGCTCCTCCCCATGGGGCGGACCCTAAGCCAGGAAGATGTGCGGGCGCTGATGG
  5   1   2       bld Egg                            TEgg058e23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTCATTTGACTCCATAACCCATGCCACCGGCCTCTCCCACGTCCTTATTGGCCATGCACTGTCCCCACTCACTGCCAAGGGTGCCATCCTGACCCAGCCAGGAGGGGTATCTGCGAGTGAATGGGGAACCCAGGAGAGAGCCAGGGGCGGGCAGGGTCCTGCGCTTACTTCCCAGACACACCTACCTGAATGTGGAGGAAGATGACGGTCGGACACTGGAGAGGAAGAGGAACGATATCTTTTGCCT
  5   1   2       bld Lun1      in                          CABD467.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAAGGGTGCCATCCTGACCCAGGAGGAGGGGTATCTGCGAGTGAATGGGGAAGCGAGGAGAGAGCCAGGGGCGGGCAGGGTCCTGCGCTTACTTCCCAGACAGACCTACCTGAATGTGGAGGAAGATGAGGGTCGGACACTGGAGAGGAAGAGGAACGTTATCTTTTGCCTCATAACCCAGATCATGAAGGAGGAGAAGGAGCTGCACATTGATAACCTAGTGTTCAGGGTGATTGAGGCCTGTCAGAAAATGGAGTCTGGGCGGAGCCTGAAGTTCCTGAGCTTTGGCTGTAGCCACACGGACGTGCTGTCCTGTATCATGCACCTGATCAGCCAGGGCTACGTGCGGCGCAGCGACGACCGCCCCCATATACTGGAGTATCTGTCCAAGGACCCGGCCACCCCACATAAGGGCAAAGCCCACATCAGCTTCCAGAGCCCGGGCAGGAAGAGACAGGGTCACGGCAGCAATCAGCCCCCCCCCAGCTCCAGTGGAGGAACGGAGCAGGGGGTTCTGGAGACTGTGCTCCTCCCCATGGGGCGGACCCTAAGCCAGGAGGATGTGCGGGCGCTGATGGGCCAGATGGTGGCGCAGGTTTCCCAAACGCTGAGTATCGACCCAGACACGGCCCAACATCTGCTCATTCACTGCAAGTGGAACGTGGACCTCCTGCTGCAGAAATACACGGAAGAACCAGAACTGCTGCTCATCTCCTCCGGCCTGCAAGTGCGGGACCCCCAGCACCCAGAGAGCCCCCAGCCTGCCTGCCCCGTGTGTGTCAGCCCCCTGAGCCCAGCGGAACATCACCCAACTCTGTGCTGCCAGCACCTGTGCTGCAAGAGCTGCT
  5   1   2       bld Brn2      in                        CAAJ23733.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGACACTGGAGAGGAAGAGGAACGTTATCTTTTGCCTCATAACCCAGATCATGAAGGAGGAGAAGGAGCTGCACATTGATAACCTAGTGTTCAGGGTGATTGAGGCCTGTCAGAAAATGGAGTCTGGGCGGAGCCTGAAGTTCCTGAGCTTTGGCTGTAGCCACACGGACGTGCTGTCCTGTATCATGCACCTGATCAGCCAGGGCTACGTGCGGCGCAGCGACGACCGCCCCCATATACTGGAGTATCTGTCCAAGGACCCGGCCACCCCACATAAGGGCAAAGCCCACATCAGCTTCCAGAGCCCGGGCAGGAAGAGACAGGGTCACGGCAGCAATCAGCCCCCCCCTAGCTCCAGTGGAGGAACGGAGCAGGGGGTTCTGGAGACTGTGCTCCTCCCCATGGGGCGGACCCTAAGCCAGGAGGATGTGCGGGCGCTGATGGGCCAGATGGTGGCGCAGGTTTCCCAAACGCTGAGTATCGACCCAGACACGGCCCAACATCTGCTCATTCACTGCAAGTGGAACGTGGACCTCCTGCTGCAGAAATACACGGAAGAACCAGAACTGCTGCTCATCTCCTCCGGCCTGCAAGTGCGGGACCCCCAGCACCCAGAGAGCCCCCAGCCTGCCTGCCCCGTGTGTGTCAGCCCCCTGAGCCCAGCGGAACATCACCCAACTCTGTGCTGCCAGCACCTGTGCTGCAAGAGCTGCTGGAAGGAATATCTGACAACACGAATTGAACAGAATCTGGCGCTGAACTGCACCTGCCCAACCACCGACTGCCTGGCACAGCCCACGTCTGACTTCATCAGCAAGATCATCACCTCCNAGGAGGTCATAGAGAAGTA
  5   1   2       bld In54                            IMAGE:8945187.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTTCGTAGTTTCCACAGACAATTCATATCTGATACGAATTCGTCCCTGAAGGAGGAGAAGGAGCTGCACATTGATAACCTAGTGTTCAGGGTGATTGAGGCCTGTCAGAAAATGGAGTCTGGGCGGAGCCTGAAGTTCCTGAGCTTTGGCTGTAGCCACACGGACGTGCTGTCCTGTATCATGCACCTGATCAGCCAGGGCTACGTGCGGCGCAGCGACGACCGCCCCCATATACTGGAGTATCTGTCCAAGGACCCGGCCACCCCACATAAGGGCAAAGCCCACATCAGCTTCCAGAGCCCGGGCAGGAAGAGACAGGGTCACGGCAGCAATCAGCCCCCCCCCAGCTCCAGTGGAGGAACGGAGCAGGGGGTTCTGGAGACTGTGCTCCTCCCCATGGGGCGGACCCTAAGCCAGGAGGATGTGCGGGCGCTGATGGGCCAGATGGTGGCGCAGGTTTCCCAAACGCTGAGTATCGACCCAGACACGGCCCAACATCTGCTCATTCACTGCAAGTGGAACGTGGACCTCCTGCTGCAGAAATACACGGAAGAACCAGAACTGCTGCTCATCTCCCTCCGGCCTGCAAGTGCGGGACCCCCAGCACCCAGAGAGCCCCCAGCCTGCCCTGCCCCGTGTGTGTCAACCCCCCTGAGCCCAGCGGACATCACCCAACTCTGTGCTGCCATCACCTGTGCTGCAAAAACTGCTGGAAGGAATACTGACAACTTTAATTGAACAAATCTGGCGCTGAACTGCACCTGCCCAA
