Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-IMAGE:7004834.5                     100 END     1           1        1                retinoc acid receptor gamma B [Xenopus laevis]
     2   2.0    0Xt7.1-CABG4413.5.5                         66 END     1           1        1                beta-2 microglobulin [Xenopus laevis]
     3   1.0    0Xt7.1-CAAJ13713.3                          28 END     2           2        7                (no blast hit)
     4   2.0    0Xt7.1-CAAK11467.3                          25 END     2           2        8                (no blast hit)
     51.6699999999999999    0Xt7.1-CAAJ12636.5                          13 END     12         13      100                Unknown (protein for MGC:146050) [Xenopus tropicalis]
     6   2.0    0Xt7.1-CAAJ14423.3                          13 END     1           1        7                (no blast hit)
     7   2.0    0Xt7.1-TEgg026p19.5                          5 END     3           3       60                Unknown (protein for MGC:146050) [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     8 200.0    0Xt7.1-CAAK2054.5                            6 PI      80       2094     2342                PREDICTED: similar to Plexin A3 precursor (Plexin 4) (Transmembrane protein sex) [Danio rerio]
     9 288.0    0Xt7.1-CAAK5042.5                            6 PI      77       1962     2448                PREDICTED: similar to plexin A2 [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012072953 Xt7.1-CAAJ12636.3 - 92 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAJ12636.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAGCGGGGGAACCCCTCTCATAGTAACTGGGCTGAATCTGGCAACTATTAAAGAACCCAAAATAAGAGCAAAATATGGAGATGCAGAGAGAGAAAATAACTGCACTGTGTACAATGACACCACCATGGTGTGCTTGGCTCCCTCCGTTGAGAATCCCTTGAGGAGCCCGCCAGAGAATGGGGACCGTCCCGATGAGATAGGTTTCATAATGGACAACGTTCTGGCCCTCCTTATTGTGAACACTACCAGCTTTCTGTATTACCCAGATCCTGTGTTTGAGCCACTGACGGCATCTGGAAACCTTGAGCTGAAGCCCAGCTCTCCTCTTATAATCAAGGGTCGGAATCTCATTCCAGCAGCCCCAGGGAACTTCAGGCTTAATTATACAGTGTTGATTGGTGACACACCGTGTGCCCTTACTGTCTCTGAGACCCAGCTCCTGTGCGAGTCTCCGAACCTTACTGGACAGCACAAAGTCACTATTAAAGCCGGAGGGTTTGAGTACTCACCGGGCACACTGCAGATTTACTCGGACAGCCTGCTGACCTTGCCTGCCATCATTGGAATTGGAGGAGGAGGTGGTTTGCTCTTGCTCATTATAATCATTGTGCTTATTGCCTACAAGAGGAAATCGCGGGATGCTGACCGTACCCTGAAACGGTTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTCGCTGAGCTGCAGACTGACATCCATGAGCTGACCAACGACCTCGATGGGGCTGGAATCCCTTTCCTGGATTACCGTACATACGCCATGCGAGTCCTTTTCCCCGGAATCGAGGATCATCCTGTTCTGAAGGAAATGGAGGTACAAGCCAATGTTGAGAAGTCCCTGACGCTGTTTGGGCAGCTCCTCACCAAGAAGCACTTCCTGCTCACCTTCATTCGCACACTGGAGGCCCAGAGAAGCTTCTCTATGAGAGACAGGGGGAACGTGGCTTCACTCATCATGACGGCGTTGCAGGGGGAGATGGAATATGCCACCGGGGTTCTCAAGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTTGAAAGCAAAAACCACCCCAAGCTGCTGCTGAGGAGGACAGAGTCTGTGGCTGAGAAGATGCTGACGAACTGGTTCACATTTCTCCTCTACAAGTTCTTAAAGGAATGTGCCGGTGAGCCGCTCTTCATGCTGTACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACAGGAGAGGCCCGCTACTCGCTGAGTGAGGACAAGCTGATCCGTCAGCAGATCGACTACAAGACACTGACCCTAAACTGTGTGAACCCTGAGAATGAGAATGCCCCTGAAATCCCTGTCAAGGTGCTGAACTGTGACACCATAACCCAAGTGAAGGAGAAACTGCTTGATGCTGTGTATAAAGGCGTTCCATACTCCCAGCGACCCAAGGCAGGAGACATGGACCTGGAATGGCGTCAGGGTAGGATGGCACGCATTATACTGCAAGATGAGGATGTGACGACCAAGATAGACAATGACTGGAAACGACTGAACACATTGGCGCATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTCAAACTCATCGACGTTTACAAAGTCCCTGAGCAGATACGAGAGTATGCTACGGACCGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAACAAGAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATGAAAAAGGCAAAAAAAGGTGTTTTTGTGTTTCTGGAAAACCACAATCGAAAAAACCACTCCGCAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCATGTTTCCTTTGAATGTCGTTTTAGTGAATAAAAATGGGGAAAAAAATAATGAATAAAGAAGAAACTCTAATTGTGAAACATGGGGGAGGGAGATGTTCCGGAAAGGGGCGGACCACCCTCGGCTACGGAGCGGTCACAGGAACTACCGTGGAAACCTGGAAAGAAAAGTTACATTTCAAGTTTCTTAGGAAACCCATCCACCCCCCCATT
                                                  Xt7.1-CHK-1008223468                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGAACCCCTCTCATAGTAACTGGGCTGAATCTGGCAACTATTAAAGAACCCAAAATAAGAGCAAAATATGGAGATGCAGAGAGAGAAAATAACTGCACTGTGTACAATGACACCACCATGGTGTGCTTGGCTCCCTCCGTTGAGAATCCCTTGAGGAGCCCGCCAGAGAATGGGGACCGTCCCGATGAGATAGGTTTCATAATGGACAACGTTCTGGCCCTCCTTATTGTGAACACTACCAGCTTTCTGTATTACCCAGATCCTGTGTTTGAGCCACTGACGGCATCTGGAAACCTTGAGCTGAAGCCCAGCTCTCCTCTTATAATCAAGGGTCGGAATCTCATTCCAGCAGCCCCAGGGAACTTCAGGCTTAATTATACAGTGTTGATTGGTGACACACCGTGTGCCCTTACTGTCTCTGAGACCCAGCTCCTGTGCGAGTCTCCGAACCTTACTGGACAGCACAAAGTCACTATTAAAGCCGGAGGGTTTGAGTACTCACCGGGCACACTGCAGATTTACTCGGACAGCCTGCTGACCTTGCCTGCCATCATTGGAATTGGAGGAGGAGGTGGTTTGCTCTTGCTCATTATAATCATTGTGCTTATTGCCTACAAGAGGAAATCGCGGGATGCTGACCGTACCCTGAAACGGTTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTCGCTGAGCTGCAGACTGACATCCATGAGCTGACCAACGACCTCGATGGGGCTGGAATCCCTTTCCTGGATTACCGTACATACGCCATGCGAGTCCTTTTCCCCGGAATCGAGGATCATCCTGTTCTGAAGGAAATGGAGGTACAAGCCAATGTTGAGAAGTCCCTGACGCTGTTTGGGCAGCTCCTCACCAAGAAGCACTTCCTGCTCACCTTCATTCGCACACTGGAGGCCCAGAGAAGCTTCTCTATGAGAGACAGGGGGAACGTGGCTTCACTCATCATGACGGCGTTGCAGGGGGAGATGGAATATGCCACCGGGGTTCTCAAGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTTGAAAGCAAAAACCACCCCAAGCTGCTGCTGAGGAGGACAGAGTCTGTGGCTGAGAAGATGCTGACGAACTGGTTCACATTTCTCCTCTACAAGTTCTTAAAGGAATGTGCCGGTGAGCCGCTCTTCATGCTGTACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACAGGAGAGGCCCGCTACTCGCTGAGTGAGGACAAGCTGATCCGTCAGCAGATCGACTACAAGACACTGACCCTAAACTGTGTGAACCCTGAGAATGAGAATGCCCCTGAAATCCCTGTCAAGGTGCTGAACTGTGACACCATAACCCAAGTGAAGGAGAAACTGCTTGATGCTGTGTATAAAGGCGTTCCATACTCCCAGCGACCCAAGGCAGGAGACATGGACCTGGAATGGCGTCAGGGTAGGATGGCACGCATTATACTGCAAGATGAGGATGTGACGACCAAGATAGACAATGACTGGAAACGACTGAACACATTGGCGCATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTCAAACTCATCGACGTTTACAAAGTCCCTGAGCAGATACGAGAGTATGCTACGGACCGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAACAAGAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATGAAAAAGGCAAAAAAAGGTGTTTTTGTGTTTCTGGAAAACCACAATCGAAAAAACCACTCCGCAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCATGTTTCCTTTGAATGTCGTTTTAGTGAATAAAAATGGGGAAAAAAATAATGAATAAAGAAGAAACTCTAATTGTGAAACATGGGGGAGGGAGATGTTCCGGAAAGGGGCGGACCACCCTCGGCTACAGAGCGGTCACAGGAACTACCGTGGAAACCTGGAAAGAAAAGTTACATTTCAAGTTTCTTAGGAAACCCATCCACCCCCCCATTCTGTTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     6     6     8     8     8     8     9     9     9     9     9     9     9     9     9    10     9    11    10    10     8    10    10    10     8     8     9     9     9     9     8     9     6     9     7     9     7     9     7    10     6    10     7    10     7    10     7    10     8    10     7    10     8    11     7    11     8    12    10    14     9    14     9    13     9    13    10    13     8    12     9    12    10    13    10    13     9    13    10    13     9    12     9    12     9    12     8    12     9    12     9    12     9    12     9    12     9    12     9    13     9    13    10    14    10    14     9    13     9    13     9    12     9    11     9    10     9    10     9    10     9    10     9    10     9    10     9    10     8    10     7    10     7    10     7    10     7    10     7    10     9    12     9    12    12    15    12    15    12    15    13    16    13    16    13    16    13    16    13    15    13    15    12    14    12    14    12    14    11    13    12    14    11    14    14    16    15    16    15    16    14    15    14    15    13    15    13    15    13    15    13    16    14    16    14    16    15    16    14    15    15    15    15    15    15    15    14    15    15    15    15    15    15    15    15    16    17    17    17    17    17    18    17    18    17    18    18    18    19    20    19    20    19    20    20    21    21    21    21    21    21    22    20    23    20    22    20    22    20    24    24    24    25    26    24    26    28    29    30    30    31    31    29    32    33    33    34    35    35    36    37    37    38    39    38    39    39    40    38    40    38    40    41    41    38    39    37    37    37    39    39    41    39    42    43    44    44    44    41    44    43    44    43    43    41    43    45    46    44    46    45    47    48    49    48    49    47    49    48    49    46    49    46    48    47    48    46    48    46    48    46    48    44    48    43    48    46    48    44    47    44    48    47    48    46    47    47    48    46    48    44    47    45    47    40    43    42    43    43    44    43    44    41    44    40    45    40    44    41    44    43    45    44    45    42    45    44    45    44    45    40    45    43    45    44    45    42    45    40    42    36    39    28    30    12    22    13    20    13    18    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    10    13    10    13     9    12     7    10     4     7     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -C------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------A----
                                                                       ...PREDICTED - Sp ---- 8e-122     XP_785698.2 PREDICTED: similar to plexin A2 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 8e-168     NP_500018.3 PLeXin family member (plx-1) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 0          NP_726627.1 plexin A CG11081-PB [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Dr ---- 0          XP_695809.1 PREDICTED: similar to Plexin A3 precursor (Plexin 4) (Transmembrane protein sex) [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_414370.2 PREDICTED: similar to plexin [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_032907.1 plexin A1; plexin 1 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_115618.2 plexin A1; plexin 1 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAH84782.1 LOC495321 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          AAI33057.1 Unknown (protein for MGC:146050) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 0          NP_001090760.1 hypothetical protein LOC100037845 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAJ12636.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------TGA---------------------------------------------------------------------TGA---------------------------------------------------------ATG---------------TAA---------------------------------------TAA------TAG---------------ATG---TAG---------TAA------------TAA---------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------TAG---TAA---------------------TGA------------------------------------------------------------------ATG---TGA---------------------------------------------------------------ATG---------------TAA---------------------------TAG---------------ATG---------------------------------------------------TAA------------------------------------ATG------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2       bld Fat1      in                         CABC6869.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAAGATCCAACCGTGCAAAAGATAGAACCAGAGTGGAGCATCGCCAGCGGGGGAACCCCTCTCATAGTAACTGGGCTGAATCTGGCAACTATTAAAGAACCCAAAATAAGAGCAAAATATGGAGATGCAGAGAGAGAAAATAACTGCACTGTGTACAATGACACCACCATGGTGTGCTTGGCTCCCTCCGTTGAGAATCCCTTGAGGAGCCCGCCAGAGAATGGGGACCGTCCCGATGAGATAGGTTTCATAATGGACAACGTTCTGGCCCTCCTTATTGTGAACACTACCAGCTTTCTGTATTACCCAGATCCTGTGTTTGAGCCACTGACGGCATCTGGAAACCTTGAGCTGAAGCCCAGCTCTCCTCTTATAATCAAGGGTCGGAATCTCATTCCAGCAGCCCCAGGGAACTTCAGGCTTAATTATACAGTGTTGATTGGTGACACACCGTGTGCCCTTACTGTCTCTGAGACCCAGCTCCTGTGCGAGTCTCCGAACCTTACTGGACAGCACAAAGTCACTATTAAAGCCGGAGGGTTTGAGTACTCACCGGGCACACTGCAGATTTACTCGGACAGCCTGCTGACCTTGCCTGCCATCATTGGAATTGGAGGAGGAGGTGGTTTGCTCTTGCTCATTATAATCATTGTGCTTATTGCCTACAAGAGGAAATCGCGGGATGCTGACCGTACCCTGAAACGGTTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTCGCTGAGCTGCAGACTGACATCCATGAGCTGACCAACGACCTCGATGGGGCTGGAATCCCTTTCCTGGATTACCGTACATACGCCATGCGAGTCC
  5   1   0   14  add Brn2 5g3  out                       CAAJ11612.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGGAACCAGCCTGGAGTATCCTCAATGGCAGCACCTGGATCACTGTGAGCGGCGCCCACCTTTCCACCATTCAAGAGCCGCAGGTTCGAGCCAAATATTCCGGAATTGAGACCATCAATTCCTGTCAGGCAGTGAATGACACGTTGATGCTCTGCAAGGCTCCGGGGATCTACAGCCCAAGTGGGGAAACTGTTCTAGAGGAGGGTTTGCAGCCAGATGAGTTTGGCTTTCTACTGGATAATGTCACCAGCCTCCGTACCCTGAACTCCACCATATTCACTTACTATCCCAACCCCACCCTGGAATCCTTTGGGCCGAGCGGAACCTTGGAGATTAAACCAGGATCTCATGTTATCCTTAAGGGAAAGAATCTGCTTCCAGCAGCCCCAGGAGGGGCCAAGTTGAACTACACGGTGCTGATAGGGGAGCAGCCCTGCTCTCTGACTGTGTCCGACACCCAACTGCTATGTGACTCTCCCAGCCAAACAGGAGAACATAAAGTCACAATTTTGGTTGGAGGGATGCAGTTCTCGCCGGGCAGCCTGAGGATTTATGCTGACAGCTCCCTCACCCTGCCAGCCATAGTGGGCATTGGGGCCGGAGGGGGGTTACTGCTCCTTGCTATTATTGTGGTTCTCATCGCCTACAAGAGAAAGACAAGAGATGCAGATCGTACCCTGAAGAGGCTTCAGATGCAGATGGACAATTTGGAGTCGCGTGTTGCCCTTGAGTGCAAAGAGGCATTTGCTGAGCTCCAGACGGACATCAATGAGCTGACCAACAACATGGATGGGGTTAAGATCCCCTTTCTGGAGTACAAAACGTACGCCATGCGAGTGCTTTT
  5   1   2       bld Brn3      in                        CAAK11232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGAGCATCGCCAGCGGGGGAACCCCTCTCATAGTAACTGGGCTGAATCTGGCAACTATTAAAGAACCCAAAATAAGAGCAAAATATGGAGATGCAGAGAGAGAAAATAACTGCACTGTGTACAATGACACCACCATGGTGTGCTTGGCACCCTCCGTTGAGAATCCCTTGAGGAGCCCGCCAGAGAATGGGGACCGTCCCGATGAGATAGGTTTCATAATGGACAACGTTCTGGCCCTCCTTATTGTGAACACTACCAGCTTTCTGTATTACCCAGATCCTGTGTTTGAGCCACTGACGGCATCTGGAAACCTTGAGCTGAAGCCTAGCTCTCCTCTTATAATCAAGGGTCGGAATCTCATTCCAGCAGCCCCAGGGAACTTCAGGCTTAATTATACAGTGTTGATTGGTGACACACCGTGTGCCCTTACTGTCTCTGAGACCCAGCTCCTGTGCGAGTCTCCGAACCTTACTGGACAGCACAAAGTCACTATTAAAGCCGGAGGGTTTGAGTACTCACCGGGCACACTGCAGATTTACTCGGACAGCCTGCTGACCTTGCCTGCCATCATTGGAATTGGAGGAGGAGGTGGTTTGCTCTTGCTCATTATAATCATTGTGCTTATTGCCTACAAGAGGAAATCGCGGGATGCTGACCGTACCCTGAAACGGTTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTCGCTGAGCTGCAGACTGACATCCATGAGCTGACCAACGACCTCGATGGGGCTGGAATCCCTTTCCT
  5   1   2       bld Abd0                               IMAGE:7017854                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACCCAGCTCCTGTGCGAGTCTCCGAACCTTACTGGACAGCACAAAGTCACTATTAAAGCCGGAGGGTTTGAGTACTCACCGGGCACACTGCAGATTTACTCGGACAGCCTGCTGACCTTGCCTGCCATCATTGGAATTGGAGGAGGAGGTGGTTTGCTCTTGCTCATTATAATCATTGTGCTTATTGCCTACAAGAGGAAATCGCGGGATGCTGACCGTACCCTGAAACGGTTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTCGCTGAGCTGCAGACTGACATCCATGAGCTGACCAACGACCTCGATGGGGCTGGAATCCCTTTCCTGGATTACCGTACATACGCCATGCGAGTCCTTTTCCCCGGAATCGAGGATCATCCTGTTCTGAAGGAAATGGAGGTACAAGCCAATGTTGAGAAGTCCCTGACGCTGTTTGGGCAGCTCCTCACCAAGAAGCACTTCCTGCTCACCTTCATTCGCACACTGGAGGCCCAGAGAAGCTTCTCTATGAGAGACAGGGGGAACGTGGCTTCACTCATCATGACGGCGTTGCAGGGGGAGATGGAATATGCCACCGGGGTTCTCAAGCAGCTTCTCTCCGACCTCTTTGAGAAGAATCTTGAAAGCAAAGACCACCCCAAGCTGCTGCTGAGGAGGACAGAATCTGTGGCTGAAAAAAGCTGACCAACTGGTT
  5   1   2       chi Tad5      in                          XZT9309.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGCCTGCTGACCTTGCCTGCCATCATTGGAATTGGAGGAGGAGGTGGTTTGCTCTTGCTCATTATAATCATTGTGCTTATTGCCTACAAGAGGAAATCGCGGGATGCTGACCGTACCCTGAAACGGTTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTCGCTGAGCTGCAGACTGACATCCATGAGCTGACCAACGACCTCGATGGGGCTGGAATCCCTTTCCTGGATTACCGTACATACGCCATGCGAGTCCTTTTCCCCGGAATCGAGGATCATCCTGTTCTGAAGGAAATGGAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCANATCATTTATGCGTAGCATTTTTGTTGCANATAAGTTTTTTTTACTAAACGAATTAAAGAAATTTAAGT
  5   1   2       bld BrSp      in                     EC2BBA13DB10.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGAAATCGCGGGATGCTGACCGTACCCTGAAACGGTTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTCGCTGAGCTGCAGACTGACATCCATGAGCTGACCAACGACCTCGATGGGGCTGGAATCCCTTTCCTGGATTACCGTACATACGCCATGCGAGTCCTTTTCCCCGGAATCGAGGATCATCCTGTTCTGAAGGAAATGGAGGTACAAGCCAATGTTGAGAAGTCCCTGACGCTGTTTGGGCAGCTCCTCACCAAGAAGCACTTCCTGCTCACCTTCATTCGCACACTGGAGGCCCAGAGAAGCTTCTCTATGAGAGACAGGGGGAACGTGGCTTCACTCATCATGACGGCGTTGCAGGGGGAGATGGAATATGCCACCGGGGTTCTCAAGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTTGAAAGCAAAAACCACCCCAAGCTGCTGCTGAGGAGGACAGAGTCTGTGGCTGAGAAGATGCTGACGAACTGGTTCACGTTTCTCCTCTACAAGTTCTTAAAGGAATGTGCCGGTGAGCCGCTCTTCATGCTGTACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACAGGAGAGGCCCGCTACTCGCTGAGTGAGGACAAGCTGATCCGTCAGC
  5   1   2       bld Ovi1      in                         CABI4686.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGAGGGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTCGCTGAGCTGCAGACTGACATCCATGAGCTGACCAACGACCTCGATGGGGCTGGAATCCCTTTCCTGGATTACCGTACATACGCCATGCGAGTCCTTTTCCCCGGAATCGAGGATCATCCTGTTCTGAAGGAAATGGAGGTACAAGCCAATGTTGAGAAGTCCCTGACGCTGTTTGGGCAGCTCCTCACCAAGAAGCACTTCCTGCTCACCTTCATTCGCACACTGGAGGCCCAGAGAAGCTTCTCTATGAGAGACAGGGGGAACGTGGCTTCACTCATCATGACGGCGTTGCAGGGGGAGATGGAATATGCCACCGGGGTTCTCAAGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTTGAAAGCAAAAACCACCCCAAGCTGCTGCTGAGGAGGACAGAGTCTGTGGCTGAGAAGATGCTGACGAACTGGTTCACATTTCTCCTCTACAAGTTCTTAAAGGAATGTGCCGGTGAGCCGCTCTTCATGCTGTACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACAGGAGAGGCCCGCTACTCGCTGAGTGAGGACAAGCTGATCCGTCAGCAGATCGACTACAAGACACTGACCCTAAACTGTGTGAACCCTGAGAATGAGAATGCCCCTGAAATCCCTGTCAAGGTGCTGAACTGTGACACCATAACCCAAGTGAAGGAGAAACTGCTTGATGCTGTATAAAGGCGTTCCATACTCCCAGCGACCCAAGGCAGGAGACATGGACCTGGAATGGCGTCAGGGTAGGATGGC
  5   1   2       chi Brn3      out                         CAAK584.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTGGAGTCGCGTGTTGCCCTTGAGTGCAAAGAGGCATTTGCTGAGCTCCAGACGGACATCAATGAGCTGACCAACAACATGGATGGGGTTAAGATCCCCTTTCTGGAGTACAAAACGTACGCCATGCGAGTGCTTTTCCCAGGGATAGAGGACCACCCCGTTCTCAAGGAGTCAGATGTCCCCTCCAATGTGGAGAAAGCCCTGCGGCTCTTTGGGCAGCTCCTGAATAACAAAACCTTTCTGCTGACGTTTATCCACACGCTTGAGAGTCAGCGAAGCTTCTCTATGCGCGACCGAGGCAATGTGGCGTCTCTGACTATGGTGGCCCTGCAGGGAAGGATGGAGTATGCCACTGTCTTACTCAAGCAGCTTCTCAGCGACCTCATTGAAAAGAACTTGGAGAGTAAAAACCACCCCAAACTGCTCCTGCGCAGGACAGAGTCTGTAGCAGAGAAGATGCTGACAAACTGGTTCACCCTTTCTGCTCTATAAGTTTCTGAAGGAGTGTGCCGGGGAGCCCCTCTTCATGCTTTTCTGTGCCATCAAGCAACAGATGGAAAAGGGACCCATAGATGCCATCACTGGGGAGGCGCGGTACTCACTGAGCGAAGATAAAACTCATCCGGCAGCAGATCGACTACAAGAATGCTACCCTCAGTTGTGTTTGCC
  3   1   2       chi Tad5      in                          XZT9309.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGTGCAAAGAAGCCTTCGCTGAGCTGCAGACTGACATCCATGAGCTGACCAACGACCTCGATGGGGCTGGAATCCCTTTCCTGGATTACCGTACATACGCCATGCGAGTCCTTTTCCCCGGAATCGAGGATCATCCTGTTCTGAAGGAAATGGAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGGGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGGCGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAA
  3   1   2       bld BrSp      in                     EC2BBA26CG07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGACCTCGATGGGGCTGGAATCCCTTTCCTGGATTACCGTACATACGCCATGCGAGTCCTTTTCCCCGGAATCGAGGATCATCCTGTTCTGAAGGAAATGGAGGTACAAGCCAATGTTGAGAAGTCCCTGACGCTGTTTGGGCAGCTCCTCACCAAGAAGCACTTCCTGCTCACCTTCATTCGCACACTGGAGGCCCAGAGAAGCTTCTCTATGAGAGACAGGGGGAACGTGGCTTCACTCATCATGACGGCGTTGCAGGGGGAGATGGAATATGCCACCGGGGTTCTCAAGCA
  5   1   2       bld BrSp      in                     EC2BBA26CG07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGACCTCGATGGGGCTGGAATCCCTTTCCTGGATTACCGTACATACGCCATGCGAGTCCTTTTCCCCGGAATCGAGGATCATCCTGTTCTGAAGGAAATGGAGGTACAAGCCAATGTTGAGAAGTCCCTGACGCTGTTTGGGCAGCTCCTCACCAAGAAGCACTTCCTGCTCACCTTCATTCGCACACTGGAGGCCCAGAGAAGCTTCTCTATGAGAGACAGGGGGAACGTGGCTTCACTCATCATGACGGCGTTGCAGGGGGAGATGGAATATGCCACCGGGGTTCTCAAGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTTGAAAGCAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Brn2      in                        CAAJ16645.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGAATCGAGGATCATCCTGTTCTGAAGGAAATGGAGGTACAAGCCAATGTTGAGAAGTCCCTGACGCTGTTTGGGCAGCTCCTCACCAAGAAGCACTTCCTGCTCACCTTCATTCGCACACTGGAGGCCCAGAGAAGCTTCTCTATGAGAGACAGGGGGAACGTGGCTTCACTCATCATGACGGCGTTGCAGGGGGAGATGGAATATGCCACCGGGGTTCTCAAGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTTGAAAGCAAAAACCACCCCAAGCTGCTGCTGAGGAGGACAGAGTCTGTGGCTGAGAAGATGCTGACGAACTGGTTCACATTTCTCCTCTACAAGTTCTTAAAGGAATGTGCCGGTGAGCCGCTCTTCATGCTGTACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACAGGAGAGGCCCGCTACTCGCTGAGTGAGGACAAGCTGATCCGTCAGCAGATCGACTACAAGACACTGACCCTAAACTGTGTGAACCCTGAGAATGAGAATGCCCCTGAAATCCCTGTCAAGGTGCTGAACTGTGACACCATAACCCAAGTGAAGGAGAAACTGCTTGATGCTGTGTATAAAGGCGTTCCATACTCCCAGCGACCCAAGGCAGGAGACATGGACCTGGAATGGCGTCAGGGTAGGATGGCACGCATTATACTGCAAGATGAGGATGTGACGACCAAGATAGACAATGACTGGAAACGACTGAACACATTGGCGCATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTCAAACTCATCGACGTTTACAAAGTCCCTGAGC
  5   1   2       bld TpA                            TTpA040h05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCTCCTCACCAAGAAGCACTTCCTGGCTCACCTTCATTCGCACACTGGAGGCCCAGAGAAGCTTCTCTATGAGAGACAGGGGGAACGTGGCTTCACTCATCATGACGGCGTTGCAGGGGGAGATGGAATATGCCACCGGGGTTCTCAAGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTTGAAAGCAAAAACCACCCCAAGCTGCTGCTGAGGAGGACAGAGTCTGTGGCTGAGAAGATGCTGACGAACTGGTTCACATTTCTCCTCTACAAGTTCTTAAAGGAATGTGCCGGTGAGCCGCTCTTCATGCTGTACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACAGGAGAGGCCCGCTACTCGCTGAGTGAGGACAAGCTGATCCGTCAGCAGATCGACTACAAGACACTGACCCTAAACTGTGTGAACCCTGAGAATGAGAATGCCCCTGAAATCCCTGTCAAGGTGCTGAACTGTGACACCATAACCCAAGTGAAGGAGAAACTGCTTGATGCTGTGTATAAAGGCGTTCCATACTCCCAGCGACCCAAGGCAGGAGACATGGACCTGGAATGGCGTCAGGGTAGGATGGCACGCATTATACTGCAAGATGAGGATGTGACGACCAAGATAGACAATGACTGGAAACGACTGAACACATTGGCGCATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTCANACTCATCGACGTTTACAAAGTCCCTGAGCAGATACGAGAGTATGCTACGGACCGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCT
  5   1   2       bld Egg       in                   TEgg064l18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGCTCTCTGCGGCTCTCTGCGGCTCTCTGCGGCTCTCTGCGGCTCTCTGCGGCTCTCTGCGGCTCTCTGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTTGAAAGCAAAAACCACCCCAAGCTGCTGCTGAGGAGGACAGAGTCTGTGGCTGAGAAGATGCTGACGAACTGGTTCACATTTCTCCTCTACAAGTTCTTAAAGGAATGTGCCGGTGAGCCGCTCTTCATGCTGTACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACAGGAGAGGCCCGCTACTCGCTGAGTGAGGACAAGCTGATCCGTCAGCAGATCGACTACAAGACACTGACCCTAAACTGTGTGAACCCTGAGAATGAGAATGCCCCTGAAATCCCTGTCAAGGTGCTGAACTGTGACACCATAACCCAAGTGAAGGAGAAACTGCTTGATGCTGTGTATAAAGGCGTTCCATACTCCCAGCGACCCAAGGCAGGAGACATGGACCTGGAATGGCGTCAGGGTAGGATGGCACGCATTATACTGCAAGATGAGGATGTGACGACCAAGATAGACAATGACTGGAAACGACTGAACACATTGGCGCATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACC
  5   1   2       bld BrSp      in                      EC2BBA6AB02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCATGACGGCATTGCAGGGGGAGATGGAATATGCCACCGGGGTTCTCAAGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTTGAAAGCAAAAACCACCCCAAGCTGCTGCTGAGGAGGACAGAGTCTGTGGCTGAGAAGATGCTGACGAACTGGTTCACGTTTCTCCTCTACAAGTTCTTAAAGGAATGTGCTGGTGAGCCGCTCTTCATGCTGTACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACAGGAGAGGCCCGCTACTCGCTGAGTGAGGACAAGCTGATCCGTCAGCAGATCGACTACAAGACACTGACCCTAAACTGTGTGAACCCTGAGAATGAGAATGCCCCTGAAATCCCTGTCAAGGTGCTGAACTGTGACACCATAACCCAAGTGAAGGAGAAACTGCTTGATGCTGTGTATAAAGGCGTTCCATACTCCCAGCGACCCAAGGCAGGAGACATGGACCTGGAATGGCGTCAGGGTAGGATGGCACGCATTATACTGCAAGATGAGGATGTGACGACCAAGATAGACAATGACTGGAAACGACTCAACACACTGGCACATTATCAGGTGACAGATGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTC
  5   1   2       bld Egg       in                   TEgg054a16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGGGGAGATGGAATATGCCACCGGGGATCTCAAGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTGTGAAAGCAAAAACCACACCCAAGCTGCCTGCTGCACGACGACAGAGTCTGTGGCTGAAAAGTGCTGACGAACTGGTTCACATTTCTCCTCTACAAGGTCTTAAAGGAATGTGCCGGGGAGCCGCTCTTCATGCTGTACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACAGGAGAGGCCCGCTACTCGCTCAGTGACGACAAGCTGATCCGTCAGCAGATCGACTACAAGACACTGACCCTAAACTGTGTGAACCCTGAGAATGAGAATGCCCCTGAAATCCCTGACAAGGTGCTGAACTGTGACACCATAACCCAAGTGAAGGAGAAACTGCTTGATGCTGTGTATAAAGGCGTTCCATGACTCCCAGCGACACAAGGCATGAGACATGGACCTGGAATGGCGTCACGGTATGATGGCACGCATTATACTGCAAGATGAGGATGTGACGACCAAGATAGACAATGACTGGAAACGACTGAACACATTGGCGCATTATCATGCGACAGACGGATCTTCAGTGGCACTGGTAC
  5   1   2       bld Tbd1      in                        CBXT11633.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGATGGAATATGCCACCGGGGTTCTCAAGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTTGAAAGCAAAAACCACCCCAAGCTGCTGCTGAGGAGGACAGAGTCTGTGGCTGAGAAGATGCTGACGAACTGGTTCACGTTTCTCCTCTACAAGTTCTTAAAGGAATGTGCCGGTGAGCCGCTCTTCATGCTGTACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACAGGAGAGGCCCGCTACTCGCTGAGTGAGGACAAGCTGATCCGTCAGCAGATCGACTACAAGACACTGACCCTAAACTGTGTGAACCCTGAGAATGAGAATGCCCCTGAAATCCCTGTCAAGGTGCTGAACTGTGACACCATAACCCAAGTGAAGGAGAAACTGCTTGATGCTGTGTATAAAGGCGTTCCATACTCCCAGCGACCCAAGGCAGGAGACATGGACCTGGAATGGCGTCAGGGTAGGATGGCACGCATTATACTGCAAGATGAGGATGTGACGACCAAGATAGACAATGACTGGAAACGACTCAACACACTGGCACATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTCAAACTCATCGACGTTTACAAAGTCTCTGAGCAGATACGAGAGTATGCTACGGACAGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCAC
  5   1   2       bld Gas7      in                         XZG50046.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGCTGCTGAGGAGGACAGAGTCTGTGGCTGAGAAGATGCTGACGAACTGGTTCACGTTTCTCCTCTACAAGTTCTTAAAGGAATGTGCCGGTGAGCCGCTCTTCATGCTGTACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACAGGAGAGGCCCGCTACTCGCTGAGTGAGGACAAGCTGATCCGTCAGCAGATCGACTACAAGACACTGACCCTAAACTGTGTGAACCCTGAGAATGAGAATGCCCCTGAAATCCCTGTCAAGGTGCTGAACTGTGACACCATAACCCAAGTGAAGGAGAAACTGCTTGATGCTGTGTATAAAGGCGTTCCATACTCCCAGCGACCCAAGGCAGGAGACATGGACCTGGAATGGCGTCAGGGTAGGATGGCACGCATTATACTGCAAGATGAGGATGTGACGACCAAGATAGACAATGACTGGAAACGACTGAACACATTGGCGCATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTCAAACTCATCGACGTTTACAAAGTCCCTGAGCAGATACGAGAGTATGCTACGGACCGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCAC
  5   1   2       chi Neu                            TNeu027g22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTTCTGTATTACCCANATCCTGTGTTTGAGCCACTGACGGCATCTGGAAACCTTGAGCTGAAGCCCAGCTCTCCTCTTATAATCAAGGGTCGGAATCTCATTCCAGCAGCCCCAGGGAACTTCAGGCTTAATTATACAGTGTTGATTGGTGACACACCGTGTGCCCTTACTGTCTCTGAGACCCAGCTCCTGTGCGAGTCTCCGAACCTTACTGGACAGCACAAAGTCACTATTAAAGCCGGAGGGTTTGAGTACTCACCGGGCACACTGCAGATTTACTCGGACAGCCTGCTGACCTTGCCTGCCATCATTGGAATTGGAGGAGGAGGTGGTTTGCTCTTGCTCATTATAATCATTGTGCTTATTGCCTACAAGAGGAAATCGCGGGATGCTGACCGTACCCTGAAACGGTTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTCGCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTG
  5   1   2       bld Neu       in                   TNeu095k17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGCTACTCGCTGAGTGAGGACAAGCTGATCCGTCAGCAGATCGACTACAAGACACTGACCCTAAACTGTGTGAACCCTGAGAATGAGAATGCCCCTGAAATCCCTGTCAAGGTGCTGAACTGTGACACCATAACCCAAGTGAAGGAGAAACTGCTTGATGCTGTGTATAAAGGCGTTCCATACTCCCAGCGACCCAAGGCAGGAGACATGGACCTGGAATGGCGTCAGGGTAGGATGGCACGCATTATACTGCAAGATGAGGATGTGACGACCAAGATAGACAATGACTGGAAACGACTGAACACATTGGCGCATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTCAAACTCATCGACGTTTACAAAGTCCCTGAGCAGATACGAGAGTATGCTACGGACCGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTC
  5   1   2       bld Gas                            TGas005n23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTGAACACATTGGCGCATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTCAAACTCATCGACGTTTACAAAGTCCCTGAGCAGATACGGCCACCAGTTGGATCATCATACTGTGGGCCTACGGAGACCTGTCGGGAGAGGACAACATCAGCAGGCAGATTTTTGGCCAGAGAGTATGCTACGGACCGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCC
  3  -1   2       bld Spl1 5g   out                        CABK3801.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGATGGCACGCATTATACTGCAAGATGAGGATGTGACGACCAAGATAGACAATGACTGGAAACGACTGAACACATTGGCGCATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTCAAACTCATCGACGTTTACAAAGTCCCTGAGCAGATACGAGAGTATGCTACGGACCGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTT
  5   1   2       bld Gas7      in                         XZG42279.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGATGGCACGCATTATACTGCAAGATGAGGATGTGACGACCAAGATAGACAATGACTGGAAACGACTCAACACACTGGCACATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTCAAACTCATCGACGTTTACAAAGTCCCTGAGCAGATACGAGAGTATGCTACGGACCGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATTACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCCT
  5   1   2       bld TpA       in                   TTpA057d14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGATGAGGATGTGACGACCAAGATAGACAATGACTGGAAACGACTGAACACATTGGCGCATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTCAAACTCATCGACGTTTACAAAGTCTCTGAGCAGATACGAGAGTATGCTACGGACGGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACATTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAAGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCT
  5   1   2       bld Gas7      in                         XZG44270.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGATGAGGATGTGACGACCAAGATAGACAATGACTGGAAACGACTGAACACATTGGCGCATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTCAAACTCATCGACGTTTACAAAGTCCCTGAGCAGATACGAGAGTATGCTACGGACCGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCCAGTTCACAGCATGAGTGCCCTGCATG
  5   1   2       bld Te4       in                        CAAN11510.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGTGACGACCAAGATAGACAATGACTGGAAACGACTGAACACATTGGCGCATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTCAAACTCATCGACGTTTACAAAGTCCCTGAGCAGATACGAGAGTATGCTACGGACCGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAAACATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATG
  3   1   2       bld Gas7      in                         XZG50046.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTGAACACATTGGCGCATTATCAGGTGACAGACGGATCTTCAGTGGCACTGGTACCCAAACAGAACTCTGCCTACAACATCTCAAACTCATCGACGTTTACAAAGTCCCTGAGCAGATACGAGAGTATGCTACGGACCGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCACGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGCTAGTTCTAGATCGCGA
  5   1   2       bld Hrt1      in                          CAAQ650.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGTACCCAAACAGAACTCTGCCTACAACATCTCAAACTCATCGACGTTTACAAAGTCCCTGAGCAGATACGAGAGTATGCTACGGACCGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACANAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAAGTAACTGGGACAGGTCATCGACACAATGG
  5   1   2       bld Te4       out                        CAAN1223.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGAGAACATGATCAAGTACACTGGAAGCCCAGACAGTCTCCGTTCTCGGACCCCAATGATAACTCCAGATCTAGAGAGTGGAGTAAAGGTTTGGCATCTAGTAAAAAATCATGAACATGGAGACCAAAAGGAAGGAGACAGAGGAAGCAATGGTGTCAGAGATCTACCTAACAAGGCTTCTAGCTACAAAGGGAACCTTGCAGAAGTTTGTGGATGACCTGTTTGAAACAATATTTAGCACAGCACATCGTGGAAGTGCTCTTCCTCTTGCAATCAAGTATATGTTTGATTTCCTAGATGAACAGGCTGACAAGCATGGCATTCATGATCCTCATGTGAGGCACACTTGGAAAAGTAACTGCTTACCGCTGAGATTTTGGGTTAATGTCATAAAAAATCCCCAATTTGTCTTTGACATACATAAAAATAGTATTACGGATGCCTGTCTTTCTGTGGTAGCACAAACTTTCATGGACTCATGCTCAACCTCAGAGCACCGTTTAGGAAAAGACTCTCCTTCCAACAAACTTCTGTATGCCAAGGACATTCCCAGTTATAAGAACTGGGTAGAAAGGTACTATTCTGATATTGCCAAAATGCCGGCTATAAGTGACCAAGATATGAATGCTTATTTGGCTGAGCAATCTCGAATGCACATGAATGAATTCAACACCATGAGTGCGCTCTCAGAGATATACTCCTATGTCGGAAAATATAGTGAAGAGATTTTGACAGCACTTGATCAAGATGACC
  5   1   2       bld HeRe      in                     EC2CAA16CF05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACTGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATT
  5   1   2       bld Gas7      in                         XZG26891.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCATCAAGCCCAGACAGCCTGAGGTCCCGCACCCCTATGATCACCCCTGACCTGGAGAGTGGAACCAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAAGTAACTGGAACAGGTCATCGACACAATGGCGC
  5   1   2       bld HdA                            THdA041l21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGAACAAACTCTGGCACCTGGTGAAAAACCATGACCACCTAGATCGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCTCGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACAGACGCCTGCCTTTCTGTGGTAGCCCAGACATTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAAGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCACATATTGCCAAAATGTCGGTTATTAGCGACCAATATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGACAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCG
  5   1   2       bld Ski1      in                         CABJ4166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGCGGGAGGGCGATAGAGGTAGCAAGATGGTGTCTGAGATCTACCTGACTCGCCTCTTGGCTACAAAGGGAACTCTCCAGAAGTTTGTGGATGATCTGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTTGTGGCGACGGANACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATNAACGTGTGCGTGTGTGTGTATATATATAAATATA
  5   1   2       bld Gas7      in                         XZG45009.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGNNCGTCCGGTTTGAGACAATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAANNATAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTTAGAAACATTTC
  5   1   2       bld HeRe      in                     EC2CAA39DA07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATCTTCAGCACGGCACACCGTGGAAGCGCGCTCCCGCTCGCTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGA
  3   1   2       bld Te4       in                        CAAN11510.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGCGCGCTCCCGCTCGCTATTTAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATAT
  5   1   2       bld Fat1      in                         CABC6070.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTATTAAATACATGTTTGATTTCCTGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTTGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAANATAAACAGTTTTAAGGGACTC
  3   1   2       bld Ovi1      in                         CABI4686.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGACGAGCAGGCGGACAAGCATCAGATCACCGACTACGATGTGCGCCACACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTTGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTT
  3   1   2       bld Egg       ?                     TEgg026p10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACATGGAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCTTGCTTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTTGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       ?                     TEgg026p16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAAAGTAACTGTTTGCCACTGAGATTCTGGGTGAACGTCATTAAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTTGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe      in                     EC2CAA16CF05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACGTCATTAAAAATCCACAGTTCGTGTTCGACATTCATAAGAACAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAACGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTT
  3   1   2       bld Egg       out                   TEgg026p19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGACATTCATAAGAANCAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTTGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Fat1      in                         CABC6869.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCATCACGGACGCCTGCCTTTCTGTGGTAGCCCAGACGTTCATGGATCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAA
  5   1   2       bld Neu       in                   TNeu074m18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGGGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTTGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGA
  5   1   2       bld Neu       in                   TNeu121e07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGGGGATTCCTGTTCCACGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTTGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGGATATATATAAATATATACATATAAAGACT
  3   1   2       bld Fat1      in                         CABC6070.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACGTCAGAACATAAGCTGGGCAAGGACTCCNCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTGGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTTGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCATGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATT
  3   1   2       bld Brn2 5g3  out                       CAAJ12339.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGTCAGAACATAAGCTGGGCAAGGACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATACTAACTGCGTTGGAAAAAGATGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATT
  3   1   2       bld Ski1      in                         CABJ4166.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTTGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCATGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATT
  3   1   2       bld Gas7      in                         XZG44270.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCCCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATACAAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATACTAACTGCGTTGGAAAAAGATGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAG
  3   1   2       bld Brn2 5g3  out                       CAAJ12636.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCAAGTAACAAGCTGCTGTATGCCAAGGACATACCCAATTACAAGAGTNGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATACTAACTGCGTTGGAAAAAGATGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAAACAAG
  3   1   2       bld Brn2 5g3  out                       CAAJ16636.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGGTGCTGTATGCCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTT
  3   1   2      seed Gas7      in                         XZG42279.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTATGGCAAGGACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAAC
  3   1   2       bld Hrt1      in                          CAAQ650.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACATACCCAATTACAAGAGTTGGGTGGAGAGGTATTACGCAGATATGCCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTTGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCATGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAAC
  3   1   2       bld Brn2      in                        CAAJ16645.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAAGAGTTGGGTGGAGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATACTAACTGCGTTGGAAAAAGATGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAACCAAG
  3   1   2       bld Brn2      out                       CAAJ12669.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAACAAG
  3   1   2       bld Brn2 5g3  out                       CAAJ13438.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAGGTATTACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATACTAACTGCGTTGGAAAAAGATGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATT
  3   1   2       bld Brn3      in                        CAAK11232.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGCAGATATTGCCAAAATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATACTAACTGCGTTGGAAAAAGATGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAAACAAG
  3   1   2       bld BrSp      in                      EC2BBA6AB02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACCTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTT
  3   1   2       bld Brn3      out                        CAAK5563.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTCGGTTATTAGCGACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATT
  3   1   2       bld Tbd1      in                        CBXT11633.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAACAAGAAAAAAAAAAAAAAA
  5   1   2       bld Neu       out                  TNeu081i14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCAGGATATGAGCGCGTACCTTGCCGAACAATCCCGATTGCACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCGGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCGACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTGTATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTGTTAAAGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAAGGACGAGACAGTACGCCTGGCCACGTAACATCCAC
  3   1   2       bld Brn2 5g3  out                       CAAJ12351.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATATGAGCGCGTACCTTGCCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATACTAACTGCGTTGGAAAAAGATGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAAAACAAGAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATG
  3   1   2       bld BrSp      in                     EC2BBA13DB10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAACAATCCCGATTACACCTGAGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATATGCACAATTT
  3   1   2       bld Te3  5g3  out                        CAAM5081.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCAGTTCAACAGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATACTAACTGCGTTGGAAAAAGATGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAAACAGG
  3   1   2       bld Neu       in                    TNeu095k17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCATGAGTGCCCTGCATGAGATTTACTCTTATATCACAAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTTTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAACAAGAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATGAAAAAGGCAAAAAAAGGTGTTTTTGTGTTTCTGGAAAACCACAATCGAAAAAACCACTCCGCAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCCATGTTTCCTTTGAATGTCGTTTTAGTGAATAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas       in                   TGas108l07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTATATCACAAAATACAGAGACGAGATACTAACTGCGTTGGAAAAAGATGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCT
  3   1   2       bld TpA       in                    TTpA057d14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATATCACATAATCCAGAGACGAGATTCTAATTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTATGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGGTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn2      out                       CAAJ20331.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAATACAGAGACGAGATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTTAAAGAAATTAAAAAAAAAACAAAAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATG
  3   1   2       bld Egg       in                    TEgg064l18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAGAGACGAGATCTAACTGCGTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG26891.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTCTAACTGCGTTGGAAAAAGACGAACAAGCAAGGAGGCAGCGGCTTCGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCCTGAGAGAACGAACAAAATAAACGTGGGCGGGGGGGGGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCCCGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAGGG
  3   1   2       bld Gas       in                    TGas108l07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGGAAAAAGATGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGGGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTTTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAACAAGAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATGAAAAAGGCAAAAAAAGGTGTTTTTGTGTTTCTGGAAAACCACAATCGAAAAAACCACTCCGCAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCATGTTTCCTTTGAATGTCGTTTTAGTGAATAAAAATGGGGAAAAAAATAATGAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA                             TTpA041h05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGGAAAAAGACGCCCAAGCAAGGAGGCGGGGGCTATGAAGTAAATTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTTTCTGCATGAAAAGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCTTGCAGTCTGACCGCGAACCATAGTGTTGACGGAAACTGCCGGCCGCAGAAACTCCTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGAGCGTGTGGGTGTATATATATAAATATAAACATACAAAGACTTTAGAAAACATTTCAAAGAAAGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTTATTCAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACACCTGGCCAAGTAACATCCACGGATTACTAAGGAAGAGGGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGTTACTTTCAAACCATAAACGACCTCTCTTTTTGGCTTTCAGCCAAAAAGTGTTAATGCTACATTTGCACAATTAAAAGAAAATATTGGGTTTTTAAAGAAATT
  5  -1   2       bld Egg       in                   TEgg072h18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAAGACGAACAAGCAAGGAGGCAGCGGCTACGAAGTAAACTGGAACAGGTCATCGACACAATGGCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAACCAAGAAAAAAAAAAAAAAAAAAGCGCCGCGTCGA
  3   1   2       bld Egg       in                    TEgg054a16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACAATGTCGCAGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGACCCCTGGTGGCGACGGAAACTGCCGGATGCAGAAACTCAGTTTGGAACTTCCGTGAGAGAACGAACAAACTAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTGTTTAAGGGACTCAAATTTCACTACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTATTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCATAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGTTACATTTGCACAAATTAAAGAAAATCTTGGGTTTTTAAAGAAATAAAAAATAGCAAGAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG45009.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGCGCAGAGTAGTTGAAGTCCAAAGTCTTTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTCGTGGGGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCCTGGGGGAACGAACAAAATAAACGTGGGGGGGGGGGGGTATATTTATAAATATATCCCTTTAAAGGCTTTGGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGGCTCAAATTTCAATCCAAATTAAAAATATGGTTTTAAACCAATGGGGGCTGCTTGAACGTTCCAGGGACGAGACAGTACCCCTGGCCCCGTAACATCCCCGGATTTTTAAGGAAGACTGGTTTCCTTTCATCCCGTTTCCCCCCAAAAATCCCCCCGGGGTATTTTCAAACCCTAAACGACCTTTTTTTTTGGCTTTCAGCCCCTAGTGTTAATGCTACATTTGCCCAATTTACTGAAAATTTTGGGTTTTTAAAGAAATTAAAAAAAAACCAAGAAAAAAAAAAAAACCAAGAAATCATAAAATGGGGTGAAT
  5   1   2   14  bld Brn3 5g3  out                       CAAK11467.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAAACAAGAAAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATGAAAAAGGCAAAAAAAGGTGTTTTTGTGTTTCTGGAAAACCACAATCGAAAAAACCACTCCACAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCATGTTTCCTTTGAATGTCGTTTTAGTGAATAAAAATGGGGAAAAAAATAATGAATAAAGA
  3   1   2       bld Tbd1      in                         CBXT5528.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTTGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCATGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTTTTTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATTTTGGGTTTTTAAAGAAATTAAAAAAAAAACAAGAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATGAAAAAGGCAAAAAAAGGTGTTTTTGTGTTTCTGGAAAACCACAATCGAAAAAACCACTCCACAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCATGTTTCCTTTGAATGTCGTTTTAGTGAATAAAAATGGGGAAAAAAAAAGGAAAAA
  5   1   2       bld Tbd1      in                         CBXT5528.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTAGTTGAAGTCCAAAGTCTCTGCGTGACTTGGTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAACCCTGCAGACTGACCGCGAGCCCTTGTGGCGACGGAAACCGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCATGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAACAAGAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATGAAAAAGGCAAAAAAAGGTGTTTTTGTGTTTCTGGAAAACCACAATCGAAAAAACCACTCCACAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCATGTTTCCTTTGAATGTCGTTTTAGTGAATAAAAATGGGGAAAAAAAAAAAAAA
  5  -1   2       bld Gas       in                   TGas081f07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCGCGTCGACACTAGCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAACCAAAAAAAAAAAAAAAAAGCG
  5  -1   2       bld Egg       out                  TEgg067n24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTCCCCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAGCAAAAAAAAAAAAAAAAA
  3  -1   2       bld Gas       in                    TGas081f07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCTCCCGATGGCAACCAAGACAGAGGGAATCCTGCAGACTGACCGCGAGCCCTCGTGGCGACGGAAACTGCCGGCTGCAGAAACTCGTTTGGAACTTCCATGAGAGAACGAACAAAATAAACGTGTGCGTGTGTGTGTATATATATAAATATATACATATAAAGACTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAAC
  3   1   2       bld Te1       out                       CBWN10620.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGTATATATATAAATATATACATATAAAGGCTTTAGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAACAAGAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATGAAAAAAAAAAAAAA
  3   1   2       add Te3  FL   out                        CAAM3879.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTAAAGGCTTTTGAAAACATTTCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGGCTCAAATTTCCATCCAAATTTAAAATATAGATTTTAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTTCGCCTGGCCCCGTAACATCCCCGGATTTCTAAGGAAGACTGGTTTTCTTTCATCCCGTTTCCCCCCAAAAATCCCCCCGGGGTACTTTCAAACCCTAAACGACCTCTCTTTTTGGCTTTCAGCCCCTAGGGTTAATGCTACATTTGCCCAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAAACCAGGAAAAAAAAAAAAACAAGAAATCCTAAAATGGGATGAAAAAGGCAAAAAAAGGGGTTTTTGTGTTTCTGGAAAACCCCAATCGAAAAAACCCCTCCCCAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCATGTTTCCTTTGAAAGTCGTTTTAGGGAATAAAAATGGGGG
  3   1   2       bld Gas7      in                         XZG27060.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGCAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAACAAGAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATGAAAAAGGCAAAAAAAGGTGTTTTTGTGTTTCTGGAAAACCACAATCGAAAAAACCACTCCGCAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCATGTTTCCTTTGAATGTCGTTTTAGTGAATAAAAAT
  5   1   2       bld Gas7      in                         XZG27060.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAAGAATGACTTAGAAACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAACAAGAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATGAAAAAGGCAAAAAAAGGTGTTTTTGTGTTTCTGGAAAACCACAATCGAAAAAACCACTCCGCAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCATGTTTCCTTTGAATGTCGTTTTAGTGAATAAAAATAAAAAAAAAAAAAAAAAAAAAAGG
  3   1   2       bld Egg       in                    TEgg072h18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCTTTATAAAATAAACAGTTTTAAGGGACTCAAATTTCAATACAAATTAAAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTANTAAGGAAGANTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAANCAAGAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATGAAAAAGGCAAAAAAAGGTGTTTTTGTGTTTCTGGAAAACCACAATCGAAAAAACCACTCCGCAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCATGTTTCCTTTGAATGTCGTTTTAGTGAATAAAAATGGGGAAAAAAATAATGAATAAAGAAGAAACTCTAATTGTGAAACATGGGGGAGGGAAATGTTCCGGAAAGGGGCGGACCACCCTCGGCTACGGAGCGGTCACAGGAACTACCGTGGAAACCTGGAAAGAAAAGTTACATTTCAAGTTTCTTAGGAAACCCATCCACCCCCCCATTCTGTTTTTTTATTTTGGAATGAAATTGTGTTTGATTATAAAACCATAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu121e07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAATATAGATTTAAAACAATGGGAGCTGCTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCATGGATTACTAAGGAAGACTGGTTTCCTCTTCATTCCCGGTCTCCCCCCAAAAATCCCCCCGGGTACTTTCAAACCCTAAACGACCTCTTTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAACAAGAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATGAAAAAGGCAAAAAAAGGTGTTTTTGTGTTTCTGGAAAACCACAATCGAAAAAACCACTCCACAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCATGTTTCCTTTGAATGTCGTTTTAGTGAATAAAAATGGGGAAAAAAATAATGAATAAAGAAGAAACTCTAATTGTGAAACATGGGGGAGGGAGATGTTCCGGAAAGGGGCGGACCACCCTCGGCTATGGAGCGGTCACAGGAACTACCATGGAAACCTGGAAAGAAAAGTTACATTTCAAGTTTCTTAGGAAACCCATCCACCCCCCATTCTGTTTTTTATTTTGGAATGAATTGTGTTTGATTTCAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas                            TGas024m13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTGAACGTTCCAGGGACGAGACAGTACGCCTGGCCACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATTAAAAAAAAAACAAGAAAAAAAAAAAAAACAAGAAATCATAAAATGAGATGAAAAAGGCAAAAAAAGGTGTTTTTGTGTTTCTGGAAAACCACAATCGAAAAAACCACTCCGCAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCATGTTTCCTTTGAATGTCGTTTTAGTGAAT
  3   1   2       bld HeRe      in                     EC2CAA39DA07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACGTAACATCCACGGATTACTAAGGAAGACTGGTTTCCTCTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGCTACTTTCAAACCCTAAACGACCTCTTTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATTTTGGGTTTTTAAAGAAATTAAAAAAAA
  5  -1   2       bld Neu                            TNeu137k06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTTCCTGTCATCCCGTCTCCCCCCAAAAATCCCCCCGGGTTACTCTCAAACCCTAAACGACCTCTCTCTTTGGCTTTCAGCCACTAGTGTTAATGCTACATTTGCACAATTTACTGAAAATCTTGGGTTTTTAAAGAAATAAAAGCCTCTTTCCCAAAAAAAACAAGAAATCGGCCGCGTC
  3   1   2       bld Neu       in                    TNeu074m18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTTAAAAAAAAACCAGGAAAAAAAAAAAAACCAAGAAATCATAAAATGAGATGAAAAAGGCAAAAAAAGGTGTTTTTGTGTTTCTGGAAAACCACAATCGAAAAAACCACTCCACAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCATGTTTCCTTTGAATGTCGTTTTAGTGAATAAAAATGGGGAAAAAAATAATGAATAAAGAAGAAACTCTAATTGTGAAACATGGGGGAGGGAGATGTTCCGGAAAGGGGGCGGACCACCCCTCGCGCTATGGAGCCGGTCACAGGGAACTACCCATGGAAACTCTGGAAAAGAAAAGGTTACATTTCCAATGTTTCTTAGGGAAACCTCATCTCACTCCCCCCATTTCTGTTTTTTATTTGTGGAAGTGAATNTGTGTTTGATTTCAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Brn3      out                       CAAK11712.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAAAAAAAAAACAAGAAATCATAAAATGAGATGAAAAATGCAAAAAAAGGTGTTTTTGTGTTTCTGGAAAACCACAATCGAAAAAACCACTCCACAGATGCTCCTACAGGAAGGATAAACTGTTCCAGAAGCTTTGATATTTTTCTAGATTTCGTTCTGTGCCATGTTTCCTTTGAATGTCGTTTTAGTGAATAAAAATGGGGAAAAAAATAATGAATAAAGAAGAAACTCTAATTGTGAAACATGGGGGAGGGAGATGTTCCGGAAAGGGGCGGACCACCCTCGGCTACAGAGCGGTCACAGGAACTACCGTGGAAACCTGGAAAGAAAAGTTACATTTCAAGTTTCTTAGGAAACCCATCCACCCCCCCATTCTGTTTTTTATTTTGGAATGAATTGTGTTTGATTTCAGATGAATATTGGATATGTTTTGTTTCCTCCAGAATAACGCTACATGACGGAAGCACATTCACATTCACCTCTTTACACAAAAGTACATGTATGATTTTGCTTTGGGAAAGCATAATAATCCCACAAAGCTTTGCAATGGTCGAGTTCCCAAAGCCACAAAGGCAGTGAAGCCCAAACACTTCCTCATTTGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)