Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 89%

 1012072967 Xt7.1-CABK4056.3.5 - 72 ESTs
                                                                       ..-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABK4056.3.5                                                                                                                                                                                                                                                                                                                                                       CAAGTTTCAGGCACTCGTGTCCCGGGGAGCAACATGTCTTTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAAAAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTACACCACATAAAAAATCTGCCCCAAAGTGTACACCAGGTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTAGCTATTTGTTCAGCAGCTCTTCAGTTTGGAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATCAAAAGCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAAGTG
                                                  Xt7.1-CHK-1008224286                                                                                                                                                                                                                                                                                                                                                             TCAGGCACTCGTGTCCCGGGGAGCAACATGTCTTTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAAAAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTACACCACATAAAAAATCTGCCCCAAAGTGTACACCAGGTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTAGCTATTTGTTCAGCAGCTCTTCAGTTTGGAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATxxxAAxCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAAGTGGTTGTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                            2     4     2     4     4     6    10    11    16    17    19    20    20    21    22    22    23    23    24    24    24    24    24    24    24    24    24    24    25    26    25    26    26    26    26    26    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    28    28    28    29    29    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    22    30    22    30    23    31    23    31    24    32    24    32    24    32    24    32    24    32    23    32    25    34    24    35    23    36    21    35    23    35    22    35    22    36    22    35    23    36    23    36    23    36    21    33    22    34    23    35    23    35    21    34    21    34    21    34    20    34    20    34    21    36    21    36    20    33    20    33    20    33    20    32    17    29    19    28    15    24    15    23    15    22    15    21    16    22    16    21    15    20    15    19    14    18    14    16    13    14    12    14    12    15    10    14    10    14    10    14    10    14    10    14    10    14    10    14    10    14    10    14    10    13    10    13    10    13    10    13    10    13    10    13    10    13    10    13     9    12     9    13     9    13     9    13    10    13    10    14    10    14    11    13    11    13    11    13    14    16    15    17    15    17    16    19    18    21    19    22    22    24    22    24    22    23    24    25    24    25    23    24    23    24    23    25    23    25    23    25    25    27    25    27    25    27    25    27    27    28    22    23    23    24    22    24    21    23    21    23    21    23    21    23    21    23    21    23    22    24    22    24    22    25    22    25    22    26    22    26    22    26    23    27    22    26    23    27    23    28    22    27    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    22    27    22    27    22    27    22    27    21    27    19    26    19    26    18    25    18    25    18    24     6    11     5     7     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     3     4
  5   1   2  SIG                                      Xt7.1-XZT26819.3                                                                                                                                                                                                                                                                                                                                                CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAATCCATGGAGGTTTTTTTCCTTTCCAGATGATTGCTGTCAGGGAACAGTCCCTGCACACTCAAAAGGTTTCATTTAAACCTCAAATTCATGGCGGCACAGCATTGCACTTCACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTTGATTGTCAGCTGGGCAAAGAAGAGCGCAATCTACAAGTGGGATGTCTTTTCATCAGGACGAGCTTTGTGATTGAATTAGATGTGAGCAACACGCTTTCAGTGCATGTGATGAAGTCATATATGTGACTCCAATCACGTGTGCACAGCCTGCACGAATAGACCTTGCGATGGAGGAGATGTTGTCCTCTACGTCATTGTTGCAGCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATGTTGCTTACAGTAAAGGGACAGTTCGGTTTACTCAAATTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTAGCTATTTGTTCAGCAGCTCTTCAGTTTGGAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTTTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAAT
  5   1   2  SIG                                      Xt7.1-CABK4056.3                                                                                                                                                                                                                                                                                                                                                                                              TTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAAAAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTACACCACATAAAAAATCTGCCCCAAAGTGTACACCAGGTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTAGCTATTTGTTCAGCAGCTCTTCAGTTTGGAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATCAAAAGAAA
  5   1   2  SIG                                      Xt7.1-CAAQ8048.3                                                                                                                                                                                                                                                                                                                                                                                                             AACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATTTGGCCAAAGAGATCCATTCCGTTGGTGGCGAAGACTTATATTTAAAATGGTATAAATTGATCCATCAAATCCGGAAATAATTAACACNCACAGTAATGCGACCTAGATGTTGGCTAATCACATCACGAGAGCAAGAATCCTATCACTCTAGCNCTACTTCCGCCATTATACACTTCTATAATGCTCTTTATATCTGAGTATCCTCGTATTACAACTCTATAATATATTAATCTAGAGAGCTAGCGGCGATATACGCACCTCGCGCGCTGTTATAGACACTNCCTCGTGCAACAAGCTCCCCNCACGAAACTATGTACTGTGAGGAGGATCNATAGCCGTGAGCANCGATTGTNCATTCCTTTTCGNGCTCAGTAAGGTGGGTCACCCTCGTCGACAGACTATTGAATAACAANCTAGTTCTTAGTATATCNTTAAAACTATACATCGTAAAACACCATCCCATAGTGCTACACTCAAGACGATGATATCTTATGCATAAGNCGCATCTACTATAA------------GGGCGAGGCGCACGCAAAAAATTCTCCTGCCGGAGTATTAGATTAAATGCCCTATGGACCGTGGAAGACGAACACGTACATTTAGATAGTGAGCTCGGCATGTGAGTGCCGACATTGTATGATACTGCTTAATTCTATAGAAAGTATTGTCTCATAGTTCGCTACACT------------TACACCAGGTCTATTTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTAGCTATTTGTTCAGCAGCTCTTCAGTTTGGAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAAGTGGTTGTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAGGGCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTAGCTATTTGTTCAGCAGCTCTTCAGTTTGGAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAAC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------G--
                                               BLH ATG      33     389                                                                                                                                                                                                                                                                                                                                                       
                                               BLH MIN      33     104                                                                                                                                                                                                                                                                                                                                                       
                                               BLH OVR      33      31                                                                                                                                                                                                                                                                                                                                                       
                                               EST CLI      31      15                                                                                                                                                                                                                                                                                                                                                       
                                               ORF LNG      33       2                                                                                                                                                                                                                                                                                                                                                       
                                                                       PROTEIN --- Dm ---- 2e-028     NP_608487.1 CG11372-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 7e-038     NP_001022531.1 gaLECtin family member (lec-3) [Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 3e-045     XP_781871.1 PREDICTED: similar to Galectin-8 (30 kDa S-type lectin) (RL-30) [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Gg ---- 1e-056     NP_001010843.1 galectin-8 variant II [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dr ---- 1e-067     NP_001001817.1 galactoside-binding soluble lectin 9 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Hs ==== 3e-069     NP_002299.2 galectin 9 short isoform [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 9e-072     NP_034838.1 lectin, galactose binding, soluble 9 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === ?? ==== 3e-159     NP_001082202.1 galectin family xgalectin-IIIa [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 3e-160     AAH77487.1 Xgalectin-IIIa protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 0          AAI35697.1 Unknown (protein for MGC:122158) [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABK4056.3.5                                                                                                                                                                                                                                                                                                                                                                                        ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------TAA---------------------------------------------TGA------------------------------------------TAG------ATG------------------------------------------------------------------TAA---------------TAA---------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------TGA------------------TAG---------------------------TGAATGTGA------ATG---------------------------------------------ATG---TAG---------------------------TAG---------------TAG---------------------------------------------------------------TGA---TAA------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------TAG------TAA---------TAA---------------------------ATG------------------TAA------TAG------TAA------------------------------------------------------------------------------------------------------------ATG---------TGA------------TGATAA---------TAA------------TAATAA------------------------------------------ATG------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------TGA------------TGATAA---------TAA------------TAATAA------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2  SIG                                      Xt7.1-XZT26819.3                                                                                                                                                                                                                                                                                                                                                CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAATCCATGGAGGTTTTTTTCCTTTCCAGATGATTGCTGTCAGGGAACAGTCCCTGCACACTCAAAAGGTTTCATTTAAACCTCAAATTCATGGCGGCACAGCATTGCACTTCACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTTGATTGTCAGCTGGGCAAAGAAGAGCGCAATCTACAAGTGGGATGTCTTTTCATCAGGACGAGCTTTGTGATTGAATTAGATGTGAGCAACACGCTTTCAGTGCATGTGATGAAGTCATATATGTGACTCCAATCACGTGTGCACAGCCTGCACGAATAGACCTTGCGATGGAGGAGATGTTGTCCTCTACGTCATTGTTGCAGCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATGTTGCTTACAGTAAAGGGACAGTTCGGTTTACTCAAATTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTAGCTATTTGTTCAGCAGCTCTTCAGTTTGGAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTTTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAAT
                                                  Xt7.1-CHK-1008283628                                                                                                                                                                                                                                                                                                                                                      CGTGGGCGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAATCCATGGAGGTTTTTTTCCTTTCCAGATGATTGCTGTCAGGGAACAGTCCCTGCACACTCAAAAGGTTTCATTTAAACCTCAAATTCATGGCGGCACAGCATTGCACTTCACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTTGATTGTCAGCTGGGCAAAGAAGAGCGCAATCTACAAGTGGGATGTCTTTTCATCAGGACGAGCTTTGTGATTGAATTAGATGTGAGCAACACGCTTTCAGTGCATGTGATGAAGTCATATATGTGACTCCAATCACGTGTGCACAGCCTGCACGAATAGACCTTGCGATGGAGGAGATGTTGTCCTCTACGTCATTGTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTTACAGTAAAGGGACAGTTCGGTTTACTCAAATTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTAGCTATTTGTTCAGCAGCTCTTCAGTTTGGAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTTTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCT
  5   1   4      seed Tad5      in                         XZT26819.5p                                                                                                                                                                                                                                                                                                                                                CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGNGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACC
  5   1   2       ext In63                            IMAGE:8958112.5p                                                                                                                                                                                                                                                                                                                                                                                                     CAATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAATCCATGGAGGTTTTTTTCCTTTCCAGATGATTGCTGTCAGGGAACAGTCCCTGCACACTCAAAAGGTTTCATTTAAACCTCAAATTCATGGCGGCACAGCATTGCACTTCACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTTGATTGTCAGCTGGGCAAAGAAGAGCGCAATCTACAAGTGGGATGTCTTTTCATCAGGACGAGCTTTGTGATTGAATTAGATGTGAGCAACACGCTTTCAGTGCATGTGATGAAGTCATATATGTGACTCCAATCACGTGTGCACAGCCTGCACGAATAGACCTTGCGATGGAGGAGATGTTGTCCTCTACGTCATTGTTGCAGCT
  5   1   2       ext TpA                            TTpA063m21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACCATGTTGCTTACAGTAAAGGGACAGTTCGGTTTACTCAAATTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGA
  3   1   4      seed Tad5      in                         XZT26819.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTTTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATT
  5   1   2  SIG                                      Xt7.1-CABK4056.3                                                                                                                                                                                                                                                                                                                                                                                              TTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAAAAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTACACCACATAAAAAATCTGCCCCAAAGTGTACACCAGGTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTAGCTATTTGTTCAGCAGCTCTTCAGTTTGGAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATCAAAAGAAA
                                                  Xt7.1-CHK-1008283620                                                                                                                                                                                                                                                                                                                                                                                                    CCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAAAAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTACACCACATAAAAAATCTGCCCCAAAGTGTACACCAGGTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTAGCTATTTGTTCAGCAGCTCTTCAGTTTGGAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATCAAAAGAAAAAAAAA
  5   1   2       add In54 5g                         IMAGE:8944731.5p                                                                                                                                                                                                                                                                                                                                    TCCCTTTCGTTCACCCACGATGATTTGATTCGATTCGTCCCCGGGGAGCAACATGTCTTTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCATCTACCAAGTGGGATGTCTTTCACCAGAAGAGCTTTGGGATGAAAAAGATGTGAGCACACGCTTCAGGTGCATGTGATGAGCATATATGTGACTCATCACCGTGTGCCCAGCTGCACAATGACCCTTGCGAATGAAGAATGTTCTAAGCATGTGCCAGTCTAGAACGGACACATAAACTGAAAAATAGTCTTACTTACCTGCTAACGAGGTATTTACAGCGTGGAAATTAACTGTATTTGATATAAGCACA
  5   1   2   10  ext Spl2 5g3  in                        CBSS5589.fwd ......................................................................................................................................................................................................................................................................................................................................................CAAGTTTCAGGCACTCGTGTCCCGGGGAGCAACATGTCTTTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGG
  5   1   3   20   nb Lun1 5g                              CABD5804.5p .....................................................................................................................................................................................................................................................................................................................................................................TCAATTCGGCACGAGGAAATGTCTTTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTNCAGGTGCATGTGAATGGAGCCCATATATGTGACTTNCATCACCGTGTGCACAGCCTGCAGC
  5   1   0       chi AbdN 5x                            IMAGE:7023573                                                                                                                                                                                                                                                                                                                                                                             CGGGGAGCAACATGTCTTTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTTCAAAATGATTGCTGTCAAGGGGAAACAGTCCCTGCACACCCAAAAAAGGTTTTCATTTAAACCCTCAAAATTCCATGGGCCGGCAACAACATTTGCACTTCAAACCCGAAGGTTTTGATGAAACACACCAATTTGTACCGGAAACAATTCACCCTGAAAAGGGCAACCTGTGGGGCAAAAAGAAAAAACCGCCAATCCTTACCCAAAGTGGGGGAAGGGGTTCTTTTTTCACCCCAGAAACAGAAAACTTTTTGTGGAATTTGAAAAAAAAAAAGAATTGTTGAAGCCAAAAAACCCCCTTTTTTTCAAAAGGTGGCCAATGGTGGGAAAATGGGGAA
  5   1   2       add Tad5 FL   in                         XZT56157.5p                                                                                                                                                                                                                                                                                                                                                                                 GAGCAACATGTCTTTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTTCATCACCGTGTGCACAGCCTGC
  5   1   2   10  ext Spl1 5g3  in                         CABK4056.5p .....................................................................................................................................................................................................................................................................................................................................................................................TGATTCGTTTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGNGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAG
  5   1   3   12   nb Tad5 5g3  in                         XZT61595.5p ......................................................................................................................................................................................................................................................................................................................................................................................CATGTCTTTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAG
  5   1   3        nb Met5      in                         CACX1199.5p                                                                                                                                                                                                                                                                                                                                                                                         TGTCTTTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGNGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACAC
  5   1   3        nb AbdN                               IMAGE:7024757                                                                                                                                                                                                                                                                                                                                                                                          GTCTTTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGGAGGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGGAAGGTCTTTTCACCAGGAACAGAGCTTTTGTGATTGAAAATAAGATGTGAGCAACACGCCTTTTCAAGGGGCATTGTGAAA
  3  -1   2       ext Fat1      in                         CABC7236.3p                                                                                                                                                                                                                                                                                                                                                                                              TTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGAC
  5   1   2       add AbdN                               IMAGE:7023946                                                                                                                                                                                                                                                                                                                                                                                                  GTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCCAGTGGGGATGGTCTTTTCACCAGGACAGAGCTTTTGTGATTGAAAATAAGATGTGGAGCAACACCGCTTTTCCAGGTGCCATGTGGAATGGAAGCCCATATATTGGTGAACTTCAAATCACCCGTGGTGGCACAAGCCCTGCCAANCAAAAATAGACCACCCTTGCCCAGATTTGGAAAAGGGAGAATGTTTGTTCCCTTACCACCCATGC
  5   1   3        nb Spl1      in                         CABK6134.5p                                                                                                                                                                                                                                                                                                                                                                                                  GTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCA
  5   1   2       add In66                            IMAGE:8963858.5p                                                                                                                                                                                                                                                                                                                                                                                                   CAATTATTTCTACACTACCATTTCTAACAAACAAAATCGTCCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTTTTCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGTCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATGAAATAAGATGGTGAGCACACGCTTTCAAGGTGCATGTGATGAGCCCATATATGTGACTTCATCACGTGTGCACAGCTGCAGCAGATGACCCCTTGCAGATTGGAGGAAAATGGTTGTTCTCTACAGCCATGTGTGCCAGGTTCT
  5   1   2       ext TbA       in                   TTbA052m18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                          TAAAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCANGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCA
  5   1   4      seed Int1      in                        CAAP14861.5p                                                                                                                                                                                                                                                                                                                                                                                                            CAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGANATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTTCATCACCGTGTGCACAGCCTGCAGC
  5   1   2       ext Int1      in                          CAAP668.5p                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATC
  5   1   2       add In63                            IMAGE:8957782.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGAGGGTCACTCTTCGAATAGATGATTGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTTCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAGTGCATGTGAATGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCTGCAGCAGATGACATCTGCAGATGAGGAAATGTGTCTACGCATGTGCAGTCTAGCACGATCACAATAGAAAATTGGAAGATATAGTTCCTATCTTATACGCTGCTAACATGTAGAGTTGAATTTTACTAAG
  5   1   3        nb Lun1                                CABD12890.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAANCATAGAAAAATTGGAAGATAAATAAGTT
  5   1   2       add Tbd0                               IMAGE:6977115                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTGTTTCAACCAAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAAGGGGGTTGATTTTTTACCTAAGGTCTGGGTATTGGAAGTAAAATATTAGAACCTGTAAAATTTTTATGGGGAGAAATTTAGTAACCGGACACAATGGGCCGGGTTAATTTTTTTAAGCCCGGGGTAAAAAAACCAAA
  5   1   0       chi Liv1      in                         CAAR4821.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCTCCAATAGTAGCATATGAGCCTTTTCTTCTCCCATAGGTAGAACTGAGAAATGTGTTCTCCAGTAGCAACAACTTAGCCATCTCTTTTCCCATAGGAACAAATGTACTATTCCATTTCTTCTCCCCATAATATTTCTGCAGTTAAACATGCACAGGGAACAATGTCTTAGTCAAGAATATGAGATTGTAAAATGTAATAGACAATGTCTTACAAGAAATAAAAGTTTTATTTTTATTGTTGTATAGGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGATTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTANACAGTGTACGGTGTTGATTTTTACCTAAGGTCT
  5   1   2       add In63                            IMAGE:8961316.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTTACAACGTTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGGGTGGCTTCCCTCCTCAACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGTCTGGTATTGAGTAAATATTAGACCTGTAGATTTTATGGGAGATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAACACCAAATTAAGTGTAAAAAACTGTGTAATATGCAATTATCAGGTGTCTTATTTGCCACCCTGGTGGCGAAATTTCAATATCAGCAGTGTGCTTTTTTACCCCTAAAATCTGCCAAGGTACCAGCTATACCATGAACATAGATGTCACGTGACATAGTCTCGATTGGCTAGTCAGATGGATACGATCTCGTGAGTGTAACACCGTGTGCTTCAG
  5   1   3        nb Spl2      in                        CBSS3948.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCACACTTTCCTGGTGCACCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAANAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTA
  5   1   2       add Tbd0      in                       IMAGE:6976526                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCACATTCAGTCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTANGGTGTTGATTTTTACCCTAAGGGTCCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTTATGGGAGAATTTAGTAACGGACACAATGGGCTGTTATTTTTTATGCTGTGTAAAAACCCAAAATAAAGTGTAAAAAAAAACTGTGTAAAAATAATTGGGCAAAATTTATCAAGTGGGGTCTTAATTTTGCACCACCCTGTGTGCCAGAATATTTTTCAAATATCAGCAGTTTTTGTTTGGCATTTTTTAACCCCCCATAAAAAAAATCTTGCCCCCCAAAGGGTACACCCAGGGTCTTATTAAACCCCATT
  5   1   3        nb Brn4      in                        CAAL22744.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAAAAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTACACCACATAAAAAATCTGCCCCAAAGTGTACACCAGGTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGT
  5   1   2       add In63                            IMAGE:8958685.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATTTTTAGATTATCTAGGAACCACAATATACAAATTCGTCCCGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAAAAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTACACCACATAAAAAATCTGCCCCAAAGTGTACACCAGGTCTATTAACCCATTGCAACCAATCAGGTATTGGTTACAACAGGTGAGCATAAATGCTTCTGATTGGTGGCATAGGTTACTAGATTTGAGTAAACCGAACATTCCTGTATGATGTGAGCACATGTGCTACAGTAAAGGGACAGTCACTTTTAAATTAATTTGGTATGAAGTAAACCTG
  3  -1   2       ext Int1      in                          CAAP631.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAATCCATGGAGGTTTTTTTCCTTCCAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAAAAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTACACCACATAAAAAATCTGCCCCAAAGTGTACACCAGGTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAAGGACAGTTCACTTTTAAAATAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAAC
  5   1   2       ext Lun1      in                         CABD1440.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAAATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATA
  5   1   2       add AbdN                               IMAGE:7006182                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAAAAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTACACCACATAAAAAATCTGCCCCAAAGTGTACACCAGGTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATANATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAAGTTATAGTTTTTTTTTTTAGCTATTTGGTTCAGCAAGCTCTTTCAGTTTGGGAATATCAAGCACCTATTCCAGTTTGTTTTGGGGTCCCAACTTGGAATATTAAAATAGGGAGT
  3   1   2       ext TbA       in                    TTbA052m18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAANGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAAAAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTACACCACATAAAAAATCTGCCCCAAAGTGTACACCAGGTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAAAAAAAAAAAAGCG
  3   1   2       add Tad5 FL   in                         XZT56157.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGAGCTTTGTGATGAAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAAAAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTACACCACATAAAAAATCTGCCCCAAAGTGTACACCAGGTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACGACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGAT
  5   1   3        nb Tad5                                 XZT39020.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGACGCGTGGGTTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAAAAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTACACCACATAAAAAATCTGCCCCAAAGTGTACACCAGGTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACANAAAAAGAAAATCATTTAC
  3   1   3        nb Met5      in                         CACX1199.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTGNCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAAAAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTACACCACATAAAAAATCTGCCCCAAAGTGTACACCAGGTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACGACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAAC
  3   1   0       chi Tbd0      in                       IMAGE:6976526                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       NANAAGCAGAGAGATGGTGTGTGGTGTGGTATATCTTCTATTATATTGTAACGGAGCACGCCCCGCATTGAATAGAATATAATGTGTAGAGAAAAAACATATATGAGGTGATATGTAGAANAATGCATGGGTGAGCGCTAATTTTGTACTCCATTGGGTAATAGAGAGAAATAGTGCGGGGAGTGAGGGGAGCACAACCAGCGCGGAGTGAGGGTGGTGGTGGTTATTTGACACACGGAGATGNGGAGTGGGGGGNGTGTAAAACCGGCGGGTGATATCTCCAGCTTGTATAGTGGAAGAACAGACAGCAACAAGGGAGGGTTTATATTGGGACACNCCACTATGNGTCCAAGAGAGATAGTCTAAAGGGGGGAAACATCATAGTGGGCGCGGTTATTATTTATGAAAAAAGATAGTTACCCCCAATATTATTTGTACTTATTATCTCTTTATATAGGAGAGTGTTATAGAGGACAGAGACGATATGTGGTTGAGTGTATCGTGATAGGAGAGNGATATTTATATATATAGTGATATATATTGCGGCGAAGCGACGCGTTATTTTTGTATGTGAGACGGACGTTTTTTTAAGGAAAAAATATTGAATATCTAACAGGTCCAAAATATTGTGTTAACGCGAAAAATATAGGTTTGTTTGGGTGTTTATCCGCGGATTTCTGGCGATTTTGTGAAAATTTACGGGGAGGAGGACCCCCCGGGAAGTTAGGATAAGGGGTAAAGCAAAAAGAATATGAAAAAGTTCATTTTTCCAAATTGTTTGAAAAAACGAGAAAATTGGAAGTTAAGAAGAAGAGGTTTGAAGAATTGGGGCATGATAAAGAGGCATAACGGGAAAGCTAACATAAAGGGTAAAAAAAACCTTTTAAACGCAGTCTACTTGCAACGTATGAGTCTTTAGGTTTAATAAGTGTATCGGTAATATAACATGTCTGTTTCACACTACGTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTGTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATGGAAACTGGCGCGCGGGGAAGGGAGTATGTGGATGGGAGGGTAGATAGAATGAACCATAGAGGAGAAGGA
  3   1   3        nb Brn4      in                        CAAL22744.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATCTTATACGCTTGCTTTAAACAGTGTAGGGTGTTGATTTTTACCTAAGGTCTGGTATTGGAGTAAAATATTAGACCTGTAGATTTTTATGGGAGAATTTAGTAACGGACACAATGGCTGTTATTTTTTATGCTGTGTAAAACACCAAAATAAAGTGTAAAAAAACTGTGTAAAATAATTGGCAAATTTATCAAGGTGTGTCTTATTTTGCACCACCTGTGTGCCAGATATTTTTCAATATCAGCAGTTTTGTTGTCATTTTTTACACCACATAAAAAATCTGCCCCAAAGTGTACACCAGGTCTATTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAAC
  3   1   2       ext Int1      in                          CAAP668.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAACCCATTGCAACCATCAGGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGAC
  5  -1   2       ext Fat1      in                         CABC7236.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTG
  3   1   2       ext Spl1 5g3  in                         CABK4056.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATCAAAAGCCTCTCG
  5   1   2       ext Tad5      in                         XZT18437.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACGACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAAATAATCTGCATTATCA
  5  -1   2       ext Int1      in                          CAAP631.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATC
  3   1   3        nb Liv1      out                       CAAR10988.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATCAAAAG
  3   1   4      seed Int1      in                        CAAP14861.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATC
  3   1   2       ext Tad5      in                         XZT18437.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACGACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATC
  3   1   2       ext Lun1      in                         CABD1440.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATCAAAAGAAAAAAAAGCGGCCGCCTAGGC
  3   1   2       add Liv1      in                         CAAR4821.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATACCAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAACTGGTTGTAACCCTATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATC
  3   1   3        nb Spl1      in                         CABK6134.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATC
  3   1   3        nb Met2                                  CUNH521.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACGACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAGAGATAAC
  3   1   3        nb Spl2      in                        CBSS3948.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTAGCTATTTGTTCAGCAGCTCTTCAGTTTGGAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATCAAAAG
  3   1   3        nb Tad5 5g3  in                         XZT61595.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACGACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATCAAAAG
  3   1   2       ext Spl2 5g3  in                        CBSS5589.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTAGCTATTTGTTCAGCAGCTCTTCAGTTTGGAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATC
  3   1   3        nb Tad5                                 XZT62159.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               tagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATC
  3   1   3        nb Hrt1      in                         CAAQ6030.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATC
  5   1   3        nb Hrt1      in                         CAAQ6030.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATCAAA
  5   1   3        nb Limb      in                        CBSU5483.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATC
  3   1   3        nb Limb      in                        CBSU5483.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATC
  5   1   2       ext Tad5                                 XZT23631.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATCaaaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2  SIG                                      Xt7.1-CAAQ8048.3                                                                                                                                                                                                                                                                                                                                                                                                             AACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATTTGGCCAAAGAGATCCATTCCGTTGGTGGCGAAGACTTATATTTAAAATGGTATAAATTGATCCATCAAATCCGGAAATAATTAACACNCACAGTAATGCGACCTAGATGTTGGCTAATCACATCACGAGAGCAAGAATCCTATCACTCTAGCNCTACTTCCGCCATTATACACTTCTATAATGCTCTTTATATCTGAGTATCCTCGTATTACAACTCTATAATATATTAATCTAGAGAGCTAGCGGCGATATACGCACCTCGCGCGCTGTTATAGACACTNCCTCGTGCAACAAGCTCCCCNCACGAAACTATGTACTGTGAGGAGGATCNATAGCCGTGAGCANCGATTGTNCATTCCTTTTCGNGCTCAGTAAGGTGGGTCACCCTCGTCGACAGACTATTGAATAACAANCTAGTTCTTAGTATATCNTTAAAACTATACATCGTAAAACACCATCCCATAGTGCTACACTCAAGACGATGATATCTTATGCATAAGNCGCATCTACTATAA------------GGGCGAGGCGCACGCAAAAAATTCTCCTGCCGGAGTATTAGATTAAATGCCCTATGGACCGTGGAAGACGAACACGTACATTTAGATAGTGAGCTCGGCATGTGAGTGCCGACATTGTATGATACTGCTTAATTCTATAGAAAGTATTGTCTCATAGTTCGCTACACT------------TACACCAGGTCTATTTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTAGCTATTTGTTCAGCAGCTCTTCAGTTTGGAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAAGTGGTTGTA
                                                  Xt7.1-CHK-1008283624                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAAxAxTTTGGCCAAAGAGATCCATTCCGTTGGTGGCGAAGACTTATATTTAAAATGGTATAAATTGATCCATCAAATCCGGAAATAATTAACACNCACAGTAATGCGACCTAGATGTTGGCTAATCACATCACGAGAGCAAGAATCCTATCACTCTAGCNCTACTTCCGCCATTATACACTTCTATAATGCTCTTTATATCTGAGTATCCTCGTATTACAACTCTATAATATATTAATCTAGAGAGCTAGCGGCGATATACGCACCTCGCGCGCTGTTATAGACACTNCCTCGTGCAACAAGCTCCCCNCACGAAACTATGTACTGTGAGGAGGATCNATAGCCGTGA------------CATTCCTTTTCGNGCTCAGTAAGGTGGGTCACCCTCGTCGACAGACTATTGAATAACAANCTAGTTCTTAGTATATCNTTAAAACTATACATCGTAAAACACCATCCCATAGTGCTACACTCAAGACGATGATATCTTATGCATAAGNCGCATCTA------------TGTAGAGGGCGAGGCGCACGCAAAAAATTCTCCTGCCGGAGTATTAGATTAAATGCCCTATGGACCGTGGAAGACGAACACGTACATTTAGATAGTGAGCTCGGCATGTGAGTGCCGACATTGTATGATACTGCTTAATTCTATAGAAAGTATTGTCTCATAGTTCGC------------------------AGGTCTATTTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTAGCTATTTGTTCAGCAGCTCTTCAGTTTGGAATATCAGCAGCTATCCAGTTGTTTGGGTCCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAAGTGGTTGTAACCCCC
  5   1   2       ext Abd0 FL                            IMAGE:7018035                                                                                                                                                                                                                                                                                                                                           GTGAGATCAGAGCAAGTTTCAGGCACTCGTGTCCCGGGGAGCAACATGTCTTTCGGTCCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAAT
  5   1   2       add In66                            IMAGE:8963511.5p                                                                                                                                                                                                                                                                                                                                                                                                 TGTCCCCTTAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATTGTGAGCACACGCTTTCAGGTGCATGTGATTGAGCCATAATGTGACTCATCACCGTGGTGCACAAGCTGCAGCAGAATGAACCCTGCGATGAGAAATGTGTCCTACGCATGTGCAGCTTAGCACGCGATCCCCCATTGATAAG
  5   1   2       ext Int1      in                        CAAP12787.5p                                                                                                                                                                                                                                                                                                                                                                                                         TAACAACCCTCCTGTTCCCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTNTGTGATTGANATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAG
  5   1   2       ext Hrt1      in                         CAAQ8048.5p                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTTACATTGCCACTGTCCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGANATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGC
  5   1   3        nb Int1      in                        CAAP14367.5p                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCATGGCCTCCATGATGGGTTTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGNGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAATAAGATGTGAGCAACACGCTTTCAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCA
  5   1   4      seed Int1      in                         CAAP8075.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTGGTGGTCATTAGCGGAGTTGTCTGTCCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATA
  5   1   2       ext Tad5      in                         XZT11039.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAACTTTCAGTGTGGTCACTCTTCGAATGATGATGTTGCCTTCCATTTTAACCCCCGATTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTAATAGCTGGGGGAGGGAGGAAAATAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTTCCAACCACAGTTACAACGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCAGGGGAACAGTCCCTGCACACCCAAAAAGGTTTCATTTAAACCTCAAATTCCATGGCGGCACAGCATTGCACTTCAACCCGAGGTTTGATGAGCACACAATTGTACGGAACAGTCACCTGAATGGCAGCTGGGGCAAAGAAGAGCGCAATCTACCAAGTGGGATGGTCTTTTCACCAGGACAGAGCTTTGTGATTGAAATAAGATGTGAGCAACACGCTTTCAAGGTGCATGTGAATGGAGCCCATATATGTGACTTCAATCACCGTGTGCACAGCCTGCAGCAGATAGACACCTTGCAGATTGAAGGAGATGTTGTCCTACAGCATGTGCAGGTCTAGCAGCGGATCAACAATAGAAAAATTGGAAGATAAATAAGTTTCTTATNCTATACGCTTGCTTTA
  5   1   2       add AbdN                               IMAGE:7005502                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGATCCTTGTTTCCAACCACAGTTACAATGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGGATCCCAATCCAAAGAGTTAATACACTGACCATAGGGGGATGTGTTAACTTAACATGTGTCCATGTACAACAGCAAGGGCCCCATCAACCAGGATACCTTCCTCAACAATTCCCACCTGGAGGTGCATTCAATCCGCAAGTTTATGCAATTCCATACCAAACTAAAATCCATGGAGGTTTTTTTCCTTCCAAGATGATTGCTGTCNAGGGGGGAACAATTCCCTGCCCAACCAAAAAAGGTTTCATTTTTAAACCCTTCAAAAATTTTCCTAGTGGGGGGGGCGGCTCAACACAGCGGAAGAAAACATGGGTGTCCCGTGCACCGATACACGAACGCATCACATGACTTTTTTGACACCTAGAGCATCACGTTTTTTGGGCCCCATGGTAAGAATAGGCCTGATGATTCCGTTGGGAAACTCTCATACAGCTTCACGAAAGGAAAACTGTCGAACTTCCCGCGCCAGGCCATGGGGAATGGAATGGTTGACACTGATATTGGCTAACTTATTATGGCTGTTGTATTCGAAAGAAACAAACGTTCCTGGGGGTTAAAATTTTGGCCAAAGAGATCCATTCCGTTGGTGGCGAAGACTTATATTTAAAATGGTATAAATTGATCCATCAAATCCGGAAATAATTAACACNCACAGTAATGCGACCTAGATGTTGGCTAATCACATCACGAGAGCAAGAATCCTATCACTCTAGCNCTACTTCCGCCATTATACACTTCTATAATGCTCTTTATATCTGAGTATCCTCGTATTACAACTCTATAATATATTAATCTAGAGAGCTAGCGGCGATATACGCACCTCGCGCGCTGTTATAGACACTNCCTCGTGCAACAAGCTCCCCNCACGAAACTATGTACTGTGAGGAGGATCNATAGCCGTGAGCANCGATTGTNCATTCCTTTTCGNGCTCAGTAAGGTGGGTCACCCTCGTCGACAGACTATTGAATAACAANCTAGTTCTTAGTATATCNTTAAAACTATACATCGTAAAACACCATCCCATAGTGCTACACTCAAGACGATGATATCTTATGCATAAGNCGCATCTACTATAANNTTGTTGTAGAGGGCGAGGCGCACGCAAAAAATTCTCCTGCCGGAGTATTAGATTAAATGCCCTATGGACCGTGGAAGACGAACACGTACATTTAGATAGTGAGCTCGGCATGTGAGTGCCGACATTGTATGATACTGCTTAATTCTATAGAAAGTATTGTCTCATAGTTCGCTACACTT
  3   1   2       ext Int1      in                        CAAP12787.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTACACCAGGTCTATTTAACCCATTGCAACCAATCAGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAATATGGTTGTAACCCCCTCTCGCCCTATATGA
  3   1   4      seed Int1      in                         CAAP8075.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCTATTANCNCATGCANNCCATCANGGGTATTGGTTACAAACAGGTGAGCAATAAATGCTTCTGATTGGTGGCCATAGGTTACTAGAATTTGAGTAAACCGAACATTCCTGTATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAAGTGGTTGTAACCCACCTCTCGCCCTAT
  3   1   2       ext Hrt1      in                         CAAQ8048.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATGAATGTGAGCCACCATGTTGCTTACAGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAATGGTTGTAACCCATAAGTACACCGTATTCAATTATTTGCATATATGTAACTTGGCTCACAATAAATCTGCATTATC
  3   1   3        nb Int1      in                        CAAP14367.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTAAAGGGACAGTTCACTTTTAAATTAATTTTTGGTATGAAGTAGACTGTGGTATTTAGAGACAACTTCTTATAGGTTATAGTTTTTTNTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtccaaCTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATAACAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAATTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAACCCTTTAAACGCAGTCCTCCTGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACACTACCTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAACCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCTTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTATATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCACCACTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAA
  3   1   2       ext Tad5      in                         XZT11039.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTCTTATAGGTAATAGTTTTTTTTTagctatttgttcagcagctcttcagtttggaatatcagcagctatccagttgtttgggtGCAACTTGAATATAAATAGGAGAGACCCTGAATAGAAAGATATCAAAAAAAGAAAATCATTTACAAATTTTAAAAACAAAAACTGAAATTAAAAAGCTGCTTAGAACTGGGCATGATAAAGGGCATACTAAAAACTAACATAAAGGTAAAAAAAGGCCTTTAAACGCAGTCCTCCGGCAACCTCTGAGTCTTTAGGTTTACTAAGTGTATCCGTAATATAACATCTCTGTTTCACGCTACTTGATGCTAAGACCTGTAAAGAAATAATTTATATAGACTTTTTAAATAGTGAACCTTTTTAAAGCCAACACTACTCCACTCGAAACAGATGAGAATGGAAAATCCTGTTATATTAGCAAACATTTGAAGAGATGGAGTCAGTTTTATATAAATATGTATTCCCCATGATGTACATTTACATGATAATGTTCACAATAAGTAAAAGTGATATAATAAATAAGCAGCTATACAAGTTGGTACTCATGCGCCATTCATAGGATGGGAATAGAGCAGAACTGTGTTAGTTTGAAGTACAGGAAACCTTGCCTTTCAAAAGTGGTTGTAACCCATAAGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)