Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 19 Jun 2019 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABK5136.3                           75 END     1           1        1                Unknown (protein for MGC:68569) [Xenopus laevis]
     2   2.0    0Xt7.1-CAAP9170.3                           37 END     1           1        2                LOC496142 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012072777 Xt7.1-CABC11006.3.5 - 70 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                    2     2     4     4     5     5     7     8     8     8     9     9    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    16    15    16    14    16    14    16    14    16    15    16    15    16    15    16    15    16    14    15    14    15    14    15    14    15    14    15    12    13    12    13    12    13    11    13    11    13    12    13    12    13    12    13    12    13    12    13    11    12     9    11    10    11    11    12    10    12     7     9     7     9     7     8     7     7     7     7     7     7     7     8     7     8     8     8     7     8     8     8     8     8     7     7     6     6     6     6     7     7     7     7     8     8     9     9     9     9    10    10    10    10    10    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    14    14    14    14    14    15    15    15    15    15    15    16    16    17    17    17    17    18    18    18    18    18    18    17    17    17    17    17    17    17    17    17    17    18    18    18    18    18    18    18    18    17    17    17    17    17    17    17    17    17    17    16    16    16    16    17    17    16    16    17    17    14    14    14    14    14    14    14    14    15    15    15    15    15    15    15    15    15    15    15    16    15    16    16    17    16    17    16    19    17    20    18    22    18    22    18    23    19    22    25    26    27    28    26    28    28    29    30    31    28    29    30    31    30    31    31    32    32    34    33    33    33    33    33    33    34    34    34    34    34    34    34    34    34    34    34    34    34    34    33    34    33    34    33    34    33    34    33    34    32    33    31    32    30    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    30    31    30    31    30    31    30    31    29    30    29    30    29    30    28    30    28    30    28    30    30    31    30    31    24    31    24    31    24    31    24    31    24    31    24    31    24    30    24    30    24    30    24    30    24    30    24    30    21    30    19    28    19    28    19    28    18    27    17    25    17    25    16    24     4     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------T-T
                                               BLH ATG      37    1194                               
                                               BLH MIN      22     200                               
                                               BLH MPR      16     200                               
                                               EST CLI       8       2                               
                                                                                                                                          PROTEIN === Ce ==== 4e-060     NP_493028.2 WAVE (actin cytoskeleton modulator) homolog family member (wve-1) [Caenorhabditis elegans] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                          PROTEIN === Dm ==== 2e-068     NP_609477.1 CG4636-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                          PREDICTED = Sp ==== 5e-082     XP_001191393.1 PREDICTED: similar to ENSANGP00000006560 [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                          PREDICTED = Dr ==== 7e-101     XP_709261.1 PREDICTED: similar to WAS protein family, member 3 isoform 5 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                          PROTEIN === ?? ==== 2e-118     NP_001086288.1 MGC84671 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                          PREDICTED = Gg ==== 0          XP_424015.2 PREDICTED: similar to WASP-family protein [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                          PROTEIN === Mm ==== 0          NP_700472.1 WAS protein family, member 2 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                          PROTEIN === Hs ==== 0          NP_008921.1 WAS protein family, member 2 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                     PROTEIN === Xl ==== 0          AAH89121.1 Unknown (protein for IMAGE:6870338) [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                          PROTEIN === Xt ==== 0          AAI35145.1 Unknown (protein for MGC:121919) [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CABC11006.3.5                                                                    ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------ATG------------ATG------------ATG------------------------------------------------ATG------------------TGATAA---------------------TAA---------TAA------------------------------------------------------------------------------------TAA------------------------------TAA---------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------ATG------TAG---------TAA------------------TAA---------TAATAA------------------------------------------------------------------------------------------------------------------------------------------------TAGTAA---------------------------------------------------------------------TAA---------------------------------------------------------------------------------TAA---------------------TAGTAA------TAA------------------------------------TAGTGA------------TAA---------------------------------------------------------------------------------------------------TAA------------------------------------------ATG---------TAA------TAATAG------------------------------------------------------------------------------------------ATG------------------------------------------TAA---TAG------------------------TAA
                                                                   ORF                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   2       ext Thy1      in                        CBST1689.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTAGTACAATAGAAAGTCTGGATATGAATCAGTACCCACCTCCTCCTCCTTTTGAGGAGCCATCATCCATTTCCCAACCATTTATTGATGACTCTCTGCCTCCACCACCTGCTGACGTCAGTGGTCAACCTTCGTTGCATCGTTCTAGCTTGGTTAGCCCTGCCTATCCTCCTCCAGCCCCACCAATTGGTTCTCCAATAGGGAGTCGACCAAGTTTTTCACCCCCACCAGCACCTCCCCCTCCTCCACCTGATGGATCAGTTCCTGATGCCCCATACCTTCCTCCACCTTCTCCTCCACCAGTGTTCCCCTCATTACCAGGCTTTCCTGCCCCTGCCCCTCCTCCTCCTCCTCCAGCACCTACTCATCTTGATTATCCAGCAGCTTCACCTCATTCTCCCACACAAGCCCCTAGTGGCGGCCCACCTCCACCACCTCCACCACCACCTCCACCTCCTGGCCCTCCTCCACCCCCTGCCTTCTCCCATTCTGAAGGTGAATCTCCATCACAAATTTCAAAACCGAAGACCTCCCTTCCTCCAGTAAGCGATCCTCGAAGTGACTTGCTATCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCATGAGAAGCGAGATGTTGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAA
  3   1   2       ext Thy1      in                        CBST1689.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCTCCACCACCTGCTGACGTCAGTGGTCAACCTTCGTTGCATCGTTCTAGCTTGGTTAGCCCTGCCTATCCTCCTCCAGCCCCACCAATTGGTTCTCCAATAGGGAGTCGACCAAGTTTTTCACCCCCACCAGCACCTCCCCCTCCTCCACCTGATGGATCAGTTCCTGATGCCCCATACCTTCCTCCACCTTCTCCTCCACCAGTGTTCCCCTCATTACCAGGCTTTCCTGCCCCTGCCCCTCCTCCTCCTCCTCCAGCACCTACTCATCTTGATTATCCAGCAGCTTCACCTCATTCTCCCACACAAGCCCCTAGTGGCGGCCCACCTCCACCACCTCCACCACCACCTCCACCTCCTGGCCCTCCTCCACCCCCTGCCTTCTCCCATTCTGAAGGTGAATCTCCATCACAAATTTCAAAACCGAAGACCTCCCTTCCTCCAGTAAGCGATCCTCGAAGTGACTTGCTATCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCATGAGAAGCGAGATGTTGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAG
  3   1   3        nb Bone      in                        CBTC5227.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACCAGTGTTCCCCTCATTACCAGGCTTTCCTGCCCCTGCCCCTCCTCCTCCTCCTCCAGCACCTACTCATCTTGATTATCCAGCAGCTTCACCTCATTCTCCCACACAAGCCCCTAGTGGCGGCCCACCTCCACCACCTCCACCACCACCTCCACCTCCTGGCCCTCCTCCACCCCCTGCCTTCTCCCATTCTGAAGGTGAATCTCCATCACAAATTTCAAAACCGAAGACCTCCCTTCCTCCAGTAAGCGATCCTCGAAGTGACTTGCTATCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCATGAGAAGCGAGATGTTGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCC
  5   1   2       ext Ova1      in                         CABE9694.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTCATTACCAGGCTTTCCTGCCCCTGCCCCTCCTCCTCCTCCTCCAGCACCTACTCATCTTGATTATCCAGCAGCTTCACCTCATTCTCCCACACAAGCCCCTAGTGGCGGCCCACCTCCACCACCTCCACCACCACCTCCACCTCCTGGCCCTCCTCCACCCCCTGCCTTCTCCCATTCTGAAGGTGAATCTCCATCACAAATTTCAAAACCGAAGACCTCCCTTCCTCCAGTAAGCGATCCTCGAAGTGACTTGCTATCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCATGAGAAGCGAGATGTTGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCCAGCAGAGTAGATACTGTAAATGTCTGTTGTGCACAGGACATTCCTTTAGGTTTTTCTTTTTGTGCTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCAATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGA
  5   1   3        nb Egg                            TEgg131b15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCCCTGCCCCTCCTCCTCCTCCTCCAGCACCTACTCATCTTGATTATCCAGCAGCTTCACCTCATTCTCCCACACAAGCCCCTAGTGGCGGCCCACCTCCACCACCTCCACCACCACCTCCACCTCCTGGCCCTCCTCCACCCCCTGCCTTCTCCCATTCTGAAGGTGAATCTCCATCACAAATTTCAAAACCGAAGACCTCCCTTCCTCCAGTAAGCGATCCTCGAAGTGACTTGCTATCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCATGAGAAGCGAGATGTTGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCCAGCAG
  5   1   2       add In54                            IMAGE:8947014.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTACTCATCTTGATTATCCAGCAGCTTCACCTCATTCTCCCACACAAGCCCCTAGTGGCGGCCCACCTCCACCACCTCCACCACCACCTCCACCTCCTGGCCCTCCTCCACCCCCTGCCTTCTCCCATTCTGAAGGTGAATCTCCATCACAAATTTCAAAACCGAAGACCTCCCTTCCTCCAGTAAGCGATCCTCGAAGTGACTTGCTATCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCATGAGAAGCGAGATGTTGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCCAGCAGAGTAGATACTGTAAATGTCTGTTGTGCACAGGACATTCCTTTAGGTTTTTCTTTTTGTGCTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAACCCTGCAGGTCACAGTACTGATGAACACCCAGCATGCATTAGAGGAGATCAGTGGCATTTTGTACCTTCTTTTCAAGAGAGATTTGTGATCCGCATGTGGTAATAGATATGCCCTGCTTAAATGTTGCATAGATGGTCTCTAGAACTAACCAATGTCTCTAAAATATTAAAACACAACTGACATGACTTTGGTTAACCCCGTTATTGCGT
  5   1   2       ext Fat1      in                        CABC11006.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAATTCGGCACGAGGCTCCCACACAAGCCCCTAGTGGCGGCCCACCTCCACCACCTCCACCACCACCTCCACCTCCTGGCCCTCCTCCACCCCCTGCCTTCTCCCATTCTGAAGGTGAATCTCCATCACAAATTTCAAAACCGAAGACCTCCCTTCCTCCAGTAAGCGATCCTCGAAGTGACTTGCTATCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCATGAGAAGCGAGATGTTGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCCAGCAGAGTAGATACTGTAAATGTCTGTTGTGCACAGGACATTCCTTCAGGTTTTTCTTTTTGTGCTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCAATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTT
  5   1   3        nb Ovi1      in                          CABI932.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACCACCACCTCCACCTCCTGGCCCTCCTCCACCCCCTGCCTTCTCCCATTCTGAAGGTGAATCTCCATCACAAATTTCAAAACCGAAGACCTCCCTTCCTCCAGTAAGCGATCCTCGAAGTGACTTGCTATCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCATGAGAAGCGAGATGTTGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCCAGCAGAGTAGATACTGTAAATGTCTGTTGTGCACAGGACATTCCTTTAGGTTTTTCTTTTTGTGCTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCAATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTT
  5   1   2       ext Ski1      in                         CABJ7183.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCATGAGAAGCGAGATGTTGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCCAGCAGAGTAGATACTGTAAATGTCTGTTGTGCACAGGACATTCCTTTAGGTTTTTCTTTTTGTGCTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCAATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGC
  5   1   3        nb Gas                            TGas049c01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGGTAGAAGAAAAATGGAGCATGAGAAGCGAGATGTTGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCCAGCAGAGTAGATACTGTAAATGTCTGTTGTGCACAGGACATTCCTTTAGGTTTTTCTTTTTGTGCTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCAATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCT
  5   1   3        nb Gas                            TGas007b04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCGGGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCCAGCAGAGTAGATACTGTAAATGTCTGTTGTGCACAGGACATTCCTTTAGGTTTTTCTTTTTGTGTTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCAATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCT
  5   1   3        nb Tbd0      out                      IMAGE:6976691                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCCAGCAGAGTAGATACTGTAAATGTCTGTTGTGCACAGGACATTCCTTTAGGTTTTTCTTTTTGTGCTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCAATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGGTTCCGCCTGTTTACTAGTAACGTGGTGCAGAAAGATCCAAACGAATCCAGAATGGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAAACCAAG
  5   1   3        nb Gas                            TGas111k22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCCAGCAGAGTAGATACTGTAAATGTCTGTTGTGCACAGGACATTCCTTTAGGTTTTTCTTTTTGTGCTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCAATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAAACCCTGTAGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTC
  5   1   3        nb Liv1      in                         CAAR4235.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCCAGCAGAGTAGATACTGTAAATGTCTGTTGTGCACAGGACATTCCTTTAGGTTTTTCTTTTTGTGCTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCAATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTA
  5   1   3        nb Gas                            TGas046m23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCCAGCAGAGTAGATACTGTAAATGTCTGTTGTGCACAGGACATTCCTTTAGGTTTTTCTTTTTGTGCTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCAATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTNTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAAT
  5   1   3        nb Spl2      in                       CBSS10304.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCCAGCAGAGTAGATACTGTAAATGTCTGTTGTGCACAGGACATTCCTTTAGGTTTTTCTTTTTGTGCTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCAATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGGTTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTT
  5   1   3        nb Egg                            TEgg103i08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCCTTTAGGTTTTTCTTTTTGTGCTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCAATAACCATTTTTAAATGTACGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCACTATAAAACTTCCATATTGCTGC
  5   1   2       ext Sto1      in                         CABG3185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAGAGATCAATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAAACAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGNATATG
  5   1   3        nb TpA                            TTpA058k13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGTAGGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGCGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTA
  3   1   2       ext Ova1      in                         CABE9694.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGT
  3   1   2       ext Fat1      in                        CABC11006.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGT
  3   1   2       ext Gas       in                    TGas107l03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTGTACCTTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGAAAAAAAAAAAAAAAAAA
  3   1   2       ext Ski1      in                         CABJ7183.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGAAAAAA
  3   1   3        nb Liv1      in                         CAAR4235.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGC
  3   1   2       ext Sto1      in                         CABG3185.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCG
  5   1   3        nb Tad5                                 XZT31589.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTCCTTTTCAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATG
  5  -1   3        nb Int1      out                        CAAP6071.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTTTCAAAAAGAGAGGATTTGTGATCCGCATGTGGTAAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATAT
  3   1   3        nb Ovi1      in                          CABI932.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTTTTCAAAAGAGAAGATTTGTGATCGNCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGT
  3   1   3        nb Fat1      in                         CABC6454.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGTAAAA
  3   1   4      seed Ovi1      in                        CABI11202.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGC
  3   1   2       add Te4  5g3  in                         CAAN4780.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGT
  3   1   2       ext Brn3 5g3  in                         CAAK7878.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGT
  3   1   3        nb Liv1      out                        CAAR1758.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGTAAAAAAA
  3   1   2       add Ovi1 5g3  in                         CABI6395.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGTAAAAAACCTC
  3   1   3        nb Lun1      in                         CABD2824.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGTACAAAA
  3   1   3        nb Tad5 FL   in                         XZT15770.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGTAAAAAAAAAAAAAAAGG
  3   1   3        nb Spl2      in                       CBSS10304.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGC
  3   1   2       add Te1  5g3  in                         CBWN9128.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAAATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGAAAAAAAAAAAAAAA
  3   1   3        nb Neu0      in                     NISC_ng20c05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGTAAAAAAAAAAAAAAAAAAG
  3   1   2       ext BrSp      in                     EC2BBA19CH03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCAT
  5   1   2       ext BrSp      in                     EC2BBA19CH03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGTAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Gas                            TGas013d03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGTCCTTCATTTCTTTGACTGGGAAGAAAAAAGCTTCAGACACAAAGACATATAAAGAGAACGGAAACATAGGAGAGAGAAGAAAGACAACCCCAATCGCGGGAATGTGAATCCACGCAAGATCCGCACAAGGAAAGAANAATGGGAGAAAATGAAGATGGGATTGGAGTTTGTGGAGGCCAAGGATAAGATGCAGAATGCAGGGCCTCAACCATATCAAAATGGATCTGTTAGTACAATAGAAAGTCTGGATATGAATCAGTACCCACCTCCTCCTCCTTTTGAGGAGCCATCATCCATTTCCCAACCATTTATTGATGACTCTCTGCCTCCACCACCTGCTGACGTCAGTGGTCAACCTTCGTTGCATCGTTCTAGCTTGGTTAGCCCTGCCTATCCTCCTCCAGCCCCACCAATTGGTTCTCCAATAGGGAGTCGACCAAGTTTTTCACCCCCACCAGCACCTGCCCCTCCTCCACCTGATGGATCAGTTCCTGATGCCCCATACCTTCCTCCACCTTCTGCTGCACCAGTGTTACCCTCATTACCAGGCTTTACTGCCCCTGCCCC
  5   1   4      seed Tad5      in                         XZT27520.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTTGGTTAGCCCTGCCTATCCTCCTCCAGCCCCACCAATTGGTTCTCCAATAGGGAGTCGACCAAGTTTTTCACCCCCACCAGCACCTCCCCCTCCTCCACCTGATGGATCAGTTCCTGATGCCCCATACCTTCCTCCACCTTCTCCTCCACCAGTGTTCCCCTCATTACCAGGCTTTCCTGCCCCTGCCCCTCCTCCTCCTCCTCCAGCACCTACTCATCTTGATTATCCAGCAGCTTCACCTCATTCTCCCACACAAGCCCCTAGTGGCGGCCCACCTCCACCACCTCCACCACCACCTCCACCTCCTGGCCCTCCTCCACCCCCTGCCTTCTCCCATTCTGAAGGTGAATCTCCATCACAAATTTCAAAACCGAAGACCTCCCTTCCTCCAGTAAGCGATCCTCGAAGTGACTTGCTATCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCATGAGAAGCGAGATGTTGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTT
  5   1   3        nb Tad5      in                         XZT38257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGACGCGTGGGGTCGACNCAAGTTTTTCACCCCCACCAGCACCTCCCCCTCCTCCACCTGATGGATCAGTTCCTGATGCCCCATACCTTCCTCCACCTTCTCCTCCACCAGTGTTCCCCTCATTACCAGGCTTTCCTGCCCCTGCCCCTCCTCCTCCTCCTCCAGCACCTACTCATCTTGATTATCCAGCAGCTTCACCTCATTCTCCCACACAAGCCCCTAGTGGCGGCCCACCTCCACCACCTCCACCACCACCTCCACCTCCTGGCCCTCCTCCACCCCCTGCCTTCTCCCATTCTGAAGGTGAATCTCCATCACAAATTTCAAAACCGAAGACCTCCCTTCCTCCAGTAAGCGATCCTCGAAGTGACTTGCTATCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCATGAGAAGCGAGATGTTGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACCCATTGGGT
  5   1   2       ext HdA       in                   THdA012b11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGCCCAGCAGAGTAGATACTGTAAATGTCTGTTGTGCACAGGACATTCCTTTAGGTTTTTCTTTTTGTGCTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCAATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTANTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAA
  5   1   2       ext Bone      in                        CBTC1935.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTCAATAAAGATATATTGCCCAGCAGAGTAGATACTGTAAATGTCTGTTGTGCACAGGACATTCCTTTAGGTTTTTCTTTTTGTGCTGCTTTTAAAATAATAACAGATTTCAGCTGAGAGATCAATAACCATTTTTAAATGTAGGGAGTGTGTTGCATATAAACCCTGCAGGTCACAGTACTGATGACACACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAAATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACAC
  5   1   3        nb Tad5                                 XZT24833.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACCCAGCATGCAATTAGAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAAATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTNGTATTTTGTATCTGCATTATGT
  3   1   4      seed Tad5      in                         XZT27520.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAAATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGTAAAAAAAAAAAAAAAGG
  3   1   2       ext Bone      in                        CBTC1935.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACACAACTTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAAATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCG
  3   1   2       ext HdA       in                    THdA012b11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAAATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATT
  3   1   3        nb Tad5      in                         XZT38257.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAAATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCTACCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGTAAAAAAAAAAAAAAACC
  5   1   4      seed Egg       in                   TEgg078f09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCCTGCCCCTGCCCCTCCTCCTCCTCCTCCAGCACCTACTCATCTTGATTATCCAGCAGCTTCACCTCATTCTCCCACACAAGCCCCTAGTGGCGGCCCACCTCCACCACCTCCACCACCACCTCCACCTCCTGGCCCTCCTCCACCCCCTGCCTTCTCCCATTCTGAAGGTGAATCTCCATCACAAATTTCAAAACCGAAGACCTCCCTTCCTCCAGTAAGCGATCCTCGAAGTGACTTGCTATCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCATGAGAAGCGAGATGTTGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTT
  5   1   2       ext Egg       in                   TEgg007n18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCCCTGCCCCTCCTCCTCCTCCTCCAGCACCTACTCATCTTGATTATCCAGCAGCTTCACCTCATTCTCCCACACAAGCCCCTAGTGGCGGCCCACCTCCACCACCTCCACCACCACCTCCACCTCCTGGCCCTCCTCCACCCCCTGCCTTCTCCCATTCTGAAGGTGAATCTCCATCACAAATTTCAAAACCGAAGACCTCCCTTCCTCCAGTAAGCGATCCTCGAAGTGACTTGCTATCTGCAATCCGTGAAGGGTTCCAGCTACGAAAGGTAGAAGAAAAAATGGAGCATGAGAAGCGAGATGTTGGTGGGAATGATGTGGCCACCATCTTGTCTCGTAGAATTGCAGTGGAATATAGTGACTCTGAGGATGATTCTTCTGAATTTGATGAAGATGATTGGTCTGATTGAGACCCTTATGAAAGAAACAAAAGGAAAGTGAATGTGCAGTTAAAAGACAAATTCCTTGTAGATGACACATTGGGTAAAATGACATATACAACTATGCAGTGCAGGGGAATGGTCAGAAAATTAAAAAAGAAGAATTTGTTAATTGGGGGAAAAAATGGTATGTTGTTTTTTTGGGGCAACTGATAAAATGTCCCACTTATAGAATGCTAATATTTTCAATAAAGATATATTGC
  3   1   4      seed Egg       in                    TEgg078f09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGAGATCAGTGGCATTTTGTACCTTCCTTTTCAAAAGAGAGGATTTGTGATCCGCATGTGGGTAATAGATTATGCCCTGCCTAAAATGTTTGCATAGATTGTTCTCTAAAGACAAAACAAATGCTCTTAAAAATATATTTAATAACAACAACAACTTAACAATGACTTTTGTTTTAACCCTTTTGTTGCTGCCCACCCTAGAATCTACATTATCATTATAAAACTTCCATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGTCAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg       in                    TEgg007n18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATATTGCTGCCAGTATAGGTCATTCAGTTCTGGTTTGATATGTGCTGTTCCGCATGTTTACTAGTAACGTGGTGCAGAAAGATCAAAGCGAATCCAGAATGAGAAAAATCACTATTTGAAATCGAATACTGTGTACTAAACAAAGGAAGAAGCCTATGCATATGCACAGCTAAGATATATTCTAAATATCATTAAGTCTGTGGTGGCTCTGCCAGTAATCTAAGTGTGGAAAAAGAGAAGTGTTTAGTAAGTAATATAAGTAATATGGGGGTTACAGTATCAGTCTCACTTTTTATAGTGACTTGGCATATTGTAATCTTTAATACTAGCCTATGCAACAATCTTCTATTTAACAATTCTCGCTAAGTGTGTTTATGCAAGTATAATTCCACACACACACACACACACATATCTATAAGTAGCTTTAACTAAGTATGCTTTTATTGCTAGACACACAATTATGATATTGAGATAAGTGCCTTAATAGAGCAGATGTGGGGAACAAGTGCTGTATGGTGCTTTGAGACAACGCTGTACGGCACAGCTCTACTCCTGCTTTGTATATGTTTTGTTAATGATTTTTACTTGGAAATCTGTTATTTTGTATCTGCATTATGTTTAAATATAGCACCATATAAAATGTTCAATTGCGTAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (