Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas138g17.3                         27 END     1           1        4                ceroid-lipofuscinosis, neuronal 5 [Xenopus tropicalis]
     2   2.0    0Xt7.1-TNeu092f08.3                         16 END     2           2       12                (no blast hit)
     3   2.0    0Xt7.1-CAAN1164.3                            8 END     2           2       25                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4 311.0    0Xt7.1-CAAN1164.3                            8 PI      95       2802     2988                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012072773 Xt7.1-TGas081e14.3 - 87 ESTs
                                                                       .........-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas081e14.3                                                                                                                        GGCGCAGGAGCAAATCGCTGGCTTGTTTTTCCGCCCTCTGAAGTGTTTTGTTTCCGTCGGCCGCGGCTTCATTTCCGTCGTGTGTGAGGCCGGGGGTGTTTGAAAGAAGAAAGTGCAGGGAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAGATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACAGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTGAAAAAAAAAAAAAAAAAAAATAAAGGGTTTTTTTATGCCATTTCAAGTGACCTGTTCTCCCTTGCCTTTGTGTGCATATTTACATTTTTTTTTTTTTAACCAAACAAGTTTATCTTATTGCTTTTATTAAATGTTTTGTCATTCAAATCTTTCTTTTGTTCAGAGGGCATCAAGATAGATTATATATTATTGTTTTCATTGGCATAATGTGTTGCTAGGTCTGCCATCTTCAAATCATTAGTGGGCACAGAAAATCTGTGATTTTGCAGGTGTTTTTTTTTGTTTGTTTTTTAATGTGTCTACCTTTGCCTAACGCTGTATAGCTCTATGGTATATCAGAAAATGTACCATAGTGCACAATGGTGTTCCAGGATGTGGCAAGGATCCCTGGAACTTGGGTCAAGGTGGTGGCATGGTGTTCCTGGCCTAGTGTAAAACATCAGTGCCACTAGGTGTTTATACAGTGTCAGAATGAAGTATATAAATAGGAGAGTCATATTCACTGCAGTGGGATACCACCAGTG
                                                  Xt7.1-CHK-1008223666                                                                                                                              GGAGCAAATCGCTGGCTTGTTTTTCCGCCCTCTGAAGTGTTTTGTTTCCGTCGGCCGCGGCTTCATTTCCGTCGTGTGTGAGGCCGGGGGTGTTTGAAAGAAGAAAGTGCAGGGAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAGATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACAGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTxxxAAAAAAAAAAAAxxxxxxTAAAGGGTTTTTTTATGCCATTTCAAGTGACCTGTTCTCCCTTGCCTTTGTGTGCATATTTACATTTTTTTTTTTTTAACCAAACAAGTTTATCTTATTGCTTTTATTAAATGTTTTGTCATTCAAATCTTTCTTTTGTTCAGAGGGCATCAAGATAGATTATATATTATTGTTTTCATTGGCATAATGTGTTGCTAGGTCTGCCATCTTCAAATCATTAGTGGGCACAGAAAATCTGTGATTTTGCAGGTGTTTTTTTTTGTTTGTTTTTTAATGTGTCTACCTTTGCCTAACGCTGTATAGCTCTATGGTATATCAGAAAATGTACCATAGTGCACAATGGTGTTCCAGGATGTGGCAAGGATCCCTGGAACTTGGGTCAAGGTGGTGGCATGGTGTTCCTGGCCTAGTGTAAAACATCAGTGCCACTAGGTGTTTATACAGTGTCAGAATGAAGTATATAAATAGGAGAGTCATATTCACTGCAGTGGGATACCA
                                                      consensus depths                                                                                                                             2     2     3     3     3     3     3     3     4     4     6     6     8     8    10    10    10    11    10    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    13    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    15    15    15    15    15    15    15    15    17    18    18    18    18    18    18    18    18    18    18    18    19    19    19    19    19    19    21    21    21    21    21    21    21    21    22    22    22    22    22    22    22    22    22    22    22    23    23    24    23    24    23    24    23    24    23    24    23    24    22    24    23    25    24    26    24    27    25    27    24    26    24    26    23    24    23    24    23    24    19    20    19    21    20    21    20    21    17    19    18    19    18    19    18    19    20    21    20    22    19    22    20    22    19    22    20    23    20    23    20    23    20    22    20    22    22    23    22    23    22    23    22    23    18    19    18    19    18    19    18    20    21    22    21    22    21    22    21    22    21    22    21    22    21    22    21    22    20    21    23    25    24    25    24    25    24    25    24    25    23    24    23    24    23    24    23    24    23    24    22    23    20    21    20    21    20    21    20    20    20    20    20    20    18    19    18    19    18    19    17    19    18    19    18    19    17    18    17    18    17    18    17    18    18    19    18    19    18    19    18    19    16    20    19    21    19    21    20    22    19    22    20    22    23    24    20    22    22    23    23    23    24    25    27    28    25    27    27    29    27    30    25    30    26    29    27    30    27    30    29    32    30    33    32    35    32    35    33    38    34    38    36    37    38    38    38    38    37    37    37    37    37    38    38    38    38    38    37    38    38    38    34    38    37    38    39    40    40    40    39    40    39    39    38    38    37    38    38    38    36    38    35    38    36    37    35    36    35    36    35    36    35    36    35    36    35    36    35    36    34    36    34    36    32    36    30    35    30    35    30    35    30    34    30    34    30    34    30    34    30    34    30    34    29    33    29    33    30    33    29    32    29    32    29    32    28    31    23    29     6    23     5     9     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTTGCCTAAGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---TG-------