  5   1   2       bld Te3                                 CAAM14867.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGACCCTAAGCCAGGAGGATGTGCGGGCGCTGATGGGCCAGATGGTGGCGCAGGTTTCCCAAACGCTGAGTATCGACCCAGACACGGCCCAACATCTGCTCATTCACTGCAAGTGGAACGTGGACCTCCTGCTGCAGAAATACACGGAAGAACCAGAACTGCTGCTCATCTCCTCCGGCCTGCAAGTGCGGGACCCCCAGCACCCAGAGAGCCCCCAGCCTGCCTGCCCCGTGTGTGTCAGCCCCCTGAGCCCAGCGGAACATCACCCAACTCTGTGCTGCCAGCACCTGTGCTGCAAGAGCTGCTGGAAGGAATATCTGACAACACGAATTGAACAGAATCTGGCGCTGAACTGCACCTGCCCAACCACCGACTGCCTGGCACAGCCCACGTCTGACTTCATCAGCAAGATCATCACCTCCAAGGAGGTCATAGAGAAGTACGAGAAGTCTCTCCTGCGAGGTTTTGTAGAGAACTGCTCCAACCTGACGTGGTGCACAAACCCCCAGGGCTGCGACCGGGTCCTGTGTAAGGAGGGATTGGGCAGCGGCGCCGCCTGTACCAAGTGCTCGTGGCTCTCCTGCTTTAACTGCAGCTTCTCCGAGGCCCATTACCCGGCCAGCTGCAGCCACATGTCCCAGTGGATGGACGACGGGGGCTTCTATGAGGGGATGACTGTGGAGGCGCAAAGCAAACACCTGACCAAGCTGATCNTCAAGCATTGCCCCAGCTGCCAGGCGCCTATCGAGAAGAACGAGGGATGTCTGCATATGACCTGTGCAAAAT
  5   1   2       bld Brn2      in                        CAAJ13631.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAGTGGAACGTGGACCTCCTGCTGCAGAAATACACGGAAGAACCAGAACTGCTGCTCATCTCCTCCGGCCTGCAAGTGCGGGACCCCCAGCACCCAGAGAGCCCCCAGCCTGCCTGCCCCGTGTGTGTCAGCCCCCTGAGCCCAGCGGAACATCACCCAACTCTGTGCTGCCAGCACCTGTGCTGCAAGAGCTGCTGGAAGGAATATCTGACAACACGAATTGAACAGAATCTGGCGCTGAACTGCACCTGCCCAACCACCGACTGCCTGGCACAGCCCACGTCTGACTTCATCAGCAAGATCATCACCTCCAAGGAGGTCATAGAGAAGTACGAGAAGTCTCTCCTGCGAGGTTTTGTAGAGAACTGCTCCAACCTGACGTGGTGCACAAACCCCCAGGGCTGCGACCGGGTCCTGTGTAAGGAGGGATTGGGCAGCGGCGCCGCCTGTACCAAGTGCTCGTGGCTCTCCTGCTTTAACTGCAGCTTCCCCGAGGCCCATTACCCGGCCAGCTGCAGCCACATGTCCCAGTGGATGGACGACGGGGGCTTCTATGAGGGGATGACTGTGGAGGCGCAAAGCAAACACCTGACCAAGCTGATCTCCAAGCATTGCCCCAGCTGCCAGGCGCCTATCGAGAAGAACGAGGGATGTCTGCATATGACCTGTGCCAAATGTAACCATGGATTCTGCTGGCGATGCCTAAAGCCCTGGAAACCCACCCACAAGGATTATTACAACTGTTCGGCCATGGTCAGTAAAGCCGCCCGGCAGGAGAAGCGGTTCCAGGACTATCATGAGAGATGCACGTTCCAG
  5   1   2       bld Te3       in                         CAAM8259.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGAACCAGAACTGCTGCTCATCTCCTCCGGCCTGCAAGTGCGGGACCCCCAGCACCCAGAGAGCCCCCAGCCTGCCTGCCCCGTGTGTGTCAGCCCCCTGAGCCCAGCGGAACATCACCCAACTCTGTGCTGCCAGCACCTGTGCTGCAAGAGCTGCTGGAAGGAATATCTGACAACACGAATTGAACAGAATCTGGCGCTGAACTGCACCTGCCCAACCACCGACTGCCTGGCACAGCCCACGTCTGACTTCATCAGCAAGATCATCACCTCCAAGGAGGTCATAGAGAAGTACGAGAAGTCTCTCCTGCGAGGTTTTGTAGAGAACTGCTCCAACCTGACGTGGTGCACAAACCCCCAGGGCTGCGACCGGGTCCTGTGTAAGGAGGGATTGGGCAGCGGCGCCGCCTGTACCAAGTGCTCGTGGCTCTCCTGCTTTAACTGCAGCTTCCCCGAGGCCCATTACCCGGCCAGCTGCAGCCACATGTCCCAGTGGATGGACGACGGGGGCTTCTATGAGGGGATGACTGTGGAGGCGCAAAGCAAACACCTGACCAAGCTGATCTCCAAGCATTGCCCCAGCTGCCAGGCGCCTATCGAGAAGAACGAGGGATGTCTGCATATGACCTGTGCCAAATGTAACCATGGATTCTGCTGGCGATGCCTAAAGCCCTGGAAACCCACCCACAAGGATTATTACAACTGTTCGGCCATGGTCAGTAAAGCCGCCCGGCAGGAGAAGCGGTTCCAGGACTACAATGAGAGATGCACGTTCCAGCACCGTGCCAAGGACTTTTGCGTGTCTCTGCGCAAGCGGCTGAGTGTTCTGAGGGAGGAGCCCCCGTTGCGCTCACTGA
  3  -1   2       bld Sto1      in                        CABG10592.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATAGGGCGAGAGGCCTGACGTGGTGCACAAACCCCCAGGGCTGCGACCGGGTCCTTTGTAAGGAGGGATTGGGCAGCGGCGCCGCCTGTACCAAGTGCTCGTGGCTCTCCTGCTTTAACTGCAGCTTCCCCGAGGCCCATTACCCGGCCAGCTGCAGCCACATGTCCCAGTGGATGGACGACGGGGGCTTCTATGAGGGGATGACTGTGGAGGCGCAAAGCAAACACCTGACCAAGCTGATCTCCAAGCATTGCCCCAGCTGCCAGGCGCCTATCGAGAAGAACGAGGGATGTCTGCATATGACCTGTGCTAAATGTAACCATGGATTCTGCTGGCGATGCCTAAAGCCCTGGAAACCCACCCACAAGGATTATTACAACTGTTCGGCCATGGTCAGTAAAGCCGCCCGGCAGGAGAAGCGGTTCCAGGACTACAATGAGAGATGCACGTTCCAGCACCGTGCCAAGGACTTTGCGGTGTCTCTGCGCAAGCGGCTGAGTGTTCTGAGGGAGGAGCCCCCGTTGCGCTCACTGACCTTCCTCATCACCGCGTGCCGCGTCCTGGAGCAGAGCCGCAAGGTTCTGGGGTACGCCTGTGTCTACAGTTACTACAACCAGGATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACCGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGATGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCA
  5   1   2       bld Int1      in                        CAAP13407.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGCTCTCCTGCTTTAACTGCAGCTTCCCCGAGGCCCATTACCCGGCCAGCTGCAGCCACATGTCCCAGTGGATGGACGACGGGGGCTTCTATGAGGGGATGACTGTGGAGGCGCAAAGCAAACACCTGACCAAGCTGATCTCCAAGCATTGCCCCAGCTGCCAGGCGCCTATCGAGAAGAACGAGGGATGTCTGCATATGACCTGTGCCAAATGTAACCATGGATTCTGCTGGCGATGCCTAAAGCCCTGGAAACCCACCCACAAGGATTATTACAACTGTTCGGCCATGGTCAGTAAAGCCGCCCGGCAGGAGAAGCGGTTCCAGGACTACAATGAGAGATGCACGTTCCAGCACCGTGCCAAGGACTTTGCGGTGTCTCTGCGCAAGCGGCTGAGTGTTCTGAGGGAGGAGCCCCCGTTGCGCTCACTGACCTTCCTCATCACCGCGTGCCGCGTCCTGGAGCAGAGCCGCAAGGTTCTGGGGTACGCCTGTGTCTACAGTTACTACAACCAGGATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACCGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAAC
  5   1   2       bld Spl1      in                         CABK9604.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCATTACCCGGCCAGCTGCAGCCACATGTCCCAGTGGATGGACGACGGGGGCTTCTATGAGGGGATGACTGTGGAGGCGCAAAGCAAACACCTGACCAAGCTGATCTCCAAGCATTGCCCCAGCTGCCAGGCGCCTATCGAGAAGAACGAGGGATGTCTGCATATGACCTGTGCCAAATGTAACCATGGATTCTGCTGGCGATGCCTAAAGCCCTGGAAACCCACCCACAAGGATTATTACAACTGTTCGGCCATGGTCAGTAAAGCCGCCCGGCAGGAGAAGCGGTTCCAGGACTACAATGAGAGATGCACGTTCCAGCACCGTGCCAAGGACTTTGCGGTGTCTCTGCGCAAGCGGCTGAGTGTTCTGAGGGAGGAGCCCCCGTTGCGCTCACTGACCTTCCTCATCACCGCGTGCCGCGTCCTGGAGCAGAGCCGCAAGGTTCTGGGGTACGCCTGTGTCTACAGTTACTACAACCAGGATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACCGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACANAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGNGAGCAGGACGATGAAGAGGACGA
  5   1   2       bld Te5       in                         CAAO7453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCAGCTGCAGCCACATGTCCCAGTGGATGGACGACGGGGGCTTCTATGAGGGGATGACTGTGGAGGCGCAAAGCAAACACCTGACCAAGCTGATCTCCAAGCATTGCCCCAGCTGCCAGGCGCCTATCGAGAAGAACGAGGGATGTCTGCATATGACCTGTGCCAAATGTAACCATGGATTCTGCTGGCGATGCCTAAAGCCCTGGAAACCCACCCACAAGGATTATTACAACTGTTCGGCCATGGTCAGTAAAGCCGCCCGGCAGGAGAAGCGGTTCCAGGACTACAATGAGAGATGCACGTTCCAGCACCGTGCCAAGGACTTTGCGGTGTCTCTGCGCAAGCGGCTGAGTGTTCTGAGGGAGGAGCCCCCGTTGCGCTCACTGACCTTCCTCATCACCGCGTGCCGCGTCCTGGAGCAGAGCCGCAAGGTTCTGGGGTACGCCTGTGTCTACAGTTACTACAACCAGGATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACCGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGNGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGATTTGGAT
  5   1   2       bld Gas8      in                         st114e01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACACCTGACCAAGCTGATCTCCAAGCATTGCCCCAGCTGCCAGGCGCCTATCGAGAAGAACGAGGGATGTCTGCATATGACCTGTGCCAAATGTAACCATGGATTCTGCTGGCGATGCCTAAAGCCCTGGAAACCCACCCACAAGGATTATTACAACTGTTCGGCCATGGTCAGTAAAGCCGCCCGGCAGGAGAAGCGGTTCCAGGACTACAATGAGAGATGCACGTTCCAGCACCGTGCCAAGGACTTTGCGGTGTCTCTGCGCAAGCGGCTGAGTGTTCTGAGGGAGGAGCCCCCGTTGCGCTCACTGACCTTCCTCATCACCGCGTGCCGCGTCCTGGAGCAGAGCCGCAAGGTTCTGGGGTACGCCTGTGTCTACAGTTACTACAACCAGGATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACCGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGATGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGT
  5   1   2       bld Gas8      in                         st115e01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATCTCCAAGCATTGCCCCAGACTGCCAGGCGCCTATCGAGAAGAACGAGGNATGTCTGCATATGACCTGTGCCAAATGTAACCATGGATTCTGCTGGCGATGCCTAAAGCCCTGGAAACCCACCCACAANGATTATTACAACTGTTCGGCCATGGTCAGTAAAGCCGCCCGGCAGGANAAGCGGTTCCAGGACTACAATGAGAGATGCACGTTCCAGCACCGTGCCAAGGACTTTGCGGTGTCTCTGCGCA
  3   1   2       bld Int1      in                        CAAP13407.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCTCTGCGCAAGCGGCTGAGTGTTCTGAGGGAGGAGCCCCCGTTGCGCTCACTGACCTTCCTCATCACCGCGTGCCGCGTCCTGGAGCAGAGCCGCAAGGTTCTGGGGTACGCCTGTGTCTACAGTTACTACAACCAGGATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACCGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGG
  5   1   2       bld Gas7                                 XZG12520.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCACTGACCTTCCTCATCACCGCGTGCCGCGTCCTGGAGCAGAGCCGCAAGGTTCTGGGGTACGCCTGTGTCTACAGTTACTACAACCAGGATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACCGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCC
  5  -1   2       bld Sto1      in                        CABG10592.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATCACCGCGTGCCGCGTCCTGGAGCAGAGCCGCAAGGTTCTGGGGTACGCCTGTGTCTACAGTTACTACAACCAGGATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACCGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGATGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGATTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTG
  3   1   2      seed Egg       in                    TEgg057e23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGCAGAGCCGCAAGGTTCTGGGGTACGCCTGTGTCTACAGTTACTACAACCAGGATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACCGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGATGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGATTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te3       out                       CAAM10335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACGCCTGTGTCTACAGTTACTACAACCAGGATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACTGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGAGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATT
  3   1   2       bld Brn2      in                        CAAJ23733.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACGCCTGTGTCTACAGTTACTACAACCAGGATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACTGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGAGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld HdA       out                   THdA048e01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACCGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTTTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTTTTTTCCTGATTAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Te3  5x   out                        CAAM9993.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATTCCGAGCGCCTCGATGTGCTGGAGTCTCAGACTGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGAGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATT
  3   1   2       bld Brn2 5g3  out                       CAAJ17415.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAGCGCCTCGATGTGCTGGAGTCTCAGACTGAGAACCTGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGAGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATT
  3   1   2       bld Brn2 FL   out                       CAAJ15869.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGACTGAGAACCGGGAGCTCCACGTCAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGAGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld HdA       out                   THdA048d24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACGTCAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTTTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTTTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTTTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTCCTGATTAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Te5       in                         CAAO7453.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCGCCCTGCAGATCCTTCTGGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGATTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld Brn2      out                       CAAJ24350.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGAGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld Brn3      in                         CAAK7716.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGATTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATTTATTCTG
  3   1   2       bld Te4       in                         CAAN4625.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGAGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld Lun1      in                          CABD467.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld Te3  5g3  out                       CAAM14485.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGATTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld Brn2 5g3  out                       CAAJ15702.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGATTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld Brn2      out                       CAAJ16724.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGAGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld Brn2      out                       CAAJ20172.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGAGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld Brn2      in                        CAAJ22954.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGATTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld Te3       out                       CAAM10074.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGATTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld Te3       out                       CAAM10345.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGATTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld Te3       out                       CAAM15261.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGAGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATTT
  3   1   2       bld Te4       in                        CAAN10937.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGACAGCCTGTTGCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGATTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATTT
  3   1   2       bld Brn2      in                        CAAJ16050.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGTGTGAGGACCTGGGCTCCTGTGTGCGACTCCTGAGTGCCGATAAGTACAGCAGTGGCCTGGAACTGGTCCGGCGAGTGCAGGAGAGAATGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCCCGAGGAATATGACGATGACTTGGATGAAGACGATTTTTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGAGGAGCTTATTTGCCCCCCAGCTTTTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld Spl1      in                         CABK9604.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTGGAACTGGTCCGGCGAGTGCAGGAGAGACTGCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATTTATTCTGACGCTCCGGTGCAGTATGTTCTTTGGGGGGCTGGGTACCCCATTTTAGTGCCAGAGGGACCCACAGGGTGTTGCTAGCCCATTGGGCAATAAGAGAGAGGGGAGCCATGTGGTCCCTTAGCGTTTGGGCTTTTTGTACTGAGAGCTGTACAGCGTCTTTATAAATAAAGTTACAGGAATCCTTGTGTAGCCCAGTAAAAAAAA
  3   1   2       bld Te3       in                         CAAM8259.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGGGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGGGCCGGTGACAAACCTGCCTGCAGCCGCAAATTTTTCTGAGGGAGCTTTGGACTCGGGGGACCCGGGGGGGGAGCAGGCCGATGAAGAGGACGATTTCGCCCAGGACTGGCCCGAGGAATATGACGATGACTTGGATGAAGACGATTTTTTTTTTTATGAAAATGAGGAGTCGGAAAATTTCGAGCCGGACTCCTTTATTTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCCCTGACGGGGGGAGCTTATTTGCCCCCCAGCTTTTATTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTTTCATTGCCCCCCCTGTTGCAGAAACCAGTTTACTTGCCCCAGTTCAAACTTGTTGCCCCAGAGTGCCTCAAAATTGTGACAAGTTTGTGGCCCGGGGGGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTTTATACATTTATATTTATAATTAGAATTATTTTTTTTTTT
  3   1   2       bld Te3  5g3  out                        CAAM2584.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGCATCCTACAGCACTCCACTCAGGATTTCCGCGTGGGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTG
  3   1   2       bld Brn2      in                        CAAJ12795.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCACTCCACTCAGGATTTTCGCGTGGGGTTCCTGTCACAACCGGATCCCAAAGAGATGAAACTTTTCAATGTGCCGGGGCCGGTGACAAACCTGCCTGCAACCGCAAATTTTTTTGAGGGAGCGTTGGACTCGGGGGACCCGGGGGGGGAGCCGGACGATGAAGAGGACGATTTCCCCCAGGACTGGCCCGAGGAATATGACGATGACTTGGATGAAGACGATTTTTTTTTTTATGAAAATGAGGAGTTGGAGAATTTTGAGCCGGACTCCTTTTTTTTTGAGGAAGATGATGCTCAGGCCTATTAGCTTTGCCCCTGACGGGAGGAGGTTTTTTGCCCCCCAGCTTTTTTTGCTTTTCCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTTTCATTTCCCCCCCTGTTGCAGAAACCAGTTTACTTGCCCCAGTTCAAACTTGTTGCCCCAGAG
  3   1   2       bld Te3  5g3  out                        CAAM3897.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGTTCCTGTCACAACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGATTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATTTATTCTGACGCTCCGGTGCAGTATGTTCTTTGGGGGGCTGGGTACCCCATTTTAGTGCCAGAGGGACCCACAGGGTGTTGCTAGCCCATTGGGCAATAAGAGAGAGGGGAGCCATGTGGTCCCTTAGCGTTTGGGCTTTTTGTACTGAGAGCTGTACAGCGTCTTTATAAATAAAGTTACAGGAATCCTTGTGTGGCCCAATT
  3   1   2       bld Gas8      in                         st114e01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTCACAACCGGATCACNAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGATTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATTTATTCTGACGCTCCGGTGCAGTATGTTCTTTGGGGGGCTGGGTACCCCATTTTAGTGCCAGAGGGACCCACAGGGTGTTGCTAGCCCATTGGGCAATAAGAGAGAGGGGAGCCATGTGGTCCCTTAGCGTTTGGGCTTTTTGTACTGAGAGCTGTACA
  3   1   2       bld Te3       in                        CAAM14028.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACCGGATCACAAAGAGATGAAACTTTCCAATGTGCCGGCGCCGGTGACAAACCTGCCTGCAACCCCAAATTTTTCTGAGGGAGCGTTGGACTCGGGGGACCCGGGGGGGGAGCAGGACGATGAAAAGGACGATTTCGCGCAGGACTGGCCCGAGGAATATGACGATGATTTGGATGAAGACGATTTTTTTTTTTATGAAAATGAGGAGTCGGAAAATTTCGAGCCGGACTCCTTTATTTTTGAGGAAGATGATGCTCAGGCCTATTAGCTTTGCCCCTGACGGGGGGAGCTTATTTGCCCCCCAGCTTTTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTTTCATTGCCCCCCCTGTTGCAGAAACCAGTTTACTTGCCCCAGTTCAAACTTGTTGCCCCAGAGTGCCTCAAAATTGTGACAAATTTGTGGCCCGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAAAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCCG
  3   1   2       bld Brn2      out                       CAAJ16672.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGTGCCGGCGCCGGTGACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGAGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATTTATTCTGACGCTCCGGTGCAGTATGTTCTTTGGGAGGCTGGGTACCCCATTTTAGTGCCAGAGGGACCCACAGGGTGTTGCTAGCCCATTGGGCAATAAGAGAGAGGGGAGGAGCCATGTGGTCCCTTAGCGTTTGGGCTGTTTGTACTGAGAGCTGTACAGCGTCTTTATAAATAAAGTTACAGGAATCCTTGTGTAGCCCAGTT
  3   1   2       bld Brn2      in                        CAAJ13631.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAAACCTGCCTGCAGCCGCAAATGTTGCTGAGGGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGACGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGAGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATTTATTCTGACGCTCCGGTGCAGTATGTTCTTTGGGAGGCTGGGTACCCCATTTTAGTGCCAGAGGGACCCACAGGGTGTTGCTAGCCCATTGGGCAATAAGAGAGAGGGGAGGAGCCATGTGGTCCCTTAGCGTTTGGGCTGTTTGTACTGAGAGCTGTACAGCGTCTTTATAAATAAAGTTACAGGAATCCTTGTGTAGCCCAGTT
  3   1   2       bld Te3       out                        CAAM4028.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAGCGTCGGACTCGGGGGACACGGGGGGGGAGCAGGCCGATGAAGAGGACGATTACGCGCAGGACTGGCACGAGGAATATGACGATGATTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTTTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATTTATTCTGACGCTCCGGTGCAGTATGTTCTTTGGGGGGCTGGGTACCCCATTTTAGTGCCAGAGGGACCCACAGGGTGTTGCTAGCCCATTGGGCAATAAGAGAGAGGGGAGCCATGTGGTCCCTTAGCGTTTGGGCTTTTTGTACTGAGAGCTGTACAGCGTCTTTATAAATAAAGTTACAGGAATCCTTGTGTGGCCC
  3   1   2       bld Brn2      in                        CAAJ13684.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGGGACCCGGGGGGGGAGCAGGACGATGAAGAGGACGATTTCGCGCAGGACTGGCCCGAGGAATATGACGATGATTTGGATGAAGACGATTTTTTTTTTGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATTTTTGAGGATGATGATGCTCAGGCCTTTTAGCTTTGCCCCTGACGGGGGGGGCTTTTTTGCCCCCCAGCTTTTATTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTTTCATTGCCCCCCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCCCGGGGGGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTTTATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATTTATTTTGACGCTCCGGTGCAGTATGTTTTTTGGGGGGCGGGGTACCCCCTTTTAGTGCCAGAGGGACCCCCAGGGTGTTGCTAGCCCCTTGGGCAATAAGAGAGGGGGGGGCCATGTGGTCCCTTAGCGTTTGGGCTTTTTGTACTGAGAGCTGTACAGCGTCTTTTTAAATAAAGTTACAGGAATCCTTGTGGGGCCCCAT
  3   1   2       bld Te3       in                         CAAM1959.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGATGACTTGGATGAAGACGATTTTTTTTTTTATGAAAATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATTTTTGAGGAAGATGATGCTCAGGCCTATTAGCTTTGCCCCTGACGGGAGGAGGTTATTTGCCCCCCAGCTTTTATTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTTTCATTGCCCCCCCTGTTGCAGAAACCAGTTTACTTGCCCCAGTTCAAACTTGTTGCCCCAGAGTGCCTCAAAATTGTGACAAATTTTTGGCCCGGGGGGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTTTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAAATGCTCTTTGTTTTTCCGG
  5   1   2       bld Te3       in                         CAAM1959.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGATGACTTGGATGAAGACGATTTCTCTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGAGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Liv1      in                          CAAR731.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTCCTGAAAAAAAAGC
  5   1   2       bld Liv1      in                          CAAR731.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTATGATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGCTTATTTGCCCCCCAGCTTCTACTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTCTCATTGCCCCGCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGAAAAAAA
  3   1   2       bld Te3       out                       CAAM15288.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATGAAGATGAGGAGTCGGAGAATTTCGAGCCGGACTCCTTTATCTTTGAGGATGATGATGCTCAGGCCTATTAGCTTTGCCACTGACGGGGGGAGTTTATTTGCCCCCCAGTTTTTATTGCTTTACCCCCCCAGCCCTGATACCCCAGGGCCTGCCACGTTTCATTGCCCCCCCTGTTGCAGAAGCCAGTTTACTTGCCCCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACAAGTTTGTGGCCCGGGGGGGAGTTAATTCCCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATCCATTTATATTTATAATTAGAATTATTTTTATTATTAAATTGCTCTTTGTTTTTCCTGATTTATTCGGACGCTCCGGTCCAGTATTTTTTTTGGGGGGCGGGGTCCCCCATTTTAGTCCCAGAGGGACCCCCAGGGTGTTGTTAGCCCATTGGGCAATAAGAGAGGGGGGACCCATGGGGTCCCTTAGCGTTTGGGCTTTTTGTAC
  3   1   2       bld Gas8      in                         st115e01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTCATTGCCCCGCNTGTNGCAGAAGCCAGTTTACTTGCCNCAGTTCAAGCTTGTTGCCCCAGAGTGCCTCAGAATTGTGACANNTTTGTGGCACGGGGCGGAGTTAATTACCCATAATTCACTCATTAACTACCCCGGCCGGGAGTTCTATACATTTATATTTATAATTAGAATTATTTTTANTATTAAAATGCTCTTTGTTTTTCGCTGATTTATTCTGACGCTCACGGTGCAGTACTGTTCTTTGGGGGGCTGGGTACCCCNTTTTAGTGCCAGAGGGACCCAGCAGGGTGTTGCTAGCCCATTNGGCAATAAGAGAGAGGGGAGCCATNNGGTCCCTTAGCGTNTGGGCTTTTTGTACTGAGAGCTGACAGCGTCTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)