Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-THdA028k23.3                         94 END     1           1        1                PREDICTED: similar to cDNA sequence BC005537 [Gallus gallus]
     2   2.0    0Xt7.1-XZT67641.3                            2 END     2           2      100                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 303.0    0Xt7.1-XZT38113.5.5                         93 PI      78        163      624                Hypothetical protein MGC76308 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 95%

 1012072699 Xt7.1-CBSW9069.3.5 - 74 ESTs
                                                                       ........-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CBSW9069.3.5                             TTTTGCCCAAGCTTTGCATGCTGATAAGCCTCTGTTTGGGAACAACCTCCCTATTGTGGTAGCGCACTGCCTCTGCACATCCCAAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224196                                   CCAAGCTTTGCATGCTGATAAGCCTCTGTTTGGGAACAACCTCCCTATTGTGGTxxxxxACTGCCTxxxxxxAxxxxxAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                  3     3     3     3     3     4     3     6     3     8     4    13     7    20    11    24    23    31    23    31    23    32    23    33    23    33    34    34    34    34    34    35    34    35    34    35    34    35    34    35    34    35    34    35    35    36    35    36    35    37    35    37    38    43    40    45    43    47    43    47    46    50    50    54    51    55    55    59    55    59    56    60    56    60    56    61    58    63    58    63    60    66    60    66    61    66    61    66    61    66    61    66    60    65    60    65    56    66    43    67    43    67    43    67    44    68    44    68    44    67    44    66    44    66    43    64    43    64    43    64    44    63    44    63    43    62    41    60    39    59    37    58    39    58    38    58    38    58    37    54    37    52    35    49    34    48    33    46    31    43    30    42    28    40    27    39    27    39    27    38    27    38    27    37    27    37    27    37    28    37    28    38    28    38    27    38    26    38    25    35    24    32    24    32    23    32    22    30     7     9
  5   1   2  SIG                                     Xt7.1-CAAL20344.3                        GGGGATTTTGCCCAAGCTTTGCATGCTGATAAGCCTCTGTTTGGGAACAACCTCCCTATTGTGGTGTAAAAAAGGCACTGCACATCCCAGATTCCATCCGAGAGCCCAGAGAACATCGCTCCGGCGTTTGGCGCTTTGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTC
  5   1   2  SIG                                      Xt7.1-CBSW9069.3                                                                         GGCATGTCGGAGTGTCAGCGCACTGCCTGCCAGGGAAGAGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAAAAAAAA
  5   1   2  SIG                                     Xt7.1-CAAL18643.3                                                                                                               AGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCCCAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAA
                                                                   VAR                                                                                         GTAAAAAAGGCA
                                                                   VAR                                                                                                     GCCAGGGAGAGA
                                                                   VAR                                                                                                                 GATTCCATCCGAGAGCCCAGAGAACATCGCTCCGGCGTTTGGCGCTTTGCAGAGATGCCTCTTGGAAGACAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                             TTTAGTCAGGACTTTGCATTGATTGATGCTGCAGTATGCCAATCACAGGCTGCCGCATCATAGTCCCACTCCCTGATGTCACTAGCCGCCTTTTTCTTGAAGCTGTAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTGGCCCACAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------T--T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------A
                                               BLH ATG     156    1075                             
                                               BLH MIN     153      97                             
                                               BLH MPR     147      97                             
                                               BLH OVR     156      57                             
                                               CDS MIN     156      23                             
                                               EST CLI      76      23                             
                                               ORF LNG     156       1                             
                                                                                                                                                                                                                                                      PROTEIN === Sc ==== 5e-042     NP_013271.1 Involved in a subset of clathrin functions at the Golgi; Aps1p [Saccharomycescerevisiae] =================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PROTEIN === Ce ==== 7e-068     NP_504559.1 AdaPTin or adaptin-related protein (18.6 kD) (apt-2C) [Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PROTEIN === Br ==== 5e-071     AAQ83889.1 clathrin-associated adaptor complex AP-1 small chain sigma1 [Branchiostoma belcheri tsingtaunese] ===========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PROTEIN === Dm ==== 7e-070     NP_651198.1 CG5864-PA [Drosophila melanogaster] ========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PREDICTED = Sp ==== 3e-071     XP_001203214.1 PREDICTED: similar to clathrin-associated adaptor complex AP-1 small chain sigma1 [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 1e-078     NP_081163.2 adaptor-related protein complex 1 sigma 2 subunit [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                               PROTEIN === Dr ==== 3e-081     NP_991121.1 adaptor-related protein complex 1, sigma 2 subunit; wu:fd19a08 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 1e-083     AAH84408.1 LOC495185 protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                               PREDICTED = ?? ==== 1e-083     NP_001088344.1 hypothetical protein LOC495185 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 4e-084     CAJ82923.1 adaptor-related protein complex 1, sigma 2 subunit [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                               PROTEIN === Gg ==== 2e-085     NP_001006261.1 similar to DC22 [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                               PROTEIN === Hs ==== 1e-085     NP_003907.3 adaptor-related protein complex 1 sigma 2 subunit [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CBSW9069.3.5                                                  TGATAA---------------------------------------------------------------------ATG------------------------TAG------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------TAG------ATG------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------TGATAA---------TGA---------------TAG---TGA---------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2  SIG                                     Xt7.1-CAAL20344.3                        GGGGATTTTGCCCAAGCTTTGCATGCTGATAAGCCTCTGTTTGGGAACAACCTCCCTATTGTGGTGTAAAAAAGGCACTGCACATCCCAGATTCCATCCGAGAGCCCAGAGAACATCGCTCCGGCGTTTGGCGCTTTGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTC
                                                  Xt7.1-CHK-1008283296                              TTTGCCCAAGCTTTGCATGCTGATAAGCCTCTGTTTGGGAACAACCTCCCTATTGTGGTGTAAAAAAGGCACTGCACATCCCAGATTCCATCCGAGAGCCCAGAGAACATCGCTCCGGCGTTTGGCGCTTTGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATAT
  5   1   2       ext BrSp 5g3  in                     EC2BBA10DG03.g1 GGGACGTGTCACAGGGCTGTAACTGGGATTTTGCCCAAGCTTTGCATGCTGATAAGCCTCTGTTTGGGAACAACCTCCCTATTGTGGTGTAAAAAAGGCACTGCACATCCCAGATTCCATCCGAGAGCCCAGAGAACATCGCTCCGGCGTTTGGCGCTTTGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTA
  5   1   2       ext BrSp 5g3  in                     EC2BBA16DF10.g1                        GGGGATTTTGCCCAAGCTTTGCATGCTGATAAGCCTCTGTTTGGGAACAACCTCCCTATTGTGGTGTAAAAAAGGCACTGCACATCCCAGATTCCATCCGAGAGCCCAGAGAACATCGCTCCGGCGTTTGGCGCTTTGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCA
  5   1   3        nb BrSp 5g3  in                     EC2BBA28CG01.g1                        GGGGATTTTGCCCAAGCTTTGCATGCTGATAAGCCTCTGTTTGGGAACAACCTCCCTATTGTGGTGTAAAAAAGGCACTGCACATCCCAGATTCCATCCGAGAGCCCAGAGAACATCGCTCCGGCGTTTGGCGCTTTGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTT
  3   1   2       ext BrSp 5g3  in                     EC2BBA34BD02.b1                                                                                                GGGGACTGCACATCCCAGATTCCATCCGAGAGCCCAGAGAACATCGCTCCGGCGTTTGGCGCTTTGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAA
  5   1   2       ext BrSp 5g3  in                     EC2BBA34BD02.g1                                                                                                 GGGACTGCACATCCCAGATTCCATCCGAGAGCCCAGAGAACATCGCTCCGGCGTTTGGCGCTTTGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAATAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTC
  5   1   3   10   nb Eye  5g3  in                         CCAX3665.b1 ................................................................................................GGCACTGCACATCCCAGATTCCATCCGAGAGCCCAGAGAACATCGCTCCGGCGTTTGGCGCTTTGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTAAACTACTAGTGTA
  5   1   4   14 seed Brn4 5g3  in                        CAAL20344.5p .................................................................................................GCACTGCACATCCCAGATTCCATCCGAGAGCCCAGAGAACATCGCTCCGGCGTTTGGCGCTTTGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGGAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATC
  3   1   4      seed Brn4 5g3  in                        CAAL20344.3p                                                                                                                                                                                                                                                                                                                                                                                                 CTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  3   1   2       ext BrSp 5g3  in                     EC2BBA16DF10.b1                                                                                                                                                                                                                                                                                                                                                                                                   GTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATATTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTTGTTGGCTGTTAAGGATTT
  3   1   2       ext BrSp 5g3  in                     EC2BBA10DG03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                   ACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATATTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTTGTGG
  3   1   3        nb BrSp 5g3  in                     EC2BBA28CG01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATATTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTGGCAACCAAAGAGTAGTTGTTGGCTGTTAAGGATTT
  3   1   2       ext Hrt1      in                        CAAQ10231.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  5   1   2       ext Hrt1      in                        CAAQ10231.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAAAAAAAAAAAAAAAAAA
  3   1   3        nb Eye  5g3  in                         CCAX3665.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  5   1   2  SIG                                      Xt7.1-CBSW9069.3                                                                         GGCATGTCGGAGTGTCAGCGCACTGCCTGCCAGGGAAGAGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAAAAAAAA
                                                  Xt7.1-CHK-1008283298                                                                               TCGGAGTGTCAGCGCACTGCCTGCxxGGxxAGAGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAAAAAAAAAAAAAA
  0   1   1           Tad5 FL                          XZT34666.FL-MGC                                                                                                                GAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGACCCAGACTGAAGACTGGGGAGGTTATTCAGATGATATCTTGTGAGAAGGACTAATCTGAAGGATTAGCCTCCCCGACCTACCTCCTAAAGTGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATATTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           TpA  FL                     TTpA004p09.FL-Sanger                                                                                                                     TGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   0       chi Brn2 5x   in                        CAAJ19791.5p     AGAGAACATCGCTCCGGCGTTTGGCGCTTTGCAGAGATGCCTCTTGGAAGACAAGTCATTAATATTTTATTGATTTTACCCTGTACTTATTTGTGACCCTGCAAAGTGCTGAAGTCTTGCTTTGCCTTTCCTTCACTTTGCATTCTAATTTCTTTTATTTTCTTTGTCGTTGTTCAACAGATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTTGTTCACACTCTGCTCTCTTACTACACCCCTCCCTAGCATTCTTAACCACTGGGCTGCCACATTGGCCTGCATTGCAGTGCGCTGGCTGAGTGCTCCTTTCCCTGGGAAGGGGGAGATTGATTAACTTACTGCTCATAATGCAGCTGCTGCTGCTCTCCGCACATAGTACTGCAAACCCTCTGGGCTAGGGCACATACATCAAGGAGACAGATATGAAAAAAAATATATATATATATGCCAGTTCACCTTCTTGTGACTGGTGTTCCAATGTCACTCTTAAACAATTATGGATAGAAGTTGTCATTAATATTACATGTTTTAGAGTTCGATTAAATGATCTATATTTATACATGGCAGAAATGAGCTAGAAAGCCAACTAAATGGCAAAAATTTTCTCCTGTGCCTACATTAGTTGTCATTCAACAGTTGATAAATCATAAGAGGAGCTACAGCCCTAGATACTTACACCAAACACAGTCAGTCAGATATTGCCCTATTCCAGTAACAAACAGCAACTTT
  5   1   2   12  ext Gas7 5g3  in                         XZG34808.5p ..........................................CGATTCGATTCGTCGACCCACGCGTCCGGGGGCATGTCGGAGTGTCAGCGCACTGCCTGCCAGGGAGAGAGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAG
  5   1   2   10  ext Spl2 5g3  in                        CBSS6591.fwd ............................................................ACCGGAAGTGGGGCATGTCGGAGTGTCAGCGCACTGCCTGCCAGGGAGAGAGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAA
  5   1   2       ext HeRe 5g3  in                     EC2CAA31CA08.g1                                                                GAGTGGGGCATGTCGGAGTGTCAGCGCACTGCCTGCTAGGGAGAGAGAGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATATAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAATTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAA
  5   1   3        nb Gas  5g                        TGas083g23.p1kSP6                                                                        GGGCATGTCGGAGTGTCAGCGCACTGCCTGCCAGGGAGAGAGAGAGTGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCA
  5   1   3   10   nb Te1  5g3  in                        CBWN12157.b1 ..........................................................................GTCGGAGTGTCAGCGCACTGCCTGCCAGGGAGAGAGAGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATATTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTC
  5   1   3   14   nb Te5  5g3  in                        CAAO11695.5p .............................................................................TCGGAGTGTCAGCGCACTGCCTGCCAGGGAGAGAGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTTGGGTTCT
  5   1   2   12  ext Gas7 5g3  in                         XZG34962.5p .............................................................................GTCGGAGTGTCAGCGCACTGCCTGCCAGGGAGAGAGAGAGTGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGATCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCG
  5   1   3   10   nb Spl2 5g3  in                        CBSS2910.fwd ..................................................................................GTGTCAGCGCACTGCCTGCCAGGGAGAGAGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAATCACTCCAGAACAATGTTAAACAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAA
  5   1   3   34   nb Te5  5x3  ?                         CAAO11188.5p ...................................................................................TCAGCGCACTGCCTACCAGGGAGAGAGAGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTG
  5   1   4   10 seed Ova1 5g3  in                         CABE4634.5p ....................................................................................TGTCAGCGCACTGCCTGCCAGGGAGAGAGAGAGTGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTTCCAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGC
  5   1   3   34   nb Te5  5g                              CAAO6258.5p .........................................................................................CACTGCCTACCAGGGAGAGAGAGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCCAGAACATGTTCTCATTTGGTTT
  5   1   3   10   nb Thy1 5g3  in                         CBST738.fwd .........................................................................................CGCACTGCCTGCCAGGGAGAGAGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGAGTTCTCAGAGGGGAAAATCACTCCNGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCA
  5   1   3   10   nb Ova1 5g3  in                         CABE1504.5p .................................................................................................CCTGCCAGGGAGAGAGAGAGTGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAG
  5   1   2   10  add Tbd1 5g3  in                          CBXT970.b1 ........................................................................................................GGGAGAGAGAGAGTGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAG
  5   1   3        nb Te5       in                         CAAO7328.5p                                                                                                             AGAGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCT
  5   1   2       add Tad5 FL   in                         XZT34666.5p                                                                                                                GAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGACCCAGACTGAAGACTGGGGAGGTTATTCAGATGATATCTTGTGAGAAGGACTAATCTGAAGGATTAGCCTCCCCGACCTACCTCCTAAAGTGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTT
  5   1   2       add TpA  FL                        TTpA004p09.p1kSP6                                                                                                                     TGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGGCCACAAGACAGGAAGCTGTCATTT
  5   1   2       ext TpA  5g3  in                   TTpA024o04.p1kSP6                                                                                                                      TGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCG
  5   1   3   10   nb Thy1 5g3  in                        CBST1914.fwd .....................................................................................................................GGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGAT
  5   1   3   10   nb Limb 5g3  in                        CBSU2736.fwd .....................................................................................................................GGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTG
  5   1   0       chi Te1       in                          CBWN978.b1                                                                                                                      GGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGAATTTCAGAGGAATTGAACTGGACTGAGCGTGGCTGGAAGTGTCTTTGGATTGGTGGAACCATCCATCTTGCCGCTGGCAACGCACCTGTTCAGTGTTTTGTGTTTCCATTCGTGCCTTCTGTCACATTGTCATGCACTGAGCACTCGTTCTTTAAGTAGCGGTGACTTTCTAACAACACTTGGGATTTCAGCCCTTTCTAATGTGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATNAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTA
  5   1   2       add TbA  5g                        TTbA050p11.p1kSP6                                                                                                                            TATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGACCCAGACTGAAGACTGGGGAGGTTATTCAGATGATATCTTGTGAGAAGGACTAATCTGAAGGATTAGCCTCCCCGACCTACCTCCTAAAGTGTTGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCT
  5   1   2   12  add Tad5 5g3  out                        XZT67641.5p ..................................................................................................................................................GCGTTTGGCGCTTTGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGTAAGGCAAACCGAGAACAGGGCAGAGGAACAGCATGACGTGCCCTGAATACTGATCCTTCCTGCGTCCTGCTCTGTGCTGTGCTTTTGCCCCCTAGCACTACGCACGTGCTGCATGGCGTTTCTCTCTATCCCTATCTACTCCTACCCTTTTGTCCTTTTTCTCCTCTAATGTGGGTTTTTGGATCAATGTGCCTATGGTGTGATAGGTGCAAATAATATAGCCTGTTGTTCCCTTGGTACAATCATAGCATTCCCTTTGTCCATGTTTTAACATTCTGTGTCTGTCTACTGATATGTGTGTGCTTCTTTGCTGTTTTATTGCTGAATTCCAGAAGGTAGACTCTCTCCTTTGAGCCTAATTCAGGTATA
  5   1   3   10   nb Tail 5g3  in                         CBSW9069.b1 ..............................................................................................................................................................GTGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATATTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAG
  5   1   2       add Eye       out                        CCAX2394.b1                                                                                                                                                                                                        GTGTCTTGCTAATTTATTTGTAACTTCCAGGGCTACCGCTTAATTCTTGTGTGTTGTGAGCTATGCCGAATGAATACAGGGAAGGCTGTGGGGGTTATGCCACCTCACATGTTGTGGGTCTTTTACATAACAGTATCATGCCTAATTATCCTTCCTCTCTTTAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGTAAGGCAAACCGAGAACAGGGCAGAGGAACAGCATGACGTGCCCTGAATACTGATCCTTCCTGCGTCCTGCTCTGTGCTGTGCTTTTCCCCCCTAGCACTACGCACGTGCTGCATGGCGTTTCTCTCTATCCCTATCTACTCCTACCCTTTTGTCCTTTTTCTCCTCTAATGTGGGTTTTTGGATCAATGTGCCTATGGTGTGATAGGTGCAAATAATATAGCCTGTTGTCCCTTGGTACAATCATAGCATTCCCTTTGTCCATGTTTTAACATTCTGTGTCTGTCTACTGATATG
  5   1   3        nb Te6       in                          CABM683.5p                                                                                                                                                                                                                                                                                                 CCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTC
  3   1   2       add Brn2 5x   in                        CAAJ19791.3p                                                                                                                                                                                                                                                                                                                        TTTACATAACAGTATCATGCCTAATTATCCTTCCTCTCTTTAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  3   1   3        nb Te5       in                         CAAO7328.3p                                                                                                                                                                                                                                                                                                                                             AATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  3   1   2       add Brn3      out                       CAAK10691.3p                                                                                                                                                                                                                                                                                                                                               CATGATTTTGCTGTAGGTCCAGATAACTTCTTTAGTCAGGACTTTGCATTGATTGATGCTGCAGTATGCCAATCACAGGCTGCCGCATCATAGTCCCACTCCCTGATGTCACTAGCCGCCTTTTTCTTGAAGCTGTACCCACATAAATTAACACCTATTTAAAGGAACAGAACCCTAGAAATAAATCCAGCATGTGTATTGTTGTATTCCTGAGTGCCATAGGTACATGTTCCGTTCCTTCATTGCCCAAACTGACTATGTTCCTTCCCCCTGCAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  5   1   2       add Liv1      in                        CAAR11993.5p                                                                                                                                                                                                                                                                                                                                               CATGATTTTGCTGTAGGTCCAGATAACTTCTTTAGTCAGGACTTTGCATTGATTGATGCTGCAGTATGCCAATCACAGGCTGCCGCATCATAGTCCCACTCCCTGATGTCACTAGCCGCCTTTTTCTTGAAGCTGTACCCACATAAATTAACACCTATTTAAAGGAACAGAACCCTAGAAATAAATCCAGCATGTGTATTGTTGTATTCCTGAGTGCCATAGGTACATGTTCCGTTCCTTCATTGCCCAAACTGACTATGTTCCTTCCCCCTGCAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATGGTTTCCCAAAAAAAAAAAAAAAAA
  3   1   2       add Liv1      in                        CAAR11993.3p                                                                                                                                                                                                                                                                                                                                                CATGATTTTGCTGTAGGTCCAGATAACTCTTTAGTCAGGACTTTGCATTGATTGATGCTGCAGTATGCCAATCACAGGCTGCCGCATCATAGTCCCACTCCCTGATGTCACTAGCCGCCTTTTTCTTGAAGCTGTACCCACATAAATTAACACCTATTTAAAGGAACAGAACCCTAGAAATAAATCCAGCATGTGTATTGTTGTATTCCTGAGTGCCATAGGTACATGTTCCGTTCCTTCATTGCCCAAACTGACTATGTTCCTTCCCCCTGCAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  3   1   4      seed Ova1 5g3  in                         CABE4634.3p                                                                                                                                                                                                                                                                                                                                                  AGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  3   1   3        nb Te6       in                          CABM683.3p                                                                                                                                                                                                                                                                                                                                                  AGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  3   1   3        nb Ova1 5g3  in                         CABE1504.3p                                                                                                                                                                                                                                                                                                                                                          GAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTTTTCCC
  3   1   3        nb Te5  5g3  in                        CAAO11695.3p                                                                                                                                                                                                                                                                                                                                                                 GTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  3   1   2       ext TpA  5g3  in                    TTpA024o04.q1kT7                                                                                                                                                                                                                                                                                                                                                                      CAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTTTTCCCAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Spl2 5g3  in                        CBSS2910.rev                                                                                                                                                                                                                                                                                                                                                                       AAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  3   1   3        nb Te1  5g3  in                        CBWN12157.g1                                                                                                                                                                                                                                                                                                                                                                             TACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATATTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCCCAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTTGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAAAAAAAAAAAAAAA
  3   1   3        nb Limb 5g3  in                        CBSU2736.rev                                                                                                                                                                                                                                                                                                                                                                                                GCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  3   1   3        nb Thy1 5g3  in                        CBST1914.rev                                                                                                                                                                                                                                                                                                                                                                                                           GAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  5   1   3        nb Thy1      in                        CBST3637.fwd                                                                                                                                                                                                                                                                                                                                                                                                           GAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAANATATTANAATA
  3   1   3        nb Tail 5g3  in                         CBSW9069.g1                                                                                                                                                                                                                                                                                                                                                                                                             AGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATATTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAAAAAAAAAAAAAAA
  3   1   3        nb Thy1 5g3  in                         CBST738.rev                                                                                                                                                                                                                                                                                                                                                                                                                CCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAGT
  3   1   2       ext Spl2 5g3  in                        CBSS6591.rev                                                                                                                                                                                                                                                                                                                                                                                                                                  TACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  3   1   0       chi Te1       in                          CBWN978.g1                                                                                                                                                                                                                                                                                                                                                                                                                                     GAACTGGACTGAGCGTGGCTGGAAGTGTCTTTGGATTGGTGGAACCATCCATCTTGCCGCTGGCAACGCACCTGTTCAGTGTTTTGTGTTTCCATTCGTGCCTTCTGTCACATTGTCATGCACTGAGCACTCGTTCTTTAAGTAGCGGTGACTTTCTAACAACACTTGGGATTTCAGCCCTTTCTAATGTGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATATTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTTTTCCCAAAAAAAAAAAAAAA
  3   1   3        nb Thy1      in                        CBST3637.rev                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  3   1   3        nb Ovi1      out                       CABI11213.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAA
  3   1   3        nb Lun1      in                        CABD14658.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  5   1   3        nb Lun1      in                        CABD14658.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAAAAAAAAAAAAAAAAAA
  3   1   2       add Tad5 FL   in                         XZT34666.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAGGAGACCCAGACTGAAGACTGGGGAGGTTATTCAGATGATATCTTGTGAGAAGGACTAATCTGAAGGATTAGCCTCCCCGACCTACCTCCTAAAGTGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATATTAACAAAAAGGGAAATGAACATTTCAGCAAATCCCCGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAGTT
  3   1   2       ext Gas7 5g3  in                         XZG34808.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGACCATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCCCAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  3   1   2       ext Gas7 5g3  in                         XZG34962.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAGGAGGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAGTTTTAGTATTTTCCTCCCAGTGAACCAAAGTATGAATGTGAATCTCCTTAGAAGGTAGGAGGACATGTTTGGGAGCCCCCTCTTCTGCTAGGAACATAAATACTCCACTCTTCCTCTGCTGATTTCACATGTGAACCTCTTTGAACATCTCCACTCTTTCATTGTCTTCACCTTTTAGCTAGTCTACATTTTGACTTAAGCCGGCCATACACGCACCAATGATATCATACAAAACC
  5   1   3        nb TbA       out                  TTbA015o13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATCGGACTGACATCAACCTCCTCTCGCCTTACCACTGTCTGTTTGTTCGACATCAGTGTTCTCCCTGCCTTCATCTCGATGTTAAACTACTAATGTAAAATGCTGTCTGTCAGAATTACTGTACTGCTAAGCTGCGTGTTTTGGGTTCTCAGAGGGGAAAATC
  3   1   2       ext HeRe 5g3  in                     EC2CAA31CA08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTGTTAAACTACTAGTGTAAAATAAAAGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATATTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAA
  3   1   2       add Tbd1 5g3  in                          CBXT970.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGATACTGCCAGTGCACCCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCCAAAAAAAAAAAAAAA
  5   1   2  SIG                                     Xt7.1-CAAL18643.3                                                                                                               AGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCCCAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAA
                                                  Xt7.1-CHK-1008283294                                                                                                                     TGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCCCAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGT
  5   1   4   14 seed Brn4 5g3  in                        CAAL18643.5p ..............................................................................................................AGAGAGTGGGGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGACAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGCATCTGATGGCACAGCGCCCCCTAGATCTGATACT
  5   1   3   10   nb Eye  5g3  in                         CCAX2753.b1 .......................................................................................................................GGAATATGCTGGCCGGCCCGCTAGCCTATATTTAGTTCACCTTCACAGGAGCAAAGCCCGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACTGTGCTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCTAGCCTCTACTTCTGCTGTGCCATAGAAGACCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATC
  3   1   4      seed Brn4 5g3  in                        CAAL18643.3p                                                                                                                                                                                                                                                                                                                                                                                                                     ACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTTTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCACAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC
  3   1   3        nb Eye  5g3  in                         CCAX2753.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGTGTGCGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAAATTTTTGTTGGGAGGCGAAGTCCAGGAGACATCCAAGAAAAACGTGCTGAAAGCCATAGAACAGGCTGATCTTCTGCAGGAGGATGCTAAAGAAGCAGAGACGCCACGCAGCGTGCTGGAAGAAATCGGACTGACATAAACCTCCTCTCGCCTTACCACTGTCTCTTTGTTCGACATCAATGTTCTCACTGCCTTCATCTCAGTGTTAAACTACTAGTGTAAAATGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAGGGGAAAATCACTCCAGAACAATGTTAACAAAAAGGGAAATGAACATTTCAGCAAATCCACGGTGTGTTCCAAGAACATGTTCTCATTTGGTTTCAGATTGATAATGTGGAATCTGATGGCACAGCGCCCCCTAGTTCTGATACTGCCAGTGCACCAGAGCTGAAGTTCTTATTGGCCCCCAAGACAGGAAGCTGTCATTTGAACCCCATCTTGTATGGAGATGGATTTGTGAGGTGCTGCAGATCCCTCGGGCACATACAAATTAACTGTTGTTTTGGCAACCAAAGAGTAGTCGTTGGCTGTTAAGGATTTTCTTTTTTGTATTGAAATTTCTTTAAAATATTAAAATATTGTTTCCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)