Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012072701 Xt7.1-TTpA007g22.5 - 60 ESTs
                                                                       ..-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA007g22.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCTACTGTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAGAATCTC
                                                  Xt7.1-CHK-1008224998                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                          6     6    16    16    18    18    19    19    19    20    19    21    19    21    20    22    20    23    20    23    21    24    24    26    24    28    27    31    26    31    27    32    29    33    31    34    31    36    36    40    38    40    37    40    34    41    35    42    36    43    37    43    38    43    40    43    38    43    40    44    40    43    39    44    35    45    39    45    43    50    50    53    49    54    48    54    51    55    49    55    49    55    50    54    51    55    50    55    46    53    49    54    52    54    49    54    52    54    50    53    49    53    50    53    51    53    50    52    45    50    44    49    43    48    42    48    41    46    41    44    38    43    37    38    37    37    37    37    35    37    36    36    32    35    29    35    27    34    26    34    24    31    17    19    17    19    17    18    17    18     4     8
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------GA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     T--------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---G--------
                                               BLH ATG      85     484                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH MIN      85      69                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH OVR      85     104                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               CDS MIN      85      36                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               EST CLI       2      36                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               ORF LNG      85       2                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bf ---- 2e-010     ABD57444.1 Mesp [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 4e-010     NP_509367.1 Helix Loop Helix containing protein HLH-8 (20.5 kD) (hlh-8) [Caenorhabditiselegans] =========================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Cs ---- 2e-011     BAC81668.1 orphan basic helix-loop-helix factor NoTlc [Ciona savignyi] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Bb ---- 8e-013     AAD10038.1 twist protein [Branchiostoma belcheri] ---------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 1e-011     XP_001181880.1 PREDICTED: similar to Dermis expressed 1 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 8e-017     BAE06630.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 1e-019     NP_001014730.1 CG33557-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Dr ==== 7e-059     NP_571047.1 paraxis [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 7e-062     NP_033354.2 transcription factor 15 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Hs ==== 4e-062     NP_004600.2 basic helix-loop-helix transcription factor 15 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Gg ==== 6e-069     NP_990277.1 paraxis [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 4e-083     AAT44961.1 paraxis-like protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === ?? ==== 4e-083     NP_001087941.1 paraxis-like protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 1e-101     CAJ83180.1 transcription factor 15 (basic helix-loop-helix) [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA007g22.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGA------------------ATG---------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  0   1   1           TpA  FL                     TTpA007g22.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGATCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAGAAAAAAAAAAAAAAAAAA
  5   1   0       chi Met2 SNG                             CUNH1466.5p                                                                                                                                                            AGAGTGACAGGAGGAGAGAGGGCTGAGGGGGAATCGGAGAGAGTGACAGCAGGAGAGAGGGCTGAGGGGGAATCGGAGAGAGTGACAGTAGGAGAGAGGGCTGAGGGGGAATCGGAGAGAGGGCTGAGGGGGAATCGGAGAGAGTGACAGCAGGAGAGAGGGCTAAGGGGGAATTAGAGAGAGTGACAGCAGGAGAGGAGGGGAGCGCAGAGAGAGGAGTGTGTGGCTGTCTCTGGTCACTCTGTGGATAGAGCGCGGCTCAGTGACAGCTCCCAGGATGGTTCATAGAGACAGTCTGTACAGCAGCTAATAGCAGGCGAGAGTGAAGCCGAGAGACAGAGAGAGTTCCCAGCAGTTGGCACCCCCCCCCCCGGGCACCATGTCCTTTGCCATGCTGCGCCATGCCCCCCCGGCGCGGTTCCTGTACCCCGAGATCAGCATGCTGTCGGACGATGAGGACAGCGCCAGTGACAGCTCGGGCTGCGGGGACAAGTCTTTCCATCACTCGGGGGACAGACTGGGCAAAAGGGCAGACAAGAAGTGCCCCAGGCTTCACCGTGAACCCCGCCAGCGCCACACGGCCAACGCCCGCGAGCGAGACCGCACCAACAGCGTCAACACCGCCTTCACCGCCCTGCGCACCCTCATCCCCACCGAGCCGGCCGACCGCAAACTCTCCAAGATCGAGACCCTGCGCTTGGCCTCCAGCTACATCTCCCATCTGGGCAACGTGCTGCTTCTCGGGGACACGTGCGGGGACGGGCAGCCCTGCCACACCGGCGGCCCCTACTACCCACCCCACCCTGCCGCGGCTACGGCCAGCCCCAAGCA
  5   1   2       bld Gas8 5g3  in                         st100h14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCCGGCAGAAGGAGCTACTGTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCANAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTA
  5   1   2       bld Neu  5g3  in                   TNeu117m11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCGGCAGAAGGAGCTACTGTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAATGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGTGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTC
  5   1   2       bld Neu  5g3  in                   TNeu095p22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGCAGAAGGAGCTACTGTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATTCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGGGGTCAATTTCCATTTCCCACTTGGCCAACGTGCTGCTACTGGCGAGGGCTG
  5   1   2   14  bld Gas6 5g3  in                         ANBT1621.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCAGAAGGAGCTACTGTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAG
  5   1   2       bld Neu  5g                        TNeu138a16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGAAGGAGCTACTGTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTGTGGCTGCTATCAGAGCTCGCCCAAAAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCT
  5   1   2       bld TpA  5g3  in                   TTpA023j14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCTACTGTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGATCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGC
  5   1   2       bld Gas8 5g3  in                          st51f09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTACTGTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCANAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGA
  5   1   2       bld Neu  5g3  in                   TNeu124g03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTACTGTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGGCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCT
  5   1   2       bld Gas8 5g3  in                          st10o20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCANAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAAGNAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGC
  5   1   2       bld Gas8 5g3  in                           st9c09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCANAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACA
  5   1   2       bld Gas8 5g3  in                          st45f16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAATGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGTGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCANAGACAAGCGGCCAATGCCAGGGANAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACA
  5   1   2       bld Gas8 5g3  in                          st45g16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAATGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGTGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCANAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGT
  5   1   2       bld Gas8 5g3  in                          st64e24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCANAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGG
  5   1   2       bld Gas8 5x3                              st83c03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCANAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAANATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCANAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCC
  5   1   2       bld Gas8 5g3  in                          st97d14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAATGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGTGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCANAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAANATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAAACCGGGCATCTGTCGGGC
  5   1   2       bld Gas8 5g3  in                          st98d14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGGGGCAGCAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAATGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGTGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGANACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAANATCGANACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGGAGGAACCCCCAAATCTTTCCCACACAGAACCAAGTGCCAATGCTGCCCA
  5   1   2       bld Gas8 5g3  in                          st93f22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGGAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCANAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAANATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCANAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTTCGCACAGAGATGACCCCCGAGTATCGGGGA
  5   1   2       bld TpA  FL   in                   TTpA007g22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGATCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGNCACGAG
  5   1   2       bld Gas8 5g3  in                         st102p03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAATGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGTGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCANAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGA
  3   1   2       bld Neu  5g3  in                    TNeu124g03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGGGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAGAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu117m11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAATGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGTGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCCAGAGGAGGAAAGTGGGGGGGCCCGGGGGCGGCCTGGGGGGGGGGAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATTTGCACCTTTTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTTTGAGGGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAGAATCTCACTGGAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas8 5g3  in                          st11g01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATGGCCTTCGCCATGATCCGTTCGGTGCCAACGCACGTGATCTATCCGGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCANAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATT
  3   1   2       bld Gas8 5g3  in                          st64e24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATGATTCCGTTCGGTGCCAACGCACGTGATNTATCCGGACCTTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTANTGGGGGGCCATCAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATT
  3   1   2      seed Neu  5g3  in                    TNeu095p22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCCAACGCACGTGATCTATCCGGACCTTTCCATTCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAGAATCTC
  3   1   2       bld Gas8 5g3  in                          st45g16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCGGACCTTTCCATGCTNTCAGAGGATGAGGAGAACCAGAGTGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGGGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATT
  3   1   2       bld TpA  5g3  in                    TTpA023j14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGACCTTTCCATGCTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATTGCACCCAAAGGGTCAACACGGCCTTTACCGCCCTGGGCACTTTTATCCCCACCGAGCCGGTGGATCGCAAGCTGTTTAAGATCGAGATCCTGCGCCTGGGGTCCAGTTACATTTCCCACTTGGCCAACGTGCTGTTACTGGGGGAGGGCTGCCAGGATGGCCAACCGTGCTTTTTTACCGTTTATAGAGCCAAGGATTCCGACGGCAAAGTGCCCCGCAGCATTTGCACCTTTTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTTGGGGGGTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATTGGGGAGGAACCCCCAAATTTTTTCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGGGAAACCGGGCATTTTTTGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTTTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCANCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TpA                            TTpA007i24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGTCAGAGGATGAGGAGAACCGAAGCGATGATTGCGACCAATCGGTTGGCTGCTGTCATAGCTCGCCCAAGATGAGGAAAGTGGGTGGCACGGGGGGCACTGGGGGGGGGCATCCGGTGGTGAAGCATATACTAGCGGCCCATGCCACGGAGAGAGATCGCACCCGTAGCGTCAACACGGCCTTCACCGCGCTGCGCAGTCTCATCCCCGCCGAGCCGGTGGATCGCGAGCTGTCTAATATCGAGATCCTGCGCCTGGCGGCCAGTGACATCTCCCACTTGGGCGACGTAGCTGCTGACTGAGGCGAGGGCTGCCAGGATGGCCAGCCGTGCTTCTCTACCGTGTATGGAGCCCAGGACTCCGACGGCAAAGTGCCCCGCAACATCTGCACGTTCTGCCTCGGCAACCAAATGAAGGGGGCCACGCACAGGCAGCATGCTGGGGACTGCCTGATAGTTCAGGGGCTGAACACTTTGCGGGTCGCACAGATATGACCCCCGAGTATCGGGTAGGAACCCCCAAATCTTTCCCACACATACCAAGTGCCAATGCTGCCCAGGGACTGGCAGGGCGAAGCCGGGCATCTGTCGGGCACAGATTGGGCT
  3   1   2       bld Gas8 5g3  in                          st10o20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATT
  3   1   2       bld Gas8 5g3  in                           st9c09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGTCAGAGGATGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACCAGGGACTTCGGGGTCACTGACCCCACAGCACTGAACTGTT
  3   1   2       bld Gas8 5g3  in                          st97d14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATGAGGAGAACCAGAGTGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGGGCTGGGCTTCCTACTGGGGGGCCATCAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTA
  3   1   2       bld Gas8 5g3  in                          st11g01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGGAGAACCAGAGCGATGATTCCGACCAATCGTTTNGGCTGCTATCAGAGCTCGNCCAAGAGGAGNAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGNCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCNTGCGCNTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTNCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTNTGCNTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCNTTCTGAGAGCTGGGCTTCCTACCTGGGGGGCCACAGGGACTCGGGGTCAACTGACCCCACAGCACTGACTGTTTCAGCGTAAATATT
  5   1   2       bld Neu5      in                          ANHP151.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCGATGATTCCGACCAATCGTTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAGAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8 5g3  in                          st51f09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGGCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATT
  3   1   2       bld Gas8      out                         st35g11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTGCTATCAGAGCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATT
  5   1   2       bld Gas8      in                          st94c06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTCGCCCAAGAGGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAANATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCANAGAGCATGCTGGGAACTGCCTGANAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGAC
  5   1   2       chi Gas8                                   st2k17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGCAGCAGGAAGAACTAAATGCCCCACTGGAGCTGATTGGGGAAAGTGGGGGTGAGTTTGGGTCAGGACCAGTATGGCCTTCGCCATGATCCGTTCGGTGCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAGAATCTCAAA
  3   1   2       bld Gas8 5g3  in                          st93f22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAAGTGGGGGGNCACGGGGGGCNCTGGGGGGGGGCAGNCCGGTGGTGAAGCAGAGACAAGCGGGCCAATGCCAGGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTNTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATT
  3   1   2       bld Gas8 5g3  in                          st45f16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGGGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACCAGCACTGACTGTTTCACGTAAATATT
  3   1   2       bld Neu5      in                          ANHP151.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAG
  3   1   2       bld Gas8 5g3  in                         st102p03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAGTGGGGGGCACGGGGGGCACTGGGGGGGGGCAGCCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGGGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATT
  3   1   2       bld Gas6 5g3  in                         ANBT1621.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGTGGTGAAGCAGAGACAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATTTGCACCTTTTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTTTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAGAATCTCACTGGG
  3   1   2       bld Panc      in                         CBTA930.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCAACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGGGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACG
  5   1   2       bld Panc      in                         CBTA930.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAAGCGGCCAATGCCAGGGAGAGAGATCGCACCCAAAGCGTCACACGGCCTTCACCGCCCTGCGCACTCTCATCCCCACCGAGCCGGTGGATCGCAAGCTGTCTAAGATCGAGACCCTGCGCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGGGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACG
  3   1   2       bld TpA  FL   in                    TTpA007g22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGCAAGCTGTCTAAGATCGAGATCCTGCGCCTGGCGTCCAGTTACATCTCCCCACCTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCCNAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGNGGCCACACGCAGAGNAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       out                   TTbA025b14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCCTGGCGTCCAGTTACATTTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGATTCCGACGGCAAAGTGCCCCGCAGCATTTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAGAAAAAAAAAAAAAAA
  3   1   2       bld Gas8      in                         st100n23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCT
  3   1   2       bld Gas8      in                          st97n23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCTGGCGTCCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCANTGACCCCACAGCACTGAACTGTT
  3   1   0       add Gas8      in                          st99n23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCTGGCGTCCAGTTACATNTCCCANTTGGCCAACGTGNTGNTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTNTATAGAGCCAAGNNNTCCGACGGCAAAGTNCNGNGCAGCAT
  5   1   2       bld Gas8      in                         st105n23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTCAGTTACATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATA
  3   1   2       bld Gas8 5g3  in                          st98d14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCCAGTTACATNTCCCACTTGGCCAACNTGCTGNTANTGGNCGAGGGNTGCCAGGATGNCCANCCGTGNTTCTTTACNGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCNCAGCATCTGCACNTTNTGCNTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCATGAGAGTTCGGGGNCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTNCCACACAGANCAAGTGCCNATGCTGCCCAGGGCNTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGGGCTGGGCTTCNTANTGGGGGGCCATCAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATT
  5   1   2       bld Gas8      in                         st100n23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCANCGAGAAAAAAAAAA
  5   1   2       bld Gas8      in                          st97n23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAGAAAAAAAAAA
  5   1   2       bld Gas8                                  st98n23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAGAAAAAAAAAA
  5   1   2       bld Gas8                                 st108n23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTCCCACTTGGCCAACGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTAC
  5   1   2       bld Gas8      in                          st99n23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGTGCTGCTACTGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCGCAGCATCTGCACCTTCTGCCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTAAATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAGAAAAAAAAA
  5   1   2       bld Gas8                                 st112n23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGGCGAGGGCTGCCAGGATGGCCAACCGTGCTTCTCTACCGTCTATAGAGCCAAGGACTCCGACGGCAAANTGCCCCGCAGCATCTGCACCTTCTGCCTCAGNAACCAAAGGAAGGGGGCCACACGCAGANAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTGCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCANGGCCTGGCAGGGCGAAACCGGNCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCATGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACTCGGGGTCACTGACCCCACAGCACTGACTGTTTCACGTANATATTTGTACAGTAGGCAAAGGGTTAATTAAAGTGTCACTCGTGCAACGAG
  3   1   2       bld Gas8      in                          st94c06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGNTNCCAGGATGGCCANCCGTGCTTTTTTACCGTNTATAGAGCCAAGGACTCCGACGGCAAAGTGCCCCNCAGCATGTGCACNTTCTGCTTCAGCANNCAAAGGAAGGGGNCCACNCGCAGAGAGCATGCTNNGANCTGCNTGAGAGTTNGGGGGCTGAACTCTTTGCGGGTCGCACAGAGATGACCNCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTNCCAATGCTGCCCAGGGCCTGGCAGGGCGAAACCGGGCATNTGTCGGGCACAGATTGGNCTCAGGATGGACCCCCCCCATGTATATTCNTTCTGAGAGCTGGGCTTCCTATCTGGGGGGCCACCAGGGACTCGGGGTCACTGACCCCACAGCAACTGACTGTTTCACGTAAATA
  3   1   2       bld Gas8      in                         st105n23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCAAAGTGCCNCNCAGCATTTGCACNTTNTGNCTCAGCAACCAAAGGAAGGGGNCCNCNCGCAGAGAGCATGNTGGGAACTGCCTGAGAGTTNGGGGNCTGAACNCTTTNCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGANCCCCCAAATCTTTCCCACNCAGACCAAGTGCCAATGNTNCCCAGGGCC
  3   1   2       bld Gas8 5g3  in                         st100h14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTCAGCAACCAAAGGAAGGGGGCCACACGCAGAGAGCATGCTGGGAACTGCCTGAGAGTTCGGGGGCTGAACACTTTNCGGGTCGCACAGAGATGACCCCCGAGTATCGGGGAGGAACCCCCAAATCTTTCCCACACAGACCAAGTGCCAATGCTGCCCAGGNCNTGGCAGGGCGAAACCGGGCATCTGTCGGGCACAGATTGGGCTCAGGATGGACCCCCCCCANGTATATTCCTTCTGAGAGCTGGGCTTCCTACTGGGGGGCCACAGGGACT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)