                                               BLH ATG     163    1525                                                                                                                        
                                               BLH MIN     106     224                                                                                                                        
                                               BLH OVR     163     911                                                                                                                        
                                               ORF LNG     163      88                                                                                                                        
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Bb ==== 1e-022     BAE46385.1 Ets1/2 [Branchiostoma belcheri] ==============================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 6e-028     NP_508865.1 friend leukemia integration 1 like (XF694) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 1e-040     AAI35690.1 Unknown (protein for MGC:121593) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 1e-071     NP_524523.2 Ets at 97D CG6338-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 1e-076     BAE06470.1 GA repeat binding protein alpha homolog [Ciona intestinalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 4e-103     XP_001178496.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dr ==== 0          NP_571662.1 E4tf1-60 transcription factor [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 0          NP_032091.2 GA repeat binding protein, alpha [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 0          NP_002031.2 GA binding protein transcription factor, alpha subunit (60kD); GA-bindingprotein transcription factor, alpha subunit (60kD); human nuclear respiratoryfactor-2 subunit alpha [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Gg ==== 0          NP_001007859.1 GA binding protein transcription factor, alpha subunit [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          AAH77619.1 Gabpa-prov protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === ?? ==== 0          NP_001086894.1 GA binding protein transcription factor, alpha subunit 60kDa [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas081e14.3                                                                                                                                                                                                                            TGA------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------ATG---------------------------------------------TAA------------------------------------------------------------ATG------TGA---------------------------------------------------------------------------------------TAA---------TAA---------------------------------------------------ATG------ATG---------------------------------------------------------------------TAA------------TGA---TAA------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------TGA---------TGA---------------------------------------------------------------------------------------------------TGA------------------------------------TAG------------------TAGTAA---ATG------------------------------------------------------------ATG------------------------------------------------------------TGA------------------------TGA------------------------TGAATG------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------TAA---------------------------------------------------TGA------------------------------TAA---------------------------------ATG------------ATG---------------------------ATG---------------------------------------------------------TAA------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  0   1   1           Neu  FL                     TNeu017n04.FL-Sanger                                                                                                                                                                                                                           TTGAAAGAAGAAAGTGCAGGGAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAAATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACAGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACACCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGTTTTTTTTTTACATTTTTGCAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTGCCTAAGCCTCATTTCCTTTTAAAGGGTTTTTTTATGCCATTTCAAGTGACCTGTTCTCCCTTGCCTTTGTGTGCATATTTACATTTTTTTTTTTTTTTAACCAAACAAGTTTATCTTATTGCTTTTATTAAATGTTTTGTCATTCAAATCTTTCTTTTGTTCAGAGGGCATCAAGATAGATTATATATTATTGTTTTCATTGGCATAATGTGTTGCTAGGTCTGCCATCTTCAAATCATTAGTGGGCACAGAAAATCTGTGATTTTGCAGGTGTTTTTTTTGTTTGTTTTTTAATGTGTCTACCTTTGCCTACCGCTGTATAGCTCTATGGTATATCAGAAAATGTACCATAGTGCACAATGGTGTTCCAAGATGTGGCAAAAATCCCTGGAACTTAGGTCAAGATGGTGGCATGGTGTTCCTGGCCTAATGTAAAACATCAGTGCCACTAGGTGTTTATACAGTGTCAGAATGAAGTATATAAATAGGAGAGTCATATTCACTGCAGTGGGATACCACCAGTGAATAAAATAGCTGACTTTTTACATTAGGCCAGGAGCACCGTGCCACCCTATTGACTCAATTTCGAGGGATATTTGGCACATCTTGGCAGACTATTGTGCAGTTAGCTGCAGATTTGATTAAATAATTGTCTCTCTAGAGACAGATCGTACTGGTGTAGGTATTACAGTTTTGCTATTGTCAACCTGGCCTTAAACCTTTGATTTGCCACCTTGGGTATATGTATGTATGTGTTTTTTCTATTTATATAGTGCTTCTTGTGTACCAGCACTGTATATCCACTGCCAGATAATTTAGCAGGCAAATCTCACTGTTCCTCCTAATACCTGTGCAAGCTTTTAGACTTTTGCCTTTAGTATTGTATTTAGTGGACTGTATGAACTCACTTGCCTTGATGAATTTAACATGGTCCAGTTCATATGTCATTGTAAAGGAAAATTCTTATCCAACTAAGCGGTGATTCTGATGAGAGGTCAGACTAACCCTCTACACTGATTTATGTTAAATTGCTCGCAGGGCTTTTCCGAGCACTTGCAGTTTATCATCTTTTTCTTTTTGTAGTTGTCAAGATATTAGTTTGTTACACTGCTGATATAATGAATTTAAAACAACAGCGCCACCTACTGTTTATATCAGATGGCTTGAGATAATAGGTAAGAAATGATAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG28255.5p                                                                                                              GGTTTCCGGTGGCGCAGGAGCAAATCGCTGGCTTGTTTTTCCGCCCTCTGAAGTGTTTTGTTTCCGTCGGCCGCGGCTTCATTTCCGTCGTGTGTGAGGCCGGGGGTGTTTGAAAGAAGAAAGTGCAGGGAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAGATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTCCAGTG
  5   1   2   22  bld Gas7 5g                              XZG60303.5p .......................................................................................................................GGCGCAGGAGCAAATCGCTGGCTTGTTTTTCCGCCCTCTGAAGTGTTTTGTTTCCGTCGGCCGCGGCTTCATTTCCGTCGTGTGTGAGGCCGGGGGTGTTTGAAAGAAGAAAGTGCAGGGAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAAATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTNGCACCT
  5   1   2   20  bld Te1  5g                             CBWN17943.b1 ...........................................................................................................................CAGGAGCAAATCGCTGGCTTGTTTTTCCGCCCTCTGAAGTGTTTTGTTTCCGTCGGCCGCGGCTTCATTTCCGTCGTGTGTGAGGCCGGGGGTGTTTGAAAGAAGAAAGTGCAGGGAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAAATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTT
  5   1   2   10  bld Te1  5g3  in                         CBWN2723.b1 ............................................................................................................................................................CTGAAGTGTTTTGTTTCCGTCGGCCGCGGCTTCATTTCCGTCGTGTGTGAGGCCGGGGGTGTTTGAAAGAAGAAAGTGCAGGGAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAAATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTG
  5   1   2   12  bld Gas7 PIPE in                         XZG19925.5p .................................................................................................................................................................................GGCCGCGGCTTCATTTCCGTCGTGTGTGAGGCCGGGGGTGTTTGAAAGAAGAAAGTGCAGGGAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAAATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCCCTTCAGGGGCCTGTTGATCCAG
  5   1   2       bld Te1       in                        CBWN10402.b1                                                                                                                                                                                  GGCCGCGGCTTCATTTCCGTCGTGTGTGAGGCCGGGGGTGTTTGAAAGAAGAAAGTGCAGGGAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAAATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCT
  5   1   2   20  bld Spl2 5g                             CBSS8499.fwd ..............................................................................................................................................................................................TTTCCGTCGTGTGTGAGGCCGGGGGTGTTTGAAAGAAGAAAGTGCAGGGAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAGATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGAC
  3  -1   2       bld Lun1      in                        CABD10307.3p                                                                                                                                                                                                TTCCGTCGTGTGTGAGGCCGGGGGTGTTTGAAAGAAGAAAGTGCAGGGAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAGATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGNCACCTTAACCAAGAAGATTTCTTCCAAAGAGCCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACAT
  5   1   2       bld TbA  5g3  out                  TTbA045i03.p1kSP6                                                                                                                                                                                                  CCGTCGTGTGTGAGGCCGGGGGTGTTTGAATTAAGAAAGTGCAGGGAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAGATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGANATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCT
  5   1   2       bld Gas7      in                         XZG26725.5p                                                                                                                                                                                                         GTGTGAGGCCGGGGGTGTTTGAAAGAAGAAAGTGCAGGGAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGATTTCAGTGTTCGCTAGATGCACATGAGATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGNGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGANATAAATGTGAACTCCCTCGGTANTACAGGAAGAGAACTC
  5   1   2       bld Gas  5g                        TGas024o01.p1kSP6                                                                                                                                                                                                               CCGGGGGTGTTTGAAAGAAGAAAGTGCAGGGNAAAAAAANAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCANCCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAGATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTG
  5   1   2       bld Neu  FL                        TNeu017n04.p1kSP6                                                                                                                                                                                                                             AAAGAAGAAAGTGCAGGGNAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAAATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTANGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTG
  5   1   2       bld HdA  5g3  in                   THdA012d12.p1kSP6                                                                                                                                                                                                                                              GGAAAAAGAGAGCACGAAGCGAGAACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATCGATGGCACAGAGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAAATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGA
  5   1   2       bld Gas       in                   TGas113m04.p1kSP6                                                                                                                                                                                                                                                                                                                                        TCCCCGGGGAAGACTGAATGCACCGAAGAAAGTATTATAGAACACACGTATAGCACAGCAGAGTTTATAAGTCAGTCTATCGACATTAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAGATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTG
  3   1   2       bld Gas7      in                         XZG28255.3p                                                                                                                                                                                                                                                                                                                                                                                                  CAGAGTTTATAAGTCAGTCTATCGACATAAATGAGCCAGTTGGCAATCTCAAGAAACTGCTAGAGCCAAGACTTCAGTGTTCGCTAGATGCACATGAGATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACCGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAAAAAAAAAAAAGG
  5   1   2       bld Gas                            TGas133f13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAGATGCACATGAGATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACCGTTACCATTGATCAGCCTGTAC
  5   1   2       bld Te1       in                         CBWN1224.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGAAATATGCCTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACAGTTACCATTGATCAGCCTGTACAGATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAAAAAAAAAAAA
  3   1   2       bld Te1       in                         CBWN1224.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGAAATATGCGTACAAGATATACAGCTCGATCCTGACCGTAGTTTATTTGACCAAGGAGTAAAGACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACAGTTACCATTGATCAGCCTGTACAGATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAAAAAAAAAAAA
  5   1   2       bld Lun1      out                        CABD6818.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCGATGGATCAGTACAGCTCAGTGTTCAGGTTATCTCTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACCGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCA
  3   1   2       bld Te1       in                        CBWN10402.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCAGCAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACAGTTACCATTGATCAGCCTGTACAGATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1      in                         CBXT3094.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATAAGGGCTTGAGCCAAAACTCAACATCCTGGAAATTGTGAAGCCTGTGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACAGTTACCATTGATCAGCCTGTACAGATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACA
  5   1   2       bld Gas                            TGas040g18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGAGACCGTAGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTGGAAGCCGAACTTGTGGAGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACAGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGAC
  5   1   2       bld Gas       in                   TGas081e14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACCGTTACCATTGATCAGCGTAAGACAACGTCTTTGCATTTTTACTAGCAGTTGAACTCTTACATAACCTAATTTCCTGATAGTACTTACTGTGTGCAACTGTTGTTGTAATGTAGAAATTTTTGGCTTATATTTAAAAGGGAAACTGTTAATGAAAACTTATTTATTATTTAATTGCTTTTGTAGCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGA
  5   1   2       bld TbA                           TTbA006g10.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGAGGCACAAGTGATAACTCTGGATGGGTCAAAACATATAACAACGATGTCCGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACAGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTG
  5   1   2       bld TbA                            TTbA068c17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCACTGGAAGGCTACAGGAAGGAGCAAGAATGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACAGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGC
  5   1   2       bld Gas7      in                         XZG38387.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCACTGGAAGGCTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACAGTTACCATTGATCAGCCTGTACAGATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGACTCTGCAGAAACTCA
  3   1   2       bld Gas7      in                         XZG26725.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTACAGGAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACCGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTGCCTAAGCCTC
  5   1   2       bld Egg                            TEgg091a13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACGCTTAGGCATTCCATATGATCCACTTCAGTGGTCTGTTGATCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACAGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCA
  5   1   2       chi Gas       in                   TGas081e16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCAGGTTCTTCATTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACCGTTACCATTGATCAGCGTAAGACAACGTCTTTGCATTTTTACTAGCAGTTGAACTCTTACATAACCTAATTTCCTGATAGTACTTACTGTGTGCAACTGTTGTTGTAATGTAGAAATTTTTGGCTTATATTTAAAAGGGAAACTGTTAATGAAAACTTATTTATTATTTAATTGCTTTTGTAGCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGATTGCTCACTGA
  5   1   2       bld TpA       in                   TTpA065m09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGTGGGTGCTTTGGGTAATGAAAGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACAGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAA
  5   1   2       bld Ova1      in                        CABE10928.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCGATTCGCTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACCGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTT
  5   1   2       bld Ova1      in                        CABE11657.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACTCTGCAACCTTAACCAAGCAAGATTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACCGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCANGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAAGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCCGGGTACACGTTTGTTTACAGTGGCCCCTCA
  3   1   2       bld Gas       in                    TGas061g14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACCGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAACAAAAACTGAATAATACATTTTACCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas       in                   TGas061g14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACCGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAGATGCAATTACAT
  5   1   2       bld Gas       in                   TGas106n03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTGTGGAGTCATTTGGAGCTTCTTAGGAATATGTTTTGGCAAGCCAGGAACATGGAGGTGAAATTGCGACAGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAG
  5   1   2       bld Gas7      in                         XZG44167.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGGCCAGGAACATGGAGGTGAAATTGCGACCGTTACCGTTGATCAGCCTGTACAAATTATACCAGCATCAATCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCACAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTATTTTTTTCGACAGAGGACTT
  5   1   2       bld Te4       out                        CAAN1164.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAACATGGAGGTGAAATTGCGACCGTTACCATTGATCAGCCTGTACAAATTATACCAGCATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTTCCACATGAACTTAATGAACT
  5   1   2       chi Egg       ?                    TEgg015o02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCAATCCAACCAACAGCACAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACAGAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCTCCCAACAGTATCAATTAATTAAAAAAAAACAAAAAACTTATTTAACAAGATACAGCATTCCCTCAAATGTTTCATTTTATTTGCTTCTGTGAACACTACTTTTAAAAATAGGTAAAGCTAAAGTACAGCTTTTAGCATGAATTAAGGGTTCCCAATGC
  5   1   2       bld Neu       in                   TNeu114o03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGACAGAATTACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTT
  5   1   2       bld Gas7      in                         XZG21937.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGTTCACCGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTTGGCTCTTT
  5   1   2       bld Ova1      in                        CABE11717.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGAGGGGGAAACAGAACGGGAAACAATGGTCAGATTCAACTATGGCAGTTTCTTTTAGAATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGA
  3   1   2       bld Te1  5g3  in                         CBWN2723.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATTGCTCACTGACAAAGATGCTAGAGACTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG19836.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGTATTTCATGGGTTGGTGACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTACTGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTA
  3  -1   2       bld Gas5                                  XZF2147.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGCAGCGGAGATTCAAACTGAACCAACCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTACAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCANATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATG
  5   1   2       bld TpA                            TTpA030p05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACACCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCT
  5   1   2       bld Gas                            TGas135f02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCACCAAACTGAGTCGGTTGGTGGCAGAATGTGAACAACAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACT
  5   1   2       bld Tbd1      in                        CBXT15973.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAAGGAGAATTCAAACTGAACCAGCCAGAACTGGTGGCACAAAAATGGGGACAGCGAAAAAACAAACCCACCATGAATTATGAGAAACTTAGCCGTGCTTTACGGTATTACTATGATGGCGACATGATCTGTAAAGTTCAAGGCAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTGAAGACCCTCATTGGCTACAGTGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAAGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCTCTCATTCAGAAGCATGGCATATTTTCCACATGAACTTAATGACT
  5   1   2       bld Gas                            TGas031k03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAACAAAAGAAAATGGCAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACACCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGGTCAGAGCTACTATCTGTCTGAGCAGTTGTCTG
  5   1   2       bld Ova1      in                         CABE6068.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAGATGCAATTACATGGCATTGGGCAGCCTATGACTGCGGTGGCACTAGCTACTGCTTCACTTCAGACAGAAAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGAAATTGTGAGCTAGAATTGA
  3   1   2      seed Gas       in                    TGas081e14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAGAATAATTTGGCTCTGCAGAAACTCAAACTGATACTTTCCATCTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas081e16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGAAACTCAAACTGATACTTTCCATCTGTACATGNCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas                            TGas019h04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGTACATTGCAGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTNTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGC
  3   1   2       bld Gas       in                    TGas113m04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACATGCAGGGATCCTCATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTGGAATTTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTGAAAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Lun1      in                        CABD10307.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATTTATGGGATTCTGATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCNCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTAAAAAAAAA
  3   1   2       bld Ova1      in                        CABE11657.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTGGAAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTGCGTAAGCCTC
  3   1   2       bld Ova1      in                        CABE11717.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGCATTTTTACTTTCAGACCTCACAGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAA
  3   1   2       bld Neu       in                    TNeu114o03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTATAAGGCATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACACCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGTTTTTTTTTTACATTTTTGCAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                        CABE10928.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATGATTTTGTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGGG
  5   1   2       bld Gas7      in                         XZG42297.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGATTTTGTTTTTTTCGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACACCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGTTTTTTTTTTACATTTTTG
  3   1   2       bld HdA  5g3  in                    THdA012d12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTTTGTTTTTTTTGACAGAGGACTTGGAATTCAGTACACTTGGATCTTGTAATTTTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATTTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTTTTTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACACCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGGTACTATCTGTTTGAGCAGTTGTTTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTTTGTTTTTTTTTTACATTTTTGCAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAAAGGGCAGTAAAAATAAACTGCTTCAATATGTGAAAAAAAAAAAAAAAAAAGCGG
  5   1   2       bld Gas7      in                          XZG5124.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGACTTGGATTCAGTAACTTGGATCTTGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTTGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTGCCTAAAGAANAAATAGAAAT
  3   1   2       bld Ova1      in                         CABE6068.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGGTAATTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAATTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTT
  3   1   2       bld Tbd1      in                         CBXT3094.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCTTCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATAATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACACCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTATTATCTGTTTGAGCAGTTGTTTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGTTTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTGAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG44167.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTGAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7 PIPE in                         XZG19925.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTG
  3   1   2       bld Gas7      in                         XZG38387.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGTAACACGTTTGTTTACAGTGGCCCCTCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGCTATGCGGCAAGCTATGGCTGTCTTTCTGACTACCATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGTTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTG
  3   1   2       bld Gas7      in                         XZG19836.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCATTCAAGAAGCATGGCATATTTTCCACATGAACTTACTGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTG
  3   1   2       bld Gas7      in                          XZG5124.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCATTCAAGAAGCATGGCATATTTTCCACATGAACTTAATGAACTTGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTGCCTAAGGAAAA
  5   1   2       bld Gas7      in                         XZG65096.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGCATGGCATATTTTCCACATGAACTTAATGAACTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGCTATGCGGCAAGCTATGGCTGTCTTTCTGACTACCATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGTTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTTACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTNCATATGTAAAAAANAAAAAAAAAA
  5   1   2       bld Mus1      in                         CABH6904.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCAATTCGGCCGAGGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7                                 XZG64595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCGGCTCTTTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACACCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGTTTTTTTTTTACATTTTTGCAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTGCCTAAGCCTC
  3   1   2       bld Gas7      in                         XZG21937.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGTAGTGAGGTTAAGCCTTCTGTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAAT
  3   1   2       bld Mus1      in                         CABH6904.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCTTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGT
  3   1   2       bld Tbd1      in                        CBXT15973.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTCTTTTCCACCATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTGAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas106n03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATAAAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACACCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGTTTTTTTTTTACATTTTTGCAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA065m09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAATCATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATTTATGTTTTAAATACGGAAGTGTTTTTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTTTTTTTGACTAACATTGTGTCCATCAGTGGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTATTTGGCCTCAGGTCAGAGGCTACTATCTGTTTGAGCAGTTGTTTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGTTTTTTTTTTACATTTTTGCAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe      in                      EC2CAA1BH06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACACCTAGTACAGTAGAGCACACCTTTACTTGGCCCCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGC
  5   1   2       bld HeRe      in                      EC2CAA1BH06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTCCATCTTCATTAAGAAAGCCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCATATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCATTCTAACCAATGACCTACATTGTGAGCTAGAATTGAATGCACACACCTAGTACAGGAGAGCACACCTTTACTTGGCCCCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTCTGATCCCTGAATATTTGGACTATCTGCTTACT
  3   1   2       bld Gas  FLt5 ?                     TGas138f20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTTCCTGATCCTAAAGGGTCCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACNTGCTTCAATATGTTGCCTAAGCCTCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas       out                  TGas138d18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCCTTTCCTGATCCTAGGGTCCATGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTCTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAAAAGGCAGAACCAACAGGGCACGTTTTAGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACT
  5   1   2       bld Gas                            TGas008p06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTTTCCTGNTCCTAAAGGTCCCTGGGGTTTATTTTGTGCTTTATTAATTAGCATACTGCAGNATACGGATTCCCCATTTGGCAAATATCTATGTTTTAAATACGGNAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCTGTTTCTCTGACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATTGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAAT
  3   1   2       bld Gas7      in                         XZG65096.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTATTTTGTGCTTTATTAATTAGCATACTGCAGAATACGGATTCCCCATTTGGCAAATATTTATGTTTTAAATACGGAAGTGTTTCTTTAAGTACATATGTCAGCTATGCGGCAAGCTATGGCTGTCTTTCTGACTACCATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTTTGAGCAGTTGTTTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGTTTTTTTTTTACATTTTTGGAAGCCCCAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCGGAATATTTGGACTATTTGCTTACTGTTTACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATTTGTAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAGG
  5   1   2       bld TbA       out                  TTbA032l12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAATATCTATGTTTTAATACGGAAGTGTTTCTTTAAGTACATATGTCAGATATGCGGCAAGCTATGGCCGTCTCTCTGACTAACATCGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACACCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTTTTTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTGCCTAAGCCTCATTTCCTTGTAAAGGGTTTTTTTATGCCATTTCAAGTGACCTGTTCTCCCTTGCCTTTGTGTGCATATTTACATTTTTTTTTTTTAACCAAACAAGTTTATCTTATTGCTTTTATTAAATGTTTTGTCATTCAAATCTTTCTTTTGTTCAGAGGACATCAAGATAGATTATATATTATTGTTTTCATTGGCATAATGTGTTGCTAGGTCTGCCATCTTCAAATCATTAGTGGGCACAGAAAATCTGTGA
  3   1   2       bld Gas7      in                         XZG42297.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACTAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACACCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGTTTTTTTTTTACATTTTTGCAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTGCCTAAGCCTCATTTCCTTTTAAAGGGTTTTTTTATGCCATTTCAAGTGACCTGTTCTCCCTTGCCTTTGTGTGCATATTTACATTTTTTTTTTTTTTTTAACCAAACAAGTTTATCTTATTGCTTTTATTAAATGTTTTGTCATTC
  3   1   2       bld Gas0                                 dad54b10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAACATTGTGTCCATCAGTCGAACCAGTGACCGACATTGTGAGCTAGAATTGAATGCACACCCCTAGTACAGCAGAGCACACCTTTACTTGGCCTCAGGTCAGAGGCTACTATCTGTCTGAGCAGTTGTCTGCTGGTCACGTGACAGACTTTAGAAAGGCAGAACCAACAGGGCACGTTTTAGGGTTATACGTTGGGATTTTAGTAAAATATGCAGATAGAAAATATTAAGAAGTTTTGGTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTGCAAAAAAA
  5   1   2       bld Gas7      in                          XZG5161.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATATGCAGATAGAAAATATTAAGAAGTTTTGTTTTTTTTTTACATTTTTGGAAGCCACAACCTTTATGATCTTGATTTATAACTGGTTGTCCCTTCCCATTTCCTTCTTTATTTTTGTTTTTGTTCCCTGAATATTTGGACTATTTGCTTACTGTTGACCATACAATACATGTATATATTTTTGAATGTTGTCCTACAAATGCTGGAACATTACAGAGGGCAGTAAAAATAAACTGCTTCAATATGTTGCCTAAGCCTCATTTCCTTGTAAAGGGTTTTTTTATGCCATTTCAAGTGACCTGTTCTCCCTTGCCTTTGTGTGCATATTTACATTTTTTTTTTTTTAACCAAACAAGTTTATCTTATTGCTTTTATTAAATGTTTTGTCATTCAAATCTTTCTTTTGTTCAGAGGGCATCAAGATAGATTATATATTATTGTTTTCATTGGCATAATGTGTTGCTAGGTCTGCCATCTTCAAATCATTAGTGGGCACAGAAAATCTGTGATTTTGCAGGTGTTTTTTTTTGTTTGTTTTTTAATGTGTCTACCTTTGCCTAACGCTGTATAGCTCTATGGTATATCAGAAAATGTACCATAGTGCACAATGGTGTTCCAGGATGTGGCAAGGATCCCTGGAACTTGGGTCAAGGTGGTGGCATGGTGTTCCTGGCCTAGTGTAAAACATCAGTGCCACTAGGTGTTTATACAGTGTCAGAATGAAGTATATAAATAGGAGAGTCATATTCACTGCAGTGNGATACCACCAGTGA
  3   1   2       bld Gas7      in                          XZG5161.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTATGCCATTTCAAGTGACCTGTTCTCCCTTGCCTTTGTGTGCATATTTACATTTTTTTTTTTTTAACCAAACAAGTTTATCTTATTGCTTTTATTAAATGTTTTGTCATTCAAATCTTTCTTTTGTTCAGAGGGCATCAAGATAGATTATATATTATTGTTTTCATTGGCATAATGTGTTGCTAGGTCTGCCATCTTCAAATCATTAGTGGGCACAGAAAATCTGTGATTTTGCAGGTGTTTTTTTTTGTTTGTTTTTTAATGTGTCTACCTTTGCCTAACGCTGTATAGCTCTATGGTATATCAGAAAATGTACCATAGTGCACAATGGTGTTCCAGGATGTGGCAAGGATCCCTGGAACTTGGGTCAAGGTGGTGGCATGGTGTTCCTGGCCTAGTGTAAAACATCAGTGCCACTAGGTGTTTATACAGTGTCAGAATGAAGTATATAAATAGGAGAGTCATATTCACTGCAGTGGGATACCACCAGTGAATAAAATAGCTGACTTTTTACATTGGGCCAGGAGCACCGTGCCACCCTATTGGCTCAATTTCGAGGGATGTTTGGCACGTCTTGGCAGACTATTGTGCAGTTAGCTGCAGATTTGATTAAATAATTGTCTCTCTAGAGACAGATCGTACTGGTGTAGGTATTACAGTTTTGCTATTGTCAACCTGGCCTTAAACCTTTGATTTGCCACCTTGGGTATA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)