Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jul 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012072856 Xt7.1-TNeu132c20.3 - 75 ESTs
                                                                       .....-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu132c20.3                                                                  AGTGAGAGAGGGTGAGCACAAAGAGCAGGGATCAGTGTGTGCAGGGACCGGAGCAACAGAGTGAAGCGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGANAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGTGCAGCGCCCGGAGGGTGTGTGTGTGTGACCCGACACGGGCCCCCCCCTCACCTGCTCTTGTGCAGACTCTTCCGCTGGCCAGAGCTGCAGCATCCCGGGCAACTGAAAGCCTTGTGTGGGTGCCAGGGAGCCGGGGGCTCGGAGAATAACAGTGTGTGCTGCAACCCCTACCATTACAGCAGGGTGTGCGGACCGGAGTCTCCACCACCACCTTATTCGCGCCTGTCTCCGAAAATTGAGCAGAAGCCTCTAGATCTCTCCGATTCATACACTGAAATGGAAGCCTCCAACTCACTGTGCATCACAGCTGGAGATATATCTGACACAAGCCTGTCTCCTGACATGAGCAAACAGGGCCACTGGTGCAGCGTTGCATACTGGGAGCATCGTACTCGCGTGGGCCGTCTCTATGCAGTGTGCCAGCCTTCAGTAAGCATTTTCTATGATCTACCTCAGGGAAGCGGCTTCTGTCTGGGCCAGCTGAATCTGGAAAACCGGAGTGAGGCAGCAGCCAGGACACGGGGGAAGATTGGACTTGGAATAGTACTGAGCCGAGAGGCTGATGGTGTGTGGGCTTACAACCGCAGCGATCATCCCATATTCGTCAACTCACCCACCTTAGATGCACCTGCCTGCCGCCCCCTAGTGGTGAGAAAGGTGATGCCTGGATACTCCCTCAAAGTGTTTGATTACAAAAAGTCCTGTGTTCTGCGGCATCACCCAACTCCACCAGAACATACAGATGGACCCTATGATCCCCACAGTGTCCGCATCAGCTTTGCCAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224132                                                                        AGAGGGTGAGCACAAAGAGCAGGGATCAGTGTGTGCAGGGACCGGAGCAACAGAGTGAAGCGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGANAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGTGCAGCGCCCGGAGGGTGTGTGTGTGTGACCCGACACGGGCCCCCCCCTCACCTGCTCTTGTGCAGACTCTTCCGCTGGCCAGAGCTGCAGCATCCCGGGCAACTGAAAGCCTTGTGTGGGTGCCAGGGAGCCGGGGGCTCGGAGAATAACAGTGTGTGCTGCAACCCCTACCATTACAGCAGGGTGTGCGGACCGGAGTCTCCACCACCACCTTATTCGCGCCTGTCTCCGAAAATTGAGCAGAAGCCTCTAGATCTCTCCGATTCATACACTGAAATGGAAGCCTCCAACTCACTGTGCATCACAGCTGGAGATATATCTGACACAAGCCTGTCTCCTGACATGAGCAAACAGGGCCACTGGTGCAGCGTTGCATACTGGGAGCATCGTACTCGCGTGGGCCGTCTCTATGCAGTGTGCCAGCCTTCAGTAAGCATTTTCTATGATCTACCTCAGGGAAGCGGCTTCTGTCTGGGCCAGCTGAATCTGGAAAACCGGAGTGAGGCAGCAGCCAGGACACGGGGGAAGATTGGACTTGGAATAGTACTGAGCCGAGAGGCTGATGGTGTGTGGGCTTACAACCGCAGCGATCATCCCATATTCGTCAACTCACCCACCTTAGATGCACCTGCCTGCCGCCCCCTAGTGGTGAGAAAGGTGATGCCTGGATACTCCCTCAAAGTGTTTGATTACAAAAAGTCCTGTGTTCTGCGGCATCACCCAACTCCACCAGAACATACAGATGGACCCTATGATCCCCACAGTGTCCGCATCAGCTTTGCCAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                       3     4     3     4     4     4     4     5     7    11    13    15    15    17    16    20    17    20    18    21    19    21    22    23    21    23    21    23    21    23    21    23    22    23    22    23    20    22    22    22    22    23    22    23    23    23    23    23    22    23    23    23    23    23    23    23    22    22    22    22    22    22    22    22    22    22    21    22    22    22    21    22    21    22    20    21    20    21    20    21    19    21    20    21    20    21    20    21    20    21    20    21    18    21    18    21    18    21    18    20    18    20    16    18    16    18    15    19    15    20    14    19    12    17    12    17    10    16    10    16    10    16     9    14     9    14     9    14     9    14     9    13     7    11     7    11     5    10     4    10     5    11     4    10     5    11     5    11     5     9     5     9     5     9     4     8     4     8     4     8     4     7     4     6     4     6     4     6     4     6     3     5     3     5     4     6     4     6     4     6     5     7     5     7     5     8     6     8     6     8     6     8     6     8     6     8     7     9     7    10     7    11     8    11     8    11     7    10     8    12     9    12     9    12     8    11     8    11     8    11     8    11     8    11     8    11     8    12     9    13    10    13    10    13     9    12     9    12     9    12    10    12    10    13    10    13    10    14    10    14    10    14    11    15    11    15    11    15    11    15    11    14    13    17    14    19    15    19    15    20    18    22    20    25    21    26    21    24    20    23    22    26    23    26    25    29    25    29    29    31    29    31    32    34    32    35    32    35    32    36    32    36    32    36    32    36    32    37    33    38    32    38    33    37    33    37    35    38    35    38    35    38    34    38    33    38    35    38    35    37    35    37    33    37    35    36    35    37    36    36    35    36    35    36    36    36    35    35    35    35    35    35    35    35    35    35    33    35    33    34    34    34    31    34    29    33    30    33    32    34    32    34    31    34    31    34    31    34    31    34    31    33    30    32    30    31    30    31    30    31    27    28    27    28    27    28    25    27    21    24    22    24    17    20    12    14     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------A
                                               BLH ATG     591     431                                                                  
                                               BLH MIN     591     142                                                                  
                                               BLH MPR      57     142                                                                  
                                               BLH OVR     591     738                                                                  
                                               CDS MIN     591     142                                                                  
                                               EST CLI      35      15                                                                  
                                               ORF LNG     591      72                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ce ---- 1e-030     NP_498493.1 SMAll body size SMA-3, dwarfin family member SMA-3 (44.5 kD) (sma-3)[Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xt ---- 2e-034     CAL49422.1 smad2 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                 PROTEIN --- Dm ---- 8e-038     NP_477260.1 CG5201-PA, isoform A [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 4e-049     BAE06694.1 Smad6/7 [Ciona intestinalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Sp ==== 6e-090     XP_798238.2 PREDICTED: similar to inhibitory protein SMAD6 [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Mm ---- 7e-127     NP_032568.2 MAD homolog 6; Smad 6 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Dr ---- 5e-127     NP_001038516.1 hypothetical protein LOC564395 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Hs ---- 3e-128     NP_005576.3 MAD, mothers against decapentaplegic homolog 6 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Gg ==== 1e-141     NP_989579.1 MAD, mothers against decapentaplegic homolog 6 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 0          AAC28938.1 Smad6 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 0          NP_001084210.1 Smad6 protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu132c20.3                                                                              TGA---------------------------------------------------------------------------------------------------------------------------------------TAG------------------------TAG------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------ATG---------------------ATGTGA---------------------------------------ATGTGA------------------------------------------------------------------------------------------------ATG---------------------------TGA---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------TAG------------------------------------------------------------------------------------TAA---------------------------------------TAATAG---------------------------------------------------------------------------TGA------TAA---------------------------------TAG------------------TGA---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATGTGATGA---------------ATG------------------------------TAA---TAA------------------------------------------------ATG---TAG---TAA------ATG------------ATG---------------------TAA---------------------------------------------------ATG---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   1           Neu  FL                     TNeu021f04.FL-Sanger                                                                                                                                                                                      GAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGAAAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGTGCAGCGCCCGGAGGGTGTGTGTGTGTGACCCGACACGGGCCCCCCCCTCACCTGCTCTTGTGCAGACTCTTCCGCTGGCCAGAGCTGCAGCATCCCGGGCAACTGAAAGCCTTGTGTGGGTGCCAGGGAGCCGGGGGCTCGGAGAATAACAGTGTGTGCTGCAACCCCTACCATTACAGCAGGGTGTGCGGACCGGAGTCTCCACCACCACCTTATTCGCGCCTGTCTCCGAAAATTGAGCAGAAGCCTCTAGATCTCTCCGATTCATACACTGAAATGGAAGCCTCCAACTCACTGTGCATCACAGCTGGAGATATATCTGACACAAGCCTGTCTCCTGACATGAGCAAACAGGGCCACTGGTGCAGCGTTGCATACTGGGAGCATCGTACTCGCGTGGGCCGTCTCTATGCAGTGTGCCAGCCTTCAGTAAGCATTTTCTATGATCTACCTCAGGGAAGCGGCTTCTGTCTGGGCCAGCTGAATCTGGAAAACCGGAGTGAGGCAGCAGCCAGGACACGGGGGAAGATTGGACTTGGAATAGTACTGAGCCGAGAGGCTGATGGTGTGTGGGCTTACAACCGCAGCGATCATCCCATATTCGTCAACTCACCCACCTTAGATGCACCTGCCTGCCGCCCCCTAGTGGTGAGAAAGGTGATGCCTGGATACTCCCTCAAAGTGTTTGATTACAAAAAGTCCTGTGTTCTGCGGCATCACCCAACTCCACCAGAACATACAGATGGACCCTATGATCCCCACAGTGTCCGCATCAGCTTTGCCAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu                            TNeu139p24.p1cSP6 GCCGCCAAAGTGTCTATACTGCCTGTGAAAGGAGAGGGGGGGGAATGCTTTCAATGGGCCCGAGTGAGTGAGAGAGGGTGAGCACAAAAGCATGGATCAGTGTGTGCACGGACCGGAGCAACACAGTGAATCGCCTACTGCTATCTGGGAAGCTGAAAGGAACCCAAGGACCGGAGCGGGGAGCCTA
  5   1   2       bld Gas8 5g3  in                          st22k05.5p                                                      GGGGCCCGAGTGAGTGAGAGAGGGTGAGCACAAAGAGCAGGGATCAGTGTGTGCAGGGACCGGAGCAACAGAGTGAAGCGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAAGTGTCTCTTGCTGCGGTCTGTCGGANCAGCCCTCTGGC
  5   1   2   14  bld Brn3 5g3  in                        CAAK10282.5p ...............................................................TGAGTGAGAGAGGGTGAGCACAAAGAGCAGGGATCAGTGTGTGCAGGGACCGGAGCAACAGAGTGAAGCGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGANAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGTGCAGCGCCCGGAGGGTGTGTGTGTGTGACCCGACAC
  5   1   2   22  bld Gas7 5g                               XZG9415.5p .................................................................AGTGAGAGAGGGTGAGCACAAAGAGCAGGGATCAGTGTGTGCAGGGACCGGAGCAACAGAGTGAAGCGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGANAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGTGCAGCGCCC
  5   1   2       bld Neu0      in                       IMAGE:6991949                                                                                                     CGGGATCAGGGACCGGAGCAACAGAGTGAAGCGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAAGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCAGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGATGCACCGGTACAGCCGGGCGCACCCTCGGGGGCGCACCACATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGATCCGGGCGGGCGGTGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGAAAGAGCAAGCCCTGTGCGCCCTGCTGGAAGCCGTGGAGTCCCGGGGTGCACCGCCCCGGAGGGTGTGTGTGTTGTGACCTACACAGGCCCCCCCCCTCACCTGATTCTTGTGCAGACTTCTTCCTCTGGGCATACCTGCAGCAATCGT
  5   1   2       bld Neu0 5g3  in                       IMAGE:6992572                                                                                                          CCCGGGATCGGAGCAACAGAGTGAAGCGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGANAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGTGCAGCGCCCGGAGGGTGTGTGTGTGTGACCCGACACGGGCCCCCCCCTTCACCTGCTCTTGTGCAGACTCTTCCCGCTGCCANAAGCTGCAGCATTCCCGGGCACTGGAAAACCTTGTTGTGGGTGCCCAGGGAGCCCGGGGGGCTCGGAAAAATTAAAAGTGGTGTGGCTGGCAACCCCCTAACCAT
  5   1   2   22  bld Gas7 5g                              XZG40676.5p .........................................................................................................GCAGGGACCGGAGCAACAGAGTGAAGCGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGANAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGTGCAGCGCCCGGAGGGTGTGTGTGTGTGACCCCACAC
  5   1   2       bld Gas  5g3  in                   TGas117e15.p1kSP6                                                                                                           ATCCCCGGGGAGCAACAGAGTGAAGCGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAACCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTC
  5   1   2       bld HdA  5g                       THdA027c20.p1kaSP6                                                                                                               GGACCGGAGCACAGAGTGAAGCGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAACAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGAAAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGT
  5   1   2       bld TbA       in                   TTbA066b19.p1kSP6                                                                                                                GACCGGAGCTACTAGTGAAGCGGCTACTGCTATCGGGGAAGCTGATAGGAATCCATTGGACCGGAGCTGGGAGCCTACTATGCAAGTGTGTCGCAGCTGCAAAGCCGATATCATAAAGGAAGCCTGTGCGGTACGGTAGCATCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGG
  5   1   2       bld Neu                            TNeu144k05.p1cSP6                                                                                                                  CCGGAGCAACATAGTGAATCGCCTACTGCTCTCGGGGAAGCTGAGAGAACCCATGGGACCGGAGCGGGGAGCCTACTATGAATTGTGCGCATTGCAAGCCGATATATAAATGAATCCTGTGCGGGACGGTATCATCAATGTGCATTGTGTGATATCGCCACAATCCCGGCTGCATTATGCTGCAATCCCCGGGAGTGTGAGGGCTATATCCGTGCAAATACCCCGCATCCCCGCTCTATCCATCGTTCATCATCCTTCTCCGGAGCATACCGCTGCGCCCATTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGATGTCCGCCATGTGACATCCGTGGGGGTTCCGTCTGGATAATCATCCTTCCGAGATGTGACCCGGGATGGGGACACCCCAATACGTGCCCA
  5   1   2   12  bld Gas7 5g3  in                         XZG23760.5p ......................................................................................................................CAACAGAGTGAAGCGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGCAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGAAAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGTGCA
  5   1   2       bld HdA  5g3  in                  THdA039d10.p1kaSP6                                                                                                                         ACAGAGTGAAGCGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGAATGGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCT
  5   1   2   12  bld Gas7 5g3  in                         XZG19139.5p ...........................................................................................................................GAGTGAAGCGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCG
  5   1   2       bld TbA       in                   TTbA049k18.p1kSP6                                                                                                                             AGTGAAGCGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGAAAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGTGCACGCCCGGAGGGTGTGTTGGTGTGTGACCCGACACGGGCCCCCCCCTCACCTGCTCTTGTGCAGACTCTTCCGCTGGCCAGAGCTGCAGCATCCCGGGCAACTGAAA
  5   1   2       bld Gas  5g3  in                  TGas089h08.p1kaSP6                                                                                                                                    CGCCTACTGCTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTT
  5   1   2       bld Gas  5g                        TGas026a22.p1kSP6                                                                                                                                        CCTACTGCTATCGGGGAAGCTGAGAGAACCCAGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCTGGGGCGCGCCGCATGTTCATGTCCAGACGCACCGGGCTGG
  5   1   2       bld Neu  5x                        TNeu133m07.p1cSP6                                                                                                                                            TGCTATCGGGGAAGCTGAGAGGAACCCAGGGACCGGAGCGCGGAGCCTACTAAGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAAGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTC
  5   1   2       bld Gas8 5g3  in                          st91m12.5p                                                                                                                                             CTATCGGGGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCANTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAANCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGANANACTGGCACAGGANAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGANAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGNTGGTTCGGCGCCTGTGGAGGANCCGGGCGGACGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGC
  5   1   2       bld AbdN 5g                            IMAGE:7006682                                                                                                                                                    GGAAGCTGAGAGGAACCCAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGAAAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTTCCGGGGTGCAGCGCCCGGAAGGTGTGTTGTGTGTGACCCGACACGGGCCCCCCCCTCACCTGCTCTTGTGCAGACTCCTTCCGCTTGGCCAGAGCTGCAGCATCCCCGGGCAACTGGAAAGCCTTGGTGTGGGGGGCCAGGGGAAGCCGGGGGGCCTCGGAGAAAAAACCAGTGGTGTGGCTG
  5   1   2   12  bld Gas7 5g3  in                         XZG14699.5p ....................................................................................................................................................................CAGGGGACCGGAGCGGGGAGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGANAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGTGCAGCGCCCGGAGGGTGTGTGTGTGTGACCCGACACGGGCCCCCCCCTCACCTGCTCTTGTGCAGACTC
  5   1   2       bld Neu  FL                        TNeu021f04.p1kSP6                                                                                                                                                                                       AGCCTACTAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGT
  5   1   2   10  bld Ovi1 5g3  in                         CABI2291.5p .............................................................................................................................................................................................TAGGAAGTGTGCGCAGTGCAAGCCGATAGAGAAAGGAAGCCTGTGCGGGACGGTAGCAGCAATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCAGTAGGCTGCAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGAAAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGTGCAGCGCCCGGAGGGTGTGTGTGTGTGACCCGACACGGGCCCCCCCCTCACCTGCTCTTGTGCAGACTCTTCCGCTGGCCAGAGTTGCAGCATCCCGGGCAACTGAAAGCCTTGTGTGGGTGCCAGGGAGCCGGGGGCTC
  5   1   2       bld HdA                            THdA027o06.p1kSP6                                                                                                                                                                                                     TGTGCGCAGTGCATGCCGATAGAAATGGGAAGCCTGTGCGGGACGGTAACAGCTATGTGCAGTGTGTGAGAGCGCCACAAGCCCGGCTGCTTTACGCTGCAATCCCCGGGAGTGTTATGGCTACAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCTGCGTTCATCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCT
  5   1   2       bld Te5       in                         CAAO8355.5p                                                                                                                                                                                                                                                                                                        CAATCCCCGGGAGTGTAAGGGCTAGAGCCGTGCAAATACCCCGCAGCCCCGCTCTATCCAGCGTTCAGCATCCTTCTCCGGAGCATCCCGCTGCGCCCAGTCTCCGTGCCCCTGCTGGATGCCCTGTGCCGTGAGTACCGCCATGTGACAGCCGTGGGGGTTCCGTCTGGAGAAGCAGCCTTCCGAGATGTGACCCGGGAGGGGGACACCCCAATACGTGCCCAGCCGACTGACTCTCTATCCGTGCGGGCACCGGAGAGACTGGCACAGGAGAGAGCGCTCTTCCCCCATGCCGACCCTTCTAGTTGGCCCCGGGCACTGAGGCACCGGAGAGCCGGGCGCACCCTCGGGGGCGCGCCGCATGTTCAGGTCCAGACGCACCGGGCTGGTTCGGCGCCTGTGGAGGAGCCGGGCGGGCGGGGATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGAAAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGTGCAGCGCCCGGAGGGTGTGTGTGTGTGACCCGACACGGGCCCCCCCCTCACCTGCTCTTGTGCAGACTCTTCCGCTGGCCAGAGCTGCAGCATCCCGGGCAACTGAAAGCCTTGTGTGGGTGCCAGGGAGCCGGGGGCTCGGAGAATAACAGTGTGTGCTGCAACCCCTACCATTACAGCAGGGTGTGCGGACCGGAGTCTCCACCACCACCTTATTCGCGCCTGTCTCCGAAAATTGAGC
  5   1   0       add Gas7      in                         XZG33615.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGAACGCTATCAGACATCTGTATGTTCTCTGTGCTTGCATGGGTTTTCTCCTGCACTCCAAAAACATACAGGAAGGTTGGTTGCCTCCTGATACATGAGCATAGACTTTGTAAATGTGAAAGAGACCTTATATTGTAAACTGCACTGTGGGCAGTGACTAATGTAAATGATGTATAATCACTGTAAAGGTGTTGAGGCCTATGTCAGCACTATACAAATAAAGTATAATAATACCATAAACTAACAATGTCAGAGCACATAAATACAAAATATTCATCAGGCCTTTTGGTAGACACTGGTCTCAGCCAGTATGAGCTATATAACATGTCAGACTCAAGAGAGAGCAAGACCAGATAATAATGTGCTTTAACAAATTTATCAATTCAGAGGACACTTCACTAACACATTTTTCTCTGCCTTCTGTTATCAGATCTCTCCGATTCATACACTGAAATGGAAGCCTCCAACTCACTGTGCATCACAGCTGGAGATATATCTGGTACGTCGGCATCCAGTGAGCATTGAGTTTAATTGTCCTTGCCTTTTTTCTTTACCTTCAAATGACTAATGAAAAGGAAATATGCTATATGTTATAGGCCAGAATTATTTGCTTTTTTGTTAATGTTTTTAAAGAGAATAAACTTAAGACGGTCATATAAAATGCTACTATCAGTTTTTTGGTGCATGCTCAGTAGCACCAGGCCCAGCAAGTCTGTGCAGCCCATAGGCAGGGTAGGGGCAGTATAGATGCCTTTGATGGCCTTATCTAGTCAGACCCCTTGTGATAGTAATTTACTAATAGAACACAGTAAGTTTCTACTTTATAGTTT
  5   1   2       bld Thy1      in                       CBST12974.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATGGAGGTGTCTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGAAAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGTGCAGCGCCCGGAGGGTGTGTGTGTGTGACCCGACACGGGCCCCCCCCTCACCTGCTCTTGTGCAGACTCTTCCGCTGGCCAGAGTTGCAGCATCCCGGGCAACTGAAAGCCTTGTGTGGGTGCCAGGGAGCCGGGGGCTCGGAGAATAACAGTGTGTGCTGCAACCCCTACCATTACAGCAGGGTGTGCGGACCGGAGTCTCCACCACCACCTTATTCGCGCCTGTCTCCGAAAATTGAGCAGAAGCCTCTAGATCTCTCCGATTCATACACTGAAATGGAAGCCTCCAACTCACTGTGCATCACAGCTGGAGATATATCTGGTACGTCGGCATCCAACACAAGCCTGTCTCCTGACATGAGCAAACAGGGCCACTGGTGCAGCGTTGCATACTGGGAGCATCGTACTCGCGTGGGCCGTCTCTATGCAGTGTGCCAGCCTTCAGTAAGCATTTTCTATGATCTACCTCAGGGAAGCGGCTTCTGTCTGGGCCAGCTGAATCTGGAAAACCGGAGTGAGGCAGCAGCCAGGACACGGGGGAAGATTGGACTTGGAATAGTACTGAGCCGAGAGGCTGATGGTGTGTGGGCTTACAACCGCAGCGATCATCCCATATTCGTCAACTCACCC
  5   1   2       bld Neu                            TNeu013p01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCTTGCTGCGGTCTGTCGGAGCAGCCCTCTGGCTCCCCGGAGCTCCGCGCCGCTGCTTCTGCGATCCTGAAGCGACTGAAAGAGCAAGCCCTGTGCGCCCTGCTGGAGGCCGTGGAGTCCCGGGGTGCAGCGCCCGGAGGGTGTGTGTGTGTGACCCGACACGGGCCCCCCCCTCACCTGCTCTTGTGCAGACTCTTCCGCTGGCCAGAGTTGCAGCATCCCGGGCAACTGAAAGCCTTGTGTGGGTGCCAGGGAGCCGGGGGCTCGGAGAATAACAGTGTGTGCTGCAACCCCTACCATTACAGCAGGGTGTGCGGACCGGAGTCTCCACCACCACCTTATTCGCGCCTGTCTCCGAAAATTGAGCAGAAGCCTCTAGATCTCTCCGATTCATACACTGAAATGGAAGCCTCCAACTCACTGTGCATCACAGCTGGAGATATATCTGGTACGTCGGCATCCAACACAAGCCTGTCTCCTGACATGAGCAAACAGGGCCACTGGTGCAGCGTTGCATACTGGGAGCATCGTACTCGCGTGGGCCGTCTCTATGCAGTGTGCCAGCCTTCAGTAAGCATTTTCTATGATCTACCTC
  5   1   2       bld Neu                            TNeu006k13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGACCCGACACGGNGCCCCCCCTCACCTGCTCTTGTGCAGACTCTTCCGCTGGCCAGAGCTGCAGCATCCCGGGCAACTGAAAGCCTTGTGTGGGTGCCAGGGAGCCGGGGGCTCGGAGAATAACAGTGTGTGCTGCAACCCCTACCATTACAGCAGGGTGTGCGGACCGGAGTCTCCACCACCACCTTATTCGCGCCTGTCTCCGAAAATTGAGCAGAAGCCTCTAGATCTCTCCGATTCATACACTGAAATGGAAGCCTCCAACTCACTGTGCATCACAGCTGGAGATATATCTGACACAAGCCTGTCTCCTGACATGAGCAAACAGGGCCACTGGTGCAGCGTTGCATACTGGGAGCATCGTACTCGCGTGGGCCGTCTCTATGCAGTGTGCCAGCCTTCAGTAAGCATTTTCTATGATCTACCTCAGGGAAGCGGCTTCTGTCTGGGCCAGCTGAATCTGGAAAACCGGAGTGAGGCAGCAGCCAGGACACGGGGGAAGATTGGACTTGGAATAGTACTGAGCCGAGAGGCTGATGGTGTGTGGGCTTACAACCGCAGCGATCATCCCATATTCGTCAACTCACCCACCTTAGATGCACCTGCCTGCCGCCCCCTTATGGTGAGAAAAGTGATGCCTGGATACTCCCTCAAAGTGTTTGATTACAAAAAGTCCTGTGTTCTGCGGCATCA
  5   1   2       bld Gas7      in                          XZG6683.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCCTCACCTGCTCTTGTGCAGACTCTTCCGCTGGCCAGAGTTGCAGCATCCCGGGCAACTGAAAGCCTTGTGTGGGTGCCAGGGAGCCGGGGGCTCGGAGAATAACAGTGTGTGCTGCAACCCCTACCATTACAGCAGGGTGTGCGGACCGGAGTCTCCACCACCACCTTATTCGCGCCTGTCTCCGAAAATTGAGCAGAAGCCTCTAGATCTCTCCGATTCATACACTGAAATGGAAGCCTCCAACTCACTGTGCATCACAGCTGGAGATATATCTGACACAAGCCTGTCTCCTGACATGAGCAAACAGGGCCACTGGTGCAGCGTTGCATACTGGGAGCATCGTACTCGCGTGGGCCGTCTCTATGCAGTGTGCCAGCCTTCAGTAAGCATTTTCTATGATCTACCTCAGGGAAGCGGCTTCTGTCTGGGCCAGCTGAATCTGGAAAACCGGAGTGAGGCAGCAGCCAGGACACGGGGGAAGATTGGACTTGGAATAGTACTGAGCCGAGAGGCTGATGGTGTGTGGGCTTACAACCGCAGCGATCATCCCATATTCGTCAACTCACCCACCTTAGATGCACCTGCCTGCCGCCCCCTAGTGGTGAGAAAGGTGATGCCTGGATACTCCCTCAAAGTGTTTGATTACAAAAAGTCCTGTGTTCTGCGGCATCACCCAACTCCACCAGAACATACAGATGGACCCTATGATCCCCACAGTGTCCGCATCAGCTTTGCCAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTTATC
  3   1   2       bld TbA       in                    TTbA049k18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTGGCCAGAGCTGCAGCATCCCGGGCAACTGAAAGCCTTGTGTGGGTGCCAGGGAGCCGGGGGCTCGGAGAATAACAGTGTGTGNTGCAACCCCTACCATTACAGCAGGGTGTGCGGACCGGAGTCTCCACCACCACCTTATTCGCGCCTGTCTCCGAAAATTGAGCAGAAGCCTCTAGATCTCTCCGATTCATACACTGAAATGGAAGCCTCCAACTCACTGTGCATCACAGCTGGAGATATATCTGGTACGTCGGCATCCAGTGAGCATTGAGTTTAATTGTCCTTGCCTTTTTTCTTTACCTTCAAATGACTAATGAAAAGGAAATATGCTATATGTTATAGGCCAGAATTATTTGCTTTTTTGTTAATGTTTTTAAAGAGAATAAACTTAAGACGGTCATATAAAATGCTACTATCAGTTTTTTGGTGCATGCTCAGTAGCACCAGGCCCAGCAGTCTGTGCAGCCCATAGGCAGGGTAGGGGCAGTATAGATGCCTTTGATGGCCTTATCTAGTCAGACCCCTTGTGATAGTAATTTACTAATAGAACACAGTAGTTTTCTACTTTATAGTTTTTAATCATAAGTGGCTGCCATTAATTGTGGCTTTAGTATATGCTTATGTAGACCATGGCTAAAGCTGGCTTCACATTAACTATTTTCATTTTATGTGGTCAAATTGCCTGTGAGATAATGGCTGACTGCGATTCGCCAACGAGTATAGATAACTAAATTGCATAGAATACATCTAATTGATTACTTCACAGCAGAAAAAAATCTTGGTGAGGCGTTTCACTCAAAAAAAAAAAAAAAAAGCG
  3   1   0       add Gas7      in                         XZG33615.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAATACAAATATTTCATCAGGCCTTTGGTAGACACTGGTCTCAGCCAGTATGAGCTATATAACATGTCAGACTCAAGAGAGAGCAAGACCAGATAATAATGTGCTTTAACAAATTTATCAATTCAGAGGACACTTCACTAACACATTTTTCTCTGCCTTCTGTTATCAGATCTCTCCGATTCATACACTGAAATGGAAGCCTCCAACTCACTGTGCATCACAGCTGGAGATATATCTGGTACGTCGGCATCCAGTGAGCATTGAGTTTAATTGTCCTTGCCTTTTTTCTTTACCTTCAAATGACTAATGAAAAGGAAATATGCTATATGTTATAGGCCAGAATTATTTGCTTTTTTGTTAATGTTTTTAAAGAGAATAAACTTAAGACGGTCATATAAAATGCTACTATCAGTTTTTTGGTGCATGCTCAGTAGCACCAGGCCCAGCAAGTCTGTGCAGCCCATAGGCAGGGTAGGGGCAGTATAGATGCCTTTGATGGCCTTATCTAGTCAGACCCCTTGTGATAGTAATTTACTAATAGAACACAGTAGTTTTCTACTTTATAGTTTTTAATCATAAGTGGCTGCCATTAATTGTGGCTTTAGTATATGCTTATGTAGACCATGGCTAAAGCTGGCTTCACATTAACTATTTTCATTTTATGTGGTCAAATTGCCTGTGAGATAATGGCTGACTGCAATTCGCCAACAAGTATAGATAACTAAATTGCATAGAATACATCTAATTGATTACTTCACAGCAGAAAAAAATCTTGGTGAGGCGTTTTCACTCT
  5   1   2       bld Neu0                               IMAGE:6993476                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCAACTCACTGTGCATCACAGCTGGAGATATATCTGACACAAGCCTGTCTCCTGACATGAGCAAACAGGGCCACTGGTGCAGCGTTGCATACTGGGAGCATCGTACTCGCGTGGGCCGTCTCTATGCAGTGTGCCAGCCTTCAGTAAGCATTTTCTATGATCTACCTCAGGGAAGCGGCTTCTGTCTGGGCCAGCTGAATCTGGAAAACCGGAGTGAGGCAGCAGCCAGGACACGGGGGAAGATTGGACTTGGAATAGTACTGAGCCGAGAGGCTGATGGTGTGTGGGCTTACAACCGCAGCGATCATCCCATATTCGTCAACTCACCCACCTTAGATGCACCTGCCTGCCGCCCCCTAGTGGTGAGAAAGGTGATGCCTGGATACTCCCTCAAAGTGTTTGATTACAAAAAGTCCTGTGTTCTGCGGCATCACCCAACTCCACCAGAACATACAGATGGACCCTATGATCCCCACAGTGTCCGCATCAGCTTTGCCAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTTGGCAGCAGTTACACCCTGAAAGAATTAAAGTGCAGAAAGGAAATCCCGCCTCTTCCCTTGTTTTACATAGAATAAATTTGCAGCCCTCCTCATGGAGACCCAGCCAGGAGGGCGCCATGTTTAATTTTGCC
  5   1   2       bld Neu0      in                       IMAGE:6991820                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTTTAAGACACAAGCCTGTCTCCTGACATGAGCAAACAGGGCCACTGGTGCAGCGTTGCATACTGGGAGCATCGTACTCGCGTGGGCCGTCTCTATGCAGTGTGCCAGCCTTCAGTAAGCATTTTCTATGATCTACCTCAGGGAAGCGGCTTCTGTCTGGGCCAGCTGAATCTGGAAAACCGGAGTGAGGCAGCAGCCAGGACACGGGGGAAGATTGGACTTGGAATAGTACTGAGCCGAGAGGCTGATGGTGTGTGGGCTTACAACCGCAGCGATCATCCCATATTCGTCAACTCACCCACCTTAGATGCACCTGCCTGCCGCCCCCTAGTGGTGAGAAAGGTGATGCCTGGATACTCCCTCAAAGTGTTTGATTACAAAAAGTCCTGTGTTCTGCGGCATCACCCAACTCCACCAGAACATACAGATGGACCCTATGATCCCCACAGTGTCCGCATCAGCTTTGCCAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAANAGAATTAAAGTGAGGAAAGGAATCAAGCTCTTTCCTTTTTACATAGAAATAATTGCAGCCCTCTCATGAGGACAGCCAGAGGCGCATGGTTATTTGGCTTGCATGCTGGTACCTTTCAAGCAATTGGCTCACTTTGTGCCCCCACTGCCTTGGGGGTCCTCCATTCCACAGAT
  5   1   2       bld Gas                            TGas094f03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCATCGTACTCTCGTGGGCCGTCTCTATGCACTGTGCCAACCTTCACTAAGCATTTTCTATGATCTACCTCAGGGAAACGGCTTCTGTCTGGGCCAGCTGAATCTGGAAAACC
  5   1   2       bld Neu       in                   TNeu132c20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGGGGCCCGGGGGTTTGTGATGCAGTGTGCCAGACATCAGGCGGCATTTTCTATGATCTACCTCAGGGAAGCGGCTTCTGTCTGGGCCAGCTGAATCTGGAAAACCGGAGTGAGGCAGCAGCCAGGACACGGGGGAAGATTGGACTTGGAATAGTACTGAGCCGAGAGGCTGATGGTGTGTGGGCTTACAACCGCGGCGATCATCCCATATTCGTCAACTCACCCACCTTATATGCACCTGCCTGCCGCCCCCTATGGTGAGAAAGGTGATGCCTGGATACTCCCTCAAAGTGTGTGATTACAAAAAGTGCTGTGTTCTGCGGCGTCACCCAACTCCACCAGAACATACAGATGGACCCTATGATCCCCACAGTGTGCGCATCAGCTTTGCCAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTGCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGAGGTGTGTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTGCGAGCCAATGTGTAACTCTTCCCTG
  3  -1   2       bld Ovi1      in                         CABI8734.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATAGGGCGAGAGGCCAGCCTTCAGTAAGCATTTTCTATGATCTACCTCAGGGAAGCGGCTTCTGTCTGGGCCAGCTGAATCTGGAAAACCGGAGTGAGGCAGCAGCCAGGACACGGGGGAAGATTGGACTTGGAATAGTACTGAGCCGAGAGGCTGATGGTGTGTGGGCTTACAACCGCAGCGATCATCCCATATTCGTCAACTCACCCACCTTAGATGCACCTGCCTGCCGCCCCCTAGTGGTGAGAAAGGTGATGCCTGGATACTCCCTCAAAGTGTTTGATTACAAAAAGTCCTGTGTTCTGCGGCATCACCCAACTCCACCAGAACATACAGATGGACCCTATGATCCCCACAGTGTCCGCATCAGCTTTGCCAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGANAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGNGTCTCCATCACAGA
  5   1   2       bld HeRe      in                     EC2CAA18DG04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGAAGCGGCTTCTGTCTGGGCCAGCTGAATCTGGAAAACCGGAGTGAGGCAGCAGCCAGGACACGGGGGAAGATTGGACTTGGAATAGTACTGAGCCGAGAGGCTGATGGTGTGTGGGCTTACAACCGCAGCGATCATCCCATATTCGTCAACTCACCCACCTTAGATGCACCTGCCTGCCGCCCCCTAGTGGTGAGAAAGGTGATGCCTGGATACTCCCTCAAAGTGTTTGATTACAAAAAGTCCTGTGTTCTGCGGCATCACCCAACTCCACCAGAACATACAGATGGACCCTATGATCCCCACAGTGTCCGCATCAGCTTTGCCAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAG
  5   1   2       bld Tad5      in                         XZT63209.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGACGCGTGGGCTGGGCCAGCTGAATCTGGAAAACCGGAGTGAGGCAGCAGCCAGGACACGGGGGAAGATTGGACTTGGAATAGTACTGAGCCGAGAGGCTGATGGTGTGTGGGCTTACAACCGCAGCGATCATCCCATATTCGTCAACTCACCCACCTTAGATGCACCTGCCTGCCGCCCCCTAGTGGTGAGAAAGGTGATGCCTGGATACTCCCTCAAAGTGTTTGATTACAAAAAGTCCTGTGTTCTGCGGCATCACCCAACTCCACCAGAACATACAGATGGACCCTATGATCCCCACAGTGTCCGCATCAGCTTTGCCAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGNGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCCTGTGCCATAATACATACATCAGGTGC
  5   1   2       bld TpA                            TTpA037k09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTGGGCTTACAACCGCAGCGATCATTCCCATATTCGTCAACTCACCCACCTTAGATGCACCTGCCTGCCGCCCCCTAGTGGTGAGAAAGGTGATGCCTGGATACTCCCTCAAAGTGTTTGATTACAAAAAGTCCTGTGTTCTGCGGCATCACCCAACTCCACCAGAACATACAGATGGACCCTATGATCCCCACAGTGTCCGCATCAGCTTTGCCAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGNGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAACCACAGATTCACACCACAAGGACTCTCACGAGCATCATGATCTAGATTTATA
  5   1   2       bld Tad5      in                         XZT46654.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGCTTACAACCGCAGCGATCATCCCATATTCGTCAACTCACCCACCTTAGATGCACCTGCCTGCCGCCCCCTAGTGGTGAGAAAGGTGATGCCTGGATACTCCCTCAAAGTGTTTGATTACAAAAAGTCCTGTGTTCTGCGGCATCACCCAACTCCACCAGAACATACAGATGGACCCTATGATCCCCACAGTGTCCGCATCAGCTTTGCCAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTAT
  3   1   2       bld Neu0 5g3  in                       IMAGE:6992572                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACTAGTCACATGTTTGCCAAGGGCTGGGGCCCATGTATTCCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCNTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAAATGTGTATAGA
  3   1   2       bld Neu0      in                       IMAGE:6991820                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTGATTACAAAAAATTCCTGTGTTCTGCGGCATCACCCAAACTCCCCCGGAACATACAGATGGACCCTATGATTCCCACAGTGTCCGCATCAGCTTTGCCAGGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACTTCTTGCCCTTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAAGG
  5   1   2       bld Egg       in                   TEgg056a13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGCATCACCCAACTCCACCAGAACATACAGATGGACCCTATGATCCCCACAGTGTCCGCATCAGCTTTGCCAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCT
  3   1   2       chi Neu0      in                       IMAGE:6991949                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTGTGAGCGGTCCNAAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATAG
  3   1   2       bld Egg       in                    TEgg056a13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGCCAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTGGCTTTAAAAAAAAAAAAAAA
  3   1   2       bld Ovi1 5g3  in                         CABI2291.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCCAAGGGCTGGGGCCCATGTTATCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTNTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTA
  3   1   2       bld Neu       in                    TNeu132c20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAGGGCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGGACTAAAATACAATAAAATGCACTTTGGCTTTAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ova1      in                         CABE5959.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTGGGGCCCATGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGC
  3   1   2       bld HeRe      in                     EC2CAA18DG04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGTGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGT
  3   1   2       bld Gas  5g3  in                    TGas089h08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTTTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTTTGTTTTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATAGAATAAAATGCACTTGGCTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2      seed Ova1      in                         CABE5959.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCNCCTGCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTT
  5  -1   2       bld Ovi1      in                         CABI8734.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTNTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAAACGAATCGATGG
  3   1   2       bld Neu  5x3  out                   TNeu118b13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGGCTGGAGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTATGTTTCTTTACTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                          XZG6683.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGTCCTACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTT
  3   1   2       bld Brn3 5g3  in                        CAAK10282.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTGGGACGATAGTGGCCTGTGTTGGCTTTATCCCTAAGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTT
  3   1   2       bld Thy1      in                       CBST12974.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGAAGGATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAATTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTT
  3   1   2       bld Te5       in                         CAAO8355.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTT
  3   1   2       bld Gas7 5g3  in                         XZG19139.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATGTGTTTTTTCTTCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAAAAAAAAAATC
  3   1   2       bld Tad5      in                         XZT46654.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCACTTTGAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATATTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas8 5g3  in                          st22k05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGCAGATAACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATAT
  3  -1   2       bld Gas5                                  XZF1402.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCCGATACAGAGTGTGTACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAANANAAAAAAAAAAANAAAA
  5   1   2       bld HdA       in                   THdA019k15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTT
  3   1   2       bld HdA       in                    THdA019k15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACGAGCCAATGTTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTAAAAAAAAAAAAAAAGCG
  3   1   2       bld HeRe                             EC2CAA11CC04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTAACTCTTCCCTGAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGTGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATGTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTACGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGT
  3   1   2       bld Gas7 5g3  in                         XZG14699.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAAAAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas  5g3  in                    TGas117e15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATCGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATTGAANCTAAAATACAATANAAATGCACTTTGGCTTTTATAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA066b19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGGGGTATGCAGGTATTTAAGCAGCTAATAGCACTGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTGTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAAGGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAAGGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTAAAAAAAAAAAAAAAAAAAAAGC
  5   1   2       bld Neu                            TNeu001g13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGATTAAACAGCTAATAGCACTGCACAATATGGGTGGGCAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCGTGGTGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTGAAAGGCGTGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTANAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTGTATATATTATA
  3  -1   2       bld Gas5                                  XZF1298.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCACAATATGTATTGACAACGCATTTCACACCTCTCTGTCTGAAGATGGTGCCTTTGGCAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCACATGTTATTTGCTGCATGCTGTACCTTCAGGATTGCTCACTTGTGACCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCACGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGCGGGTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAAGACTCTCACGAGCATCACGATCTAGATTGAATATCAAATGTATA
  3   1   2       bld Gas8 5g3  in                          st91m12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGATGGTGCCTNTGGCAGCAGTTACACCTGAAAGAANTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTNTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATGTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCNTGGGTNTCCATCACAGATTGGGTTAAAGGCANGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACANACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGNTATTCANTNNTCTATGNTATTNTGCCNTGTGATGAAAGCCTCTNGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATACNATATGGAAATATATATATTATACCTGTAAATAGGGAGTCATC
  3   1   2       bld Gas7 5g3  in                         XZG23760.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCAGTTACACCTGAAAGAATTAAAGTGAGAAAGGAATCCAGCTCTTCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGCGCATGTTATTTGCTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTCTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld HdA  5g3  in                    THdA039d10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCTTTTTACATAGAATAATTGCAGCCTCTCATGAGACCAGCAGAGGGGCATGTTATTTGGTGCATGCTGTACCTTCAGCATTGCTCACTTGTGCCCACTGCTTGGGTTTCCATCACAGATTGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAAAGGGGCGGTTTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGGTGCAGAAATGCAGAATCCTTTGCTATTCATTTTTTTATGCTATTTTGCCATGTGATGAAAGCCTTTAGAAGTTATGGGGTTCATTTTTTTTTTTTGCGGCCCAGGGTAAAACTAACCCATAAAAACCACAGATTCACCCCCACAAAGGATTTTCACGAGCATCATGATTTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGGGTCATTTTTACAAGGTAATTATTTATGTATGGGGCAATGGGTATTTGAACTAAAATACAATAAAATGCACTTTGGCTTTTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  3   1   2       bld Gas7                                 XZG14761.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGGTTAAAGGCATGCCTCCCTCTGCCCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATACATCAGGTGCCATGTTGTTGAATTCCTTTGGTGCTGCAGAACTGCAGAATCCTTTGCTATTCATTTTTCTATGCTATTCTGCCATGTGATGAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Tad5      in                         XZT63209.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTCTGCAGCACAGAGTAAAACTAACCCATAAAAACCACAGATTCACCACCACAAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)