Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012072999 Xt7.1-CAAQ5578.3.5 - 112 ESTs
                                                                       .........-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAQ5578.3.5                                                                                AGCCGAGGGGACACAGACAGGCGGCCGATCCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGGAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGTAATTGCTTAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222938                                                                                      GGGGACACAGACAGGCGGCCGATCCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGGAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGxxxxxxxxxAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                     5     5     6     6     6     6     8     8     9     9     9     9     9     9     9     9    10    10    10    10    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    11    11    11    12    11    12    11    13    12    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    15    15    16    16    17    17    17    18    18    17    18    19    19    18    18    18    18    18    19    19    19    19    19    18    18    18    19    17    18    17    18    17    18    17    18    17    18    17    18    17    18    18    19    17    18    19    20    19    20    19    20    17    18    17    19    17    19    16    20    13    19    12    18    13    19    12    20    13    19    12    18    15    20    15    19    16    20    16    20    16    20    16    20    14    16    14    16    13    17    14    17    14    17    14    17    14    16    16    18    16    18    16    19    16    19    18    19    18    19    19    20    19    20    19    20    18    19    19    21    18    21    18    22    18    22    17    23    15    22    15    22    15    20    14    20    14    19    14    19    14    19    14    20    15    20    13    18    13    18    14    19    14    19    15    20    15    20    15    20    15    20    14    19    13    18    14    20    14    20    14    20    17    22    17    23    17    23    17    23    17    23    17    23    17    23    17    22    17    21    15    21    15    22    15    21    15    21    14    20    14    20    14    20    13    20    18    19    18    20    19    21    19    21    19    20    19    20    20    21    20    21    20    21    20    21    19    21    19    21    19    21    20    22    20    23    19    22    19    23    18    22    19    25    20    26    20    26    21    26    21    27    21    27    21    27    25    35    29    41    27    40    28    44    36    49    35    47    34    47    31    50    35    52    31    54    33    55    33    56    33    56    34    55    35    55    35    56    34    56    33    57    34    58    33    58    34    59    33    57    51    58    54    58    53    58    56    58    54    57    54    57    53    57    54    57    53    56    54    56    53    56    54    56    53    56    55    56    54    55    52    54    52    53    51    54    48    52    48    51    46    51    48    50    42    50    44    50    45    51    46    51    46    51    46    51    46    51    44    50    44    50    43    49    43    49    41    49    40    49    39    49    39    49    38    48    20    46    17    38    26    32    11    32     3    17     4     4
  5   1   2  SIG                                     Xt7.1-CAAN12206.3                                                        CGTGCGCACAGGCTGCCCGGCAGGAGCCGAGGGGACACAGACAGGCGGCCGATCCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGGAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGTATTATCATGGTCACCCCCATACAGTCCCAGCATACGCTCAGCAGAAATCTCAGCTCTTATCTAAGTATAACCACCAATGAACTATACCCAGGCTAACTCAGTTCTTGTCCAGCCGTGCCTGCCTAGTAATACGACTGACGCCTCCTTGAACCCGGAGGTG------------------------GGATTATATACGATCCCACCACATTCGAATTCGTCCCCGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTGGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCTTGGCACCTCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGGATGCAACTTTGGGTTCTTTATTCTTTCCTTTTTGTTGGCGCAGGGTATGTGGGTGTACATCTCCTGTGGGGGGGCCCCCGGTTTACATTTCCTGTGGGGGCCCCGGCCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACT
  5   1   2  SIG                                      Xt7.1-CAAQ5578.3                                                                                                             CCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGAAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTTGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTGAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGTAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACCGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCTATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGCTTATAAAAAAAAAAA
  5   1   2                                         Xt7.1-TNeu088l23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGAGGGTTACATATTTGCCCATTGGGTGGGTACGTGGGTGATGGCGCCAATGAGTAGAACCACCTGGACCTTCTCTCCTTAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTGGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCATCCCTTCCGGTGCGCACGGAGCGCTGGTATCTGGCGCAACCCTGGCACGCGGCGGACATGATGGCACCGACTAAGCGAAGATGAGAGAGCGCACGCGCGGTCATCAGGCCCCTCCGTGCCGGGTTTTCTTCTTGGCCACGCAGAGCACTGGTCTTATTTTCTTGGG------------------------------------------------TTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCNTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATAGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCNAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTGTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAACTGGGTGCCCGTGGGCCCATCCGTAACCTTCAGGGGATATACACTAAAGTCAGTTCCAGCTGGGGGCACATTTGGCTTTATGGGGGGGCAGATAGGCATTGGGCCCTTTCCTATAGGGGAGCCACATGGAGCCCTCCAGCTATTGCAGAACTCCCAGCTTCCCACCAGTGTAACTGGACTGCAGTTTGGGTACAACCTTAATTAGGGTTTTCAAAATCCATGGAAAATAAAGACCAATTGCAGAGATGTTTAGCATGATGTAGGGAGTGCTATTCTGAGACAACTTACAATTGGTCTTCGTTTATTATTTGTGTTTTTGTCTAGTTTTTACTTTTTGTATCTGGTTGCTAAGGGTCCAAATAATTCAAAAACTAGAAAAAAATAGAGACCAATTGAAAAGTTGCTTAGAACTGACCCAACATACTAAGAGTTAAGTTAAAGGGACAGCTGGGGGCTAACGGCTTGATGACTTGCCCTTGCAGCTGACGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCAACCTGGAACTGCTGGGTTT
                                                                   SNP                                                                                                                                                                                                                                                                                ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                            ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --G------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---G--------
                                               BLH ATG     128    2427                                                                                
                                               BLH MIN     128     255                                                                                
                                               BLH OVR     101     411                                                                                
                                               ORF LNG     101     141                                                                                
                                                                       PROTEIN --- Sc ---- 1e-015     NP_010597.1 Component of transcription initiation factor IIb, 75 kDa subunit; Tfb1p[Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PROTEIN === Ce ==== 1e-053     NP_499880.3 R02D3.3 [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Dm ==== 9e-139     NP_610957.1 CG8151-PB [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PREDICTED = Sp ==== 2e-159     XP_798784.1 PREDICTED: similar to TFIIH basal transcription factor complex p62 subunit (Basic transcription factor 62 kDa subunit) (BTF2-p62) (General transcription factor IIH polypeptide 1) [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Dr ==== 0          NP_001004596.1 zgc:92126 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 0          NP_032212.2 general transcription factor II H, polypeptide 1; general transcription factorIIH, polypeptide 1 (62kD subunit); general transcription factor II H,polypeptide 1 (62kD subunit) [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 0          NP_005307.1 general transcription factor IIH, polypeptide 1 (62kD subunit) [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PREDICTED = Gg ==== 0          XP_421013.2 PREDICTED: similar to basic transcription factor 62kD subunit [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PREDICTED = Xl ==== 0          AAH46266.1 Similar to general transcription factor IIH, polypeptide 1, 62kDa [Xenopuslaevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === ?? ==== 0          NP_001080277.1 general transcription factor IIH, polypeptide 1, 62kDa [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 0          AAH75586.1 General transcription factor IIH, polypeptide 1, 62kDa [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAQ5578.3.5                                                                                                                                                       TAG---------------------------ATG------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------TGA------------------------------------------------------------------------------------------------------------------TGAATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------TGAATG---ATG---------------------------------------------------------------------TGATAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATAA
                                                                   ORF                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2  SIG                                     Xt7.1-CAAN12206.3                                                        CGTGCGCACAGGCTGCCCGGCAGGAGCCGAGGGGACACAGACAGGCGGCCGATCCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGGAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGTATTATCATGGTCACCCCCATACAGTCCCAGCATACGCTCAGCAGAAATCTCAGCTCTTATCTAAGTATAACCACCAATGAACTATACCCAGGCTAACTCAGTTCTTGTCCAGCCGTGCCTGCCTAGTAATACGACTGACGCCTCCTTGAACCCGGAGGTG------------------------GGATTATATACGATCCCACCACATTCGAATTCGTCCCCGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTGGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCTTGGCACCTCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGGATGCAACTTTGGGTTCTTTATTCTTTCCTTTTTGTTGGCGCAGGGTATGTGGGTGTACATCTCCTGTGGGGGGGCCCCCGGTTTACATTTCCTGTGGGGGCCCCGGCCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACT
                                                  Xt7.1-CHK-1008277826                                                              CACAGGCTGCCCGGCAGGAGCCGAGGGGACACAGACAGGCGGCCGATCCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGGAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGTATTATCATGGTCACCCCCATACAGTCCCAGCATACGCTCAGCAGAAATCTCAGCTCTTATCTAAGTATAACCACCAATGAACTATACCCAGGCTAACTCAGTTCTTGTCCAGCCGTGCCTGCCTAGTAATACGACTGACGCCTCCTTGAACCCG------------------------------------TATACGATCCCACCACATTCGAATTCGTCCCCGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTGGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCTTGGCACCTCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGxCxxxGGATGCAACTTTGGGTTCTTTATTCTTTxCxTTTTGTxGxxxxAGGGTATGTGGGTGTACATCTCCTGTGGGGGGGCCCCCGGTTxxxxxTTCCTGTGGGGGCCCCGGCxxxxxxTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATT
  5   1   1           Neu0 FL                     IMAGE:6994310.FL-MGC                                                                     TGCCCGGCAGGAGCCGAGGGGACACAGACAGGCGGCCGATCCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGAAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTTGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTGAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGTAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACCGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCTATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGATGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAATGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTGGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGCTTAAATTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg030a05.FL-Sanger                                                                                                                                                                       CGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGGAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGCGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACCAAAGCCGAGGCGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATCCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTTAAATTTAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   14  ext Te4  5g3  in                         CAAN4112.5p ...............................................GGAAGTGACGTGCGCACAGGCTGCCCGGCAGGAGCCGAGGGGACACAGACAGGCGGCCGATCCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCTCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAAGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGAAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCAGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTG
  5   1   3   14   nb Te4  5g3  in                        CAAN12491.5p .......................................................CGTGCGCACAGGCTGCCCGGCAGGAGCCGAGGGGACACAGACAGGCGGCCGATCCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCTCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAAGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGAAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCAGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTGCAGAGTGCGCCAAAATGGA
  5   1   2       add Gas1 5g                            IMAGE:6987899                                                         CGTGCGCCAGGCTGCCCGGTAGCAGCCGAGGGGACACAGACAGGCGGCCGATCCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGGAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGGAGCAGTTTTTTCAGTCTCATTATTTTCCACCGGGGACGGGCTGAACACTGGCGGCCAAAGACCTGTTTTGGAGGAGTGCGCCCAAAAGGGAACGAGAGAAGTCCTