Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG20107.5                            9 END     1           1       12                PREDICTED: similar to A-kinase anchor protein 1 isoform 1 precursor; A-kinase anchor protein, 149kD; spermatid A-kinase anchor protein 84; protein kinase A anchoring protein 1; dual-specificity A-kinase anchoring protein 1 [Gallus gallus]

 This cluster: approximate FL confidence score = 94%

 1012072662 Xt7.1-TNeu087i22.3 - 56 ESTs
                                                                       ....-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu087i22.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGTACTTTGTACTTGGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCTAT
                                                  Xt7.1-CHK-1008225216                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTGTACTTGGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCTATGAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         11    14    12    23    22    24    24    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    24    25    24    25    24    25    24    25    25    26    27    28    28    29    28    29    28    30    29    30    29    30    29    31    27    30    29    32    29    32    32    35    33    36    33    36    34    37    35    39    36    40    37    41    39    42    42    45    44    47    43    47    43    47    44    47    44    45    45    46    45    46    47    48    47    48    46    48    46    48    42    47    44    47    44    48    44    48    44    47    43    46    43    46    42    45    42    45    39    42    37    41    38    40    36    38    35    38    36    38    36    38    34    35    34    35    32    33    29    33    32    33    32    33    31    33    30    33    30    32    29    32    29    30    28    31    29    31    30    31    29    30    29    30    29    30    29    30    28    29    27    29    27    29    28    29    27    28    23    25    21    23    16    22    10    17
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------T---
                                               BLH ATG     108     789                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH MIN     108     102                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH OVR     108     134                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               EST CLI      -3      48                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               ORF LNG     108       4                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 9e-018     NP_494798.4 Helix Loop Helix family member (hlh-1) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 2e-028     AAB61360.1 MyoD-family protein j [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 1e-034     NP_476650.1 nautilus CG10250-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Bf ==== 3e-036     AAN87802.1 myogenic regulatory factor 2 [Branchiostoma floridae] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 6e-035     XP_781762.2 PREDICTED: similar to Transcription factor SUM-1 (Sea urchin myogenic factor 1) [Strongylocentrotus purpuratus] ----------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Bb ==== 5e-037     BAC16742.1 MyoD-related [Branchiostoma belcheri] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Br ---- 2e-043     AAR12639.1 MyoD [Branchiostoma belcheri tsingtaunese] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- ?? ---- 1e-058     NP_001079366.1 similar to myogenic differentiation 1 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN -== Dr ==== 3e-074     NP_571651.1 myogenic factor 5; myogenic regulatory factor 5 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Gg ==== 4e-090     NP_001025534.1 myogenic factor 5 [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 1e-105     NP_032682.1 myogenic factor 5 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 4e-108     NP_005584.1 myogenic factor 5 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 2e-142     CAA40062.1 myogenic factor Xmyf-5 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 4e-151     AAL11024.1 myogenic factor MYF-5 [Silurana tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu087i22.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGA---------------TGA---------------------------ATG---ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------TAA---------------------------------------ATG---TAA------------------------------------TAA------ATG------------TAG---------TAA---------------------TAAATG------------------------------------TAA---TAATAA---------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   1           Neu0 FL                     IMAGE:5384698.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTTGTACTTTGTACTTTGTACTTGGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCTATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas127b01.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTGTACTTTGTACTTGGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCTATGAAAAAAAAAAAAAAAAAAAA
  5   1   2       chi 1030 5x                         IMAGE:7027150.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGCACTTAGTCTTGGGCTTTTGTACTTTGTACTTTNGACTTGGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGTCGGTAACTGTCTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCTCTATGGGATAGAAGGGAAGGTTGCCTCCCCTGAGAAGAAGGGGCTAATGGCTCTAATAAACGTAAAATCAGGGCTTTTTTGGATACTCCTTCATAAATGAACGGCATCCACTGTATGAGTTCCGCCCAGATTCATGAGGAATTTGTCTAATTGGGTGGTGAGAAATTCCTACAATATAAAATCTCCTATGTTAATATTTAGTGAGTATATATATAGGCTCCCCCTCTATAACGAACCCGCTAGGTGTTGCTTTAGAAATATTAAATTGTGTCTTAATAAAGAAGATATGTGCGGTGTTAAAAAGCTCTGCGTATCTCTCATTGTGTGATAAAAAGGAGATTATTTTCATGTGTGTCACTACTAGAGATATAACGTCCTAAATTATCAATGACATTTTACCTCCGTCTCTTTTGAAGCTTCTATATTCCTCTTGTGTCAGCTCAGAATGGTAAAGAACGCGAGTAAATATAATGGGGGGTTTAGATGTGGGTTTTCTTTGCGGCGCACTTCGGGGGAAACCGAAACGTAGGTGGCTCCACCCTTTTCAACACTTTGTGGACATTATCCCGCCGGTAAAAATGTGGGGTATATATAGATTATCTAATACACTCTATATGTGCCAAAATATAACCAGGATATCGTCATATGTTATACTTACTCGGCCGAGATTTTTTAGTCTCAGACAAAAAATCAATTTCTTTTTATTTTCAATGATCATAGTGTATTATGTAATATTTCTTCATATCTTGTTTTTATATCTTCTGACCCCATGTTTTCACTATAGCCGTATAAATACTCATTTGTCACCACACATAGTAGGGAGATATAGCTGGGAAAAATGTTCGTTTAATCTGTCGCCACCGCACCCATTTGCTGGTG
  5   1   2       bld Neu0 FL   in                    IMAGE:5384698.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCTTTTGTACTTTGTACTTTGTACTTGGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTAC
  5   1   2       bld HeRe 5g3  in                     EC2CAA37BE01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGACTTAGTCTTGGGCTTTTGTACTTATTGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCATATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACT
  5   1   2       bld TbA  5g3  in                   TTbA019c09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTTTTGTACTTTGTACTTTGTACTTGGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGAATGCCCGACCATCTACCATGTACTATAAACCTCTGTTAATTCCCATTACATATACTTTTACTAATATATGA
  5   1   2       bld TbA  5g3  in                   TTbA020c09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTTTTGTACTTTGTACTTTGTACTTGGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCNATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCAAAACATTTCCT
  5   1   2   12  bld Gas7 5g3  in                         XZG40294.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTTTGTACTTTGTACTTTGTACTTGGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCC
  5   1   2       chi Tad5 5g                              XZT33504.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTTGTACTTTGTACTTTGTACTTGGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGGTAAGAACCTTGCTAACAGACCCATTCCTAAATCTATAGACATGTCTTGTTTTATCAGTTACTAGGGTCTTTAAATATGCATTTGTTATTTGGTATTGTTCTATTCCACAGTATGCATGAAAATGAATTCCCTATATTGTTTTTTGGACTAT
  5   1   2       bld TpA  5g                        TTpA068f21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGGGCTTTTGTACTTATTGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCAGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCC
  5   1   2       chi Neu  5x                        TNeu059d09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACTTTGTACTTTGTACTTGGAGAAAGCTGTCCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAA
  5   1   2       bld TbA  5g3  in                   TTbA047f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACTTTGTACTTTGTACTTGGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACNAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAG
  5   1   2       bld Neu  5g3  in                   TNeu087i22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGGGCTTTGTACTTGGAGAAAGCTGACCAAAGGAGGCTCCGGGGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTGGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGAGGGTGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGAGCTTCAAGAATCCGATGAAGATGAGCATGTGAGAGCACCCATTGGTCACCACCAAGCAGGTGACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGAC
  5   1   2       bld Gas  5g                        TGas042g05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTGTACTTTGTACTTGGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTNTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACT
  5   1   2       bld Gas  FL   in                   TGas127b01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGTACTTTGTACTTGGAGAAAGCTGACTCCGTGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCTACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTAT
  5   1   2       bld Neu  5g3  in                   TNeu072m18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGTACTTTGTACTTGGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCATAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACA
  5   1   2   12  bld Gas7 5g3  in                         XZG51315.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTTTGTACTTATTGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCAGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGCCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGAC
  5   1   2   12  bld Gas7 5g3  in                         XZG59064.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTTTGTACTTATTGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCAGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACGCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTC
  5   1   2   12  bld Tad5 5g3  in                         XZT64086.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTTTGTACTTATTGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCAGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGTAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATG
  5   1   2       bld Gas  5g   out                  TGas132b01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTGTACTTATTGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCAGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCATATGGCATGACTGACTGCAGCAGCCCGCAATGGTCCTGGAAGGAACAGCAGCTTTGATAATGCTTATTGCTCCGATTTA
  5   1   2       bld Gas  5g                        TGas138c17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTGTACTTATTGAGAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCAGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCC
  5   1   2       bld Gas  5g                        TGas046o13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACTTATTGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCAGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTNTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTA
  3  -1   2       bld Gas6      in                         ANBT2695.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCTTTAGTGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCAGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCT
  3  -1   2       bld Gas6      in                            ANBT7.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCTTTAGTGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCAGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCATTAACATATACTTACTAAATATNATGACTTAATCCAAAACATTTCCTT
  5   1   2   12  bld Gas7 5g3  in                            XZG86.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TACTTGGAGAAAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCCTCTCTGAGCAATGCTCCCTCCC
  5   1   2       bld Gas8 5g                               st10c06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGCTGACCAAAGGAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCAGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATT
  5   1   2       bld Gas8 5g3  in                         st110g15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAACTCCTAAGAGATTTCCTGAGACTTGATTGCTTCAACTCCACTGAGCATCTTTACAAGCAGCAGTATTCAGAATGGAGATGGTAGATACCTGCCATTTTTCCCCATCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCAGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCTCTCTATGGAGCTCACAAAAAGGATCTTCAAGAATCAGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCAT
  5   1   2       bld Neu                            TNeu009l22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGANAAGACTATGAGCATGGCATGTCTCTCTTGGAGCTCACAAAAAGGACTTCAAAAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTC
  3   1   2      seed Neu  5g3  in                    TNeu072m18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAATCCGATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCTATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  FL   in                    TGas127b01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACCATGCTGTTTTTTTCTTTCTATGAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu087i22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATGAAGATGAGCATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACCATGCTGTTTTTTTCTTTCTAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Gas6      in                            ANBT7.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATGTAAGAGCACCCATTGGTCACCACCAAGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCTATGAAAAAAAAAG
  3   1   2       bld TbA  5g3  in                    TTbA020c09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCTTCCACTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACCATGCTGTTTTTTTCTTTCTA
  5   1   2       bld Gas                            TGas005a03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGGGGNATTCCCCGGGTATGGACAGAAAGGAGGCTGCCACCATGGAAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTAT
  5  -1   2       bld Gas6      in                         ANBT2695.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCTATGAAAAAAAAAG
  3   1   2       bld Gas8 5g3  in                         st110g15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTATGGACAGAAGGAAGGCTGCCACCATGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAAT
  3   1   2       bld Gas7 5g3  in                         XZG51315.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCT
  3   1   2       bld TbA  5g3  in                    TTbA019c09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTTTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATTCCCAATTGCTATTGTGTTAATAAACCATGCTGTTTTTTTCTTTCTATGAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Gas7      out                        XZG20107.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAGAAAGGAGAAGGCTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCTATG
  3   1   2       bld Tad5 5g3  in                         XZT64086.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTAAGAAAGTAAACCAGGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGTAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTC
  5   1   2       bld Gas7      in                         XZG28137.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTTTTGAAACTCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTG
  3   1   2       bld Gas8                                 st115o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTCAAANGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTGGNATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCC
  3   1   2       bld Gas8                                 st116o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTNGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAAT
  5   1   2       bld Neu                            TNeu047a17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     NAGCACCACTACAAACCCCAATCAGAGACTGCCAAAGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATCATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTA
  5   1   2       bld Egg                            TEgg093i01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGCAAACCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAG
  3   1   2       bld TbA  5g3  in                    TTbA047f16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCAATCAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTTTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATTTAGTATTGTGGATCGGATCTCCTTTTTTGAGCAATGCTCCCTCCCTATTCCAGACTCTTTTTCCCTGTTTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATTTACCATGTACTATAAACCTTTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGGGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTTTACTTGGGTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACACTGCTGTTTTTTTCTTTTTATGAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Gas7 5g3  in                         XZG59064.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAGACTGCCAAAGGTGGAGATCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCTATGAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7      in                         XZG54478.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCGTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCTATG
  3   1   2       bld Gas7 5g3  in                            XZG86.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCCTAGGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTT
  3   1   2       bld Gas7 5g3  in                         XZG40294.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCTAAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTTTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATTTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGGGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCTATG
  5   1   2       bld Gas7      in                         XZG54478.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCGTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCTATGAAAAAAAAAAAAAAAAAAAAGG
  5   1   2       bld Gas                            TGas040o01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACGCAATTAAATATATAGAGAGCCTCCAANACCTACTGCAAGAACAGGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATNTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTC
  3   1   2       bld Gas7      in                         XZG28137.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAACGCAATTAAATATATAGAGAGCCTCCAAGACCTACTGCAAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTTTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATTTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCTTTGG
  3   1   2       bld Gas8                                 st114o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTCCCAGGACAGAGCTGCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATNTTTTAAATGCCTAAATTATATTTCT
  3   1   2       bld HeRe 5g3  in                     EC2CAA37BE01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACCGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCGCAATGGTCTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTTCTGAGCAATGCTCCCTCCCTATTCCAGACTCTCTCTCCCTGTCTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAAT
  3   1   2       bld Neu0 FL   in                    IMAGE:5384698.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGAACCAGGAAGCCCGACATCCAGCTGCTCAGATGGCATGACTGACTGCAGCAGCCCACAATGGTTTGGAAGGAACAGCAGCTTTGATAATGTTTATTGCTCCGATTTACAGACAAGTTTTTCATCAACCAAACTGACACTGTCCAGCCTTGACTGCTTATTTAGTATTGTGGATCGGATCTCCTTTTTTGAGCAATGCTCCCTCCCTATTCCAGACTTTTTTTCCCTGTTTCCTACCAGTAGCACTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGGCCAATTTTCCATGTACTATAAACCTTTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATTGGGGTATAAGGGCTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTTTACTTGGGTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTTTTTTTTTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5  -1   2       chi TbA                            TTbA053f14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATAACCAGTCAAGGCTGGACAGTGTCAGTTTGGTTGATGAAAAACTTGTCTGTAAATCGGAGCAATAAACATTATCAAAGCTGCTGTTCCTTCCAGACCATTGTGGGCTGCTGCAGTCAGTCATGCCATCTGAGCAGCTGGATGTCGGGCTTCCTGGTTCGGTGCAGCTCTGACTCCTTTCCACGATCACCTGACATGCCCGATTGCCGACCAATCTACCATGTACTATAAACCTCTGTTAATTCCATTAACATATACTTACTAAATATTATGACTTAATCCAAAACATTTCCTTGCAACCAGCAAATCGGCGTATAAGGACTTATGTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGNTTTTTTTCTTTCTATG
  5   1   2       bld TbA                            TTbA045d03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGCAAGGAAATCGGCGTATAAGGACTCATTTTATTATTTGTATAGATATGTATATAAAGAAATAATTTTGTTATTTTTTAAATGCCTAAATTATATTTCTACTTGGCTACATTTTGTATTTAACGTTAATAACCAAGCCTACAGCAAGAAATCCCAATTGCTATTGTGTTAATAAACATGCTGTTTTTTTCTTTCTATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)