Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012072654 Xt7.1-XZT8128.5 - 65 ESTs
                                                                       .........-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-XZT8128.5                                                                      GTGCAACTGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTATATCTTTT
                                                  Xt7.1-CHK-1008224635                                                                            CTGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTATA
                                                      consensus depths                                                                           4     4    13    15    14    16    18    20    21    23    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    26    26    26    27    27    27    27    28    28    30    30    30    30    31    31    31    31    31    31    31    31    30    30    30    30    29    29    29    29    29    29    29    29    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    29    29    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    29    29    32    33    32    33    31    32    31    35    32    36    32    37    31    36    29    38    31    39    32    38    33    39    32    38    31    38    29    35    32    36    31    36    32    36    30    34    31    34    31    35    31    35    31    35    31    35    30    34    28    34    32    34    32    34    31    32    31    32    30    32    30    30    28    28    27    28    28    28    28    28    29    30    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    30    30    30    30    30    30    29    30    31    31    30    31    30    31    30    31    29    30    28    30    29    30    29    30    29    30    29    30    29    30    23    30    29    30    29    30    29    30    23    24     2     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------C-----
                                               BLH ATG      57    1177                                                                      
                                               BLH MIN      51     194                                                                      
                                               BLH OVR      57      91                                                                      
                                               EST CLI       0      45                                                                      
                                               ORF LNG      57       8                                                                      
                                                                                                                                                                                      PROTEIN -== Ce ==== 1e-088     NP_508183.1 ARRestin, beta 1, Drosophila kurtz homolog (48.5 kD) (arr-1) [Caenorhabditiselegans] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PREDICTED - Sp ---- 1e-089     XP_792277.2 PREDICTED: similar to beta-arrestin 1, putative [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 3e-103     NP_524988.1 kurtz CG1487-PA [Drosophila melanogaster] -----------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PROTEIN --- Ci ---= 2e-112     BAB60819.1 arrestin [Ciona intestinalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PROTEIN --- Dr ==== 6e-132     NP_957418.1 arrestin, beta 2 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN -== Mm ==== 1e-145     NP_796205.1 arrestin, beta 1 isoform A [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN -== Hs ==== 2e-146     NP_004032.2 arrestin beta 1 isoform A [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PREDICTED = Gg ==== 9e-156     XP_001232314.1 PREDICTED: similar to cone arrestin [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN === Xt ==== 0          AAI35572.1 Unknown (protein for MGC:122040) [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN === Xl ==== 0          AAC42225.1 cone arrestin [Xenopus laevis]  ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN === ?? ==== 0          NP_001081780.1 cone arrestin [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-XZT8128.5                                                                                                                               ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------TAA---------------TGA------------------------------------------------------------------------TGA---------------------------------------------ATG---------ATG---------------------------------------------------TAAATG
                                                                   ORF                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  0   1   1           Tad5 FL                          XZT33388.FL-MGC                                                                      GTGCAACTGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTAATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTCTGACAAACATTACCAGACTAATTCTTAAAAATAAACAATAAATGGAAATTCTTGCTATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   10  bld Eye  5g3  in                         CCAX1427.b1 ......................................GCGGTAGTGACAAGGGTCACCAAAACCATCAGTGCAACTGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATG
  5   1   2       bld Tad5 FL   in                         XZT33388.5p                                                                      GTGCAACTGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACAAAATTGTATGCTGTGAGGAGATGAATGACAC
  5   1   2   10  bld Eye  5g3  in                         CCAX2567.b1 .....................................................................GTGCAACTGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAATTACC
  5   1   2   10  bld Eye  5g3  in                         CCAX5292.b1 .....................................................................GTGCAACTGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGA
  5   1   2   12 seed Tad5 5g3  in                         XZT44482.5p ......................................................................TGCAACTGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTT
  5   1   2   20  bld Eye  5g                              CCAX1933.b1 .......................................................................GCAACTGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTG
  5   1   2       bld Eye       in                         CCAX6901.b1                                                                        TGCACTGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAACCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACC
  5   1   2       bld Tbd1      in                        CBXT21139.b1                                                                            CTGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACA
  5   1   2   10  bld Eye  5g3  in                         CCAX2771.b1 ...........................................................................CTGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAA
  5   1   2   10  bld Eye  5g3  in                          CCAX652.b1 ...........................................................................CTGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAG
  5   1   2   10  bld Eye  5g3  in                         CCAX1280.b1 ............................................................................TGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATT
  5   1   2   20  bld Eye  5g                              CCAX7321.b1 ............................................................................CTGAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGGACAAAGAAAAGTCTTTTGTGA
  5   1   2   12  bld Tad5 5g3  in                         XZT54561.5p .............................................................................GAAGTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATCTGTGA
  5   1   2   12  bld Tad5 5g3  in                         XZT19965.5p ..............................................................................CGGACGCGTGGGCGGACGCGTGGGAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACA
  5   1   2   10  bld Eye  5g3  in                         CCAX9957.b1 ................................................................................GTCCAAGAGAACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAAAGGC
  5   1   2   22  bld Tad5 5g                               XZT8128.5p .....................................................................................CAGAGACTGATACAGGTAAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTG
  5   1   2       bld Tad5      in                           XZT773.5p                                                                                                       GGTAAATTTCTGCTGCACAGAAAACTGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACACACCAGCAAGATTGTG
  5   1   2   10  bld Eye  5g3  in                         CCAX2425.b1 ......................................................................................................AAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCA
  5   1   2   10  bld Eye  5g3  in                         CCAX5640.b1 ......................................................................................................AAAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTA
  5   1   2   10  bld Eye  5g3  in                         CCAX1365.b1 .......................................................................................................AAATTTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATG
  5   1   2   10  bld Eye  5g3  in                         CCAX7639.b1 ...........................................................................................................TTCTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGGAACAGTTGACAGA
  5   1   2   10  bld Eye  5g3  in                         CCAX6116.b1 .............................................................................................................CTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATC
  5   1   2   10  bld Eye  5g3  in                         CCAX6820.b1 .............................................................................................................CTGCTGCAACAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGGAACAGTTGACAGATGTGGTTCTTT
  5   1   2   10  bld Eye  5g3  in                         CCAX9853.b1 ......................................................................................................................CAGAAAACATGGCAGAAGGTTCCAAGGTATTTAAGAAGTCCAGCGCTGATGGCAAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGGTTCTTTATTTCACT
  5   1   2       bld Eye       in                         CCAX7208.b1                                                                                                                                 GGTTTAAGGTTCCTTGGTATTTAAGAAGTCCTGCGCTGATGGCTAGCTGTCCATCTATCTAGCAAAGCGGGACTATGTGGACCATGTGGACCATGTTGAACCTGTAGATGGAATGATTCTAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAG
  5  -1   0       chi Te3                                 CAAM14853.5p                                                                                                                                                                                                                            TCATATCTGCATGGTACCAGTGCTCGCCCATTTCCCTCTGTGCCACAATTTCTTTCTGTTAATGCTGATTGCTGCAGGGTCCTCACGTTGTGTTGTGTGAGCTGTTGCAGAGAAACTAGTGAAGCAGAGTGAGTAGGAAGGAAACTGTGTCTCATCACCCACAGAACTGTGGCTTCTAATTGTTATCCCTTTTTCATTTTCTCATGAAGTTTTTTTTTTCCTTTACAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAGTAAGGGTCATATGCCCCTTATTGGTTGTCCTCAGGGCAGAACACAGGCGGCAATAGGCACTTTAGTTGTAGTGACTTATGGCAATATAGAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTAGATCTACCCAGTGACAGCATTGGGAATGTATCCATGGTGATGGCAAGATATTTGGTCACTGCCCATTTTCTCACAGCCCTTTAAGTCACTGTAAATCTTATATCTTCTCTTTGTCTTTGCAGAATTCTGGGTGACCCTGGTATTGCGCGTTCCTTTTAGATTGCGTGTGCGCGCTGCGGTTCCGGTTGGATTTTTCCCCAGCTCGGTGATCTGACGCTTTATCATCATGAGCTCGGCAGGCGGCG
  5   1   2       bld Tad5      in                         XZT64921.5p                                                                                                                                                                                                                                                                           AAAGGACAAGAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCC
  5   1   2       bld Eye       in                         CCAX6847.b1                                                                                                                                                                                                                                                                                    GAAAGTCTTTGTGACTCTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAAC
  5   1   2       bld Tad5                                 XZT26140.5p                                                                                                                                                                                                                                                                                                    CTCACATGTACTTTCCGTTATGGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCA
  5   1   2       bld Eye                                  CCAX5016.b1                                                                                                                                                                                                                                                                                                                         GGACGTGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGT
  5   1   2       bld Eye       in                         CCAX8019.b1                                                                                                                                                                                                                                                                                                                                    CCATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCT
  5   1   2       bld Tbd1      in                         CBXT8563.b1                                                                                                                                                                                                                                                                                                                                     CATGAGCTCATTGGCTTGAGCTTTAAGAAGGATCTGTACTTTCTGCATTGTCAGGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTG
  5   1   2       bld Eye       in                         CCAX2996.b1                                                                                                                                                                                                                                                                                                                                                                AGGGATCTGTACTTTCTGCATTGTTTTGTGTACCCCCCATTGCCTGAAGATAAAAAGGCCCTCACTCCGCTACAGGAAAAGTTAGCTAAAAAGCTGGGACAGAATGCATTTCCCTTCTGTTTTAATATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAATCCGAGTAAACCTGGTGGTGGCCAGAG
  5   1   2       bld Tad5      in                         XZT55094.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGGCCACAGATTTGCCATGCTCAGTGACACTTCAGCCTGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAAGTGAAAGGTTTCTGTGCAGAAAATGTGGAAGAGAAAGTACCCAGAAAAAACAGTGTGCAGCTCATCATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGACCTGCCCCATGTGTCCAAACAACACGGCAGTTCATGATGTCAGACCGACCACTACAGTTGGAGGCTTCTCTGAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGANCAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGAACATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATA
  3   1   2       bld Tad5 5g3  in                         XZT19965.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTAATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTCTGACAAACATTACCAGACTAATTCTTAAAAATAAACAATAAATGGAAATTCTTGCT
  3   1   2       bld Tad5 5g3  in                         XZT44482.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTAATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTCTGACAAACATTACCAGACTAATTCTTAAAAATAAACAATAAATGGAAATTCTTGCTATATCTTTT
  3   1   2       bld Tad5      in                         XZT55094.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTCTGACAAACATTACCAGACTAATTCTTAAAAATAAACAATAAATGGAAATTCTTGCTAT
  3   1   2       bld Tad5      in                         XZT64921.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACAAAGAGATATATTACCATGGGGAACCCATTGGTGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTCTGACAAACATTACCAGACTAATTCTTAAAAATAAACAATAAATGGAAATTCTTGCTAT
  3   1   2       bld Eye  5g3  in                          CCAX652.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTCTGACAAACATTACCAGACTAATTCTTAAAAATAAACAATAAATGGAAATTCTTGCTATA
  3   1   2       bld Tbd1      in                         CBXT8563.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATGTAAAAATTACCAACAACACCCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTCTGACAAACATTACCAGACTAATTCTTAAAAATAAACAATAAATGGAAATTCTTGCTAAAAAAAAAACAAAAAAAAAAAAAAA
  3   1   2       bld Tad5 FL   in                         XZT33388.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTAATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTTTGACAAACATTACCAGACTAATTCTTAAAAATAAACAATAAATGGAAATTCTTGCTTT
  3   1   2       bld Eye  5g3  in                         CCAX1365.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAATGTAAAAATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTTTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATTTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTTTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGG
  3   1   2       chi Tbd1      in                        CBXT21139.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATTACCAACAACACCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTCCTGACAGTTCTGCTTGGATATGGGTTGTAGCATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTCGTTTACATGTGGTATGAGATGAGGTCTTTAGCTCTGACAAACATTACCAGACTAATTCTTAAAAATAAACAATAAATGGAAATTCTTGCTATAAAAAAAAAAAAAAA
  3   1   2       bld Eye       in                         CCAX2996.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAACACCCAGCAAGATTGTGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTTTGACAAACATTACCAGACTAATTCTTAAAAATAAACAATAAATGGAAATTCTTGCTA
  3   1   2       bld Eye  5g3  in                         CCAX2425.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAAGATTGTGAAAAAGATTAAAATCCCAGTGGAACAGTTGACAGATGTGGTTCTTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTATA
  3   1   2       bld Tad5 5g3  in                         XZT54561.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCAAGATTGGAAAAAGATTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATTTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATTTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTAATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTATATCTTTT
  3   1   2       bld Eye  5g3  in                         CCAX9853.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAAGATTAAAATCCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACCACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCTTACGGCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTCTGACAAACATTACCAGACTAATTCTTAAAAATAAACAATAAATGGAAATTCTTGCTA
  3   1   2       bld Eye  5g3  in                         CCAX5292.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAAAATCACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTTTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATTTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTTTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGTTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTA
  3   1   2       bld Eye       in                         CCAX8019.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACAGTGGAACAGTTGACAGATGTGGTTCTTTATTCCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACCACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCCAACAACAGGAAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCTTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTTTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGTTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTATAAC
  3   1   2       bld Eye  5g3  in                         CCAX6116.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGAACAGTTGACAGATGTGGTTCTTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTTTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATTTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTTTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGTTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTATA
  3   1   2       bld Eye  5g3  in                         CCAX1280.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGAGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTTTGACAAACATTACCAGACTAATTCTTAAAAATAAACAATAAATGG
  3   1   2       bld Tad5      in                           XZT773.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTNTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTCTGACAAACATTACCAGACTAATTCTTAAAAATAAACAATAAA
  3   1   2       bld Eye  5g3  in                         CCAX6820.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGGTTCTTTATTCACGGGACCAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACCCAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATTTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTTTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATTTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTTTAACACTAGTTTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGTTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTA
  3   1   2       bld Eye  5g3  in                         CCAX1427.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACTGGACAAGTACACCAAAATTTGTATGCTGTGAGGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTTTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATTTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTTTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATTTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTTTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGG
  3   1   2       bld Eye  5g3  in                         CCAX5640.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTA
  3   1   2       bld Eye       in                         CCAX6847.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATTTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTTTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATTTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTTTAACACTAGTTTTTCCCTGGCATATAACCTTGGGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTTTTTAGTTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTTTA
  3   1   2       bld Eye       in                         CCAX6901.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGGACAAGTACACCAAAATTGTATGCTGTGAGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATTTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTTTGGGTGACCGGACATCAAGTGATGTGCTGGTAGATGGGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGGGCAGAGGGTGAAGAAAACA
  3   1   2       bld Eye  5g3  in                         CCAX2771.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGGGGGAGATGAATGACACAGTAGCAGCAAATGGCACTTTCTCTAGGTCTTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATTTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTCTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTATA
  3   1   2       bld Eye       in                         CCAX7208.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTAGCAGCAAATGGCACTTTTTTTGGGTCTTATTCTGTGACACCGCTTTTGGCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCTTACGGCCTGGCATGGACAAAGAGGTGTTGGAAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTTTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTCTGACAAACATTACCAGACTAATTCTTAAAAATAAACAATAAATGGAAATTCTTGCTA
  3   1   2       bld Eye                                  CCAX6875.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCAACAACAGGGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATTTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAACCCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATTTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTTTAACACTAGTTTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTTTTTAGTTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTA
  3   1   2       bld Eye  5g3  in                         CCAX2567.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGAAACGTGGACTGGCTCTAGATGGCAAACTGAAACACGGTGACACCAACCTTGCATCATCTACAATCCTACGGCCTGGCATGGACAAAGAGGTGTTGGGAATGCTGGTGTCGTATAAAGTCCGAGTAAACCTGGTGGTGGCCAGAGGAGGAATTCTGGGTGACCTGACATCAAGTGATGTGCTGGTAGATCTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTA
  3   1   2       bld Eye  5g3  in                         CCAX7639.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTAGATTTGCCACTTACACTGATGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTTTAACACTAGTTTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTTTTTAGCTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGG
  3   1   2       bld Eye                                  CCAX4003.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATTTGCCACTTACACTGATGCATCCCAAACCATCTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGACAATGCAGATTGTAGAATATTGCACTGTACTTTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTTTTTAGCTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGG
  3   1   2       bld Eye                                  CCAX3895.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTACACTGAGGCATCCCAAACCATTTCCGGACCAGACAAACATTGAGGATGTGGTGATAGAGGAATTTGCCCGGCAAAAGCTTCAGGGAGCAGAGGGTGAAGATGACAAGGAAGATGCATAAAGTGAAAGCAGCAGTTGAGAAGCTGCCAATGCAGATTGTAGAATATTGCACTGTACTTTAACACTAGTCTTTCCCTGGCATATAACCTTGGGAGTGTGGGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTTTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTTTA
  3   1   2       bld Eye  5g3  in                         CCAX9957.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGCTGACAAATGCAGATTGTAGAATTTTGCACTGTACTCTAACACTAGTCTTTCCCTGGCATATAACCTTGTGAGTGTGTGAGTTGGTTACTGGTCCATACATATGCATCCTTGTTTACATGTGGTATGAGATGTGGTCTTTAGCTCTGACAAACATTACCAGACTAATTTTTAAAAATAAACAATAAATGGAAATTCTTGCTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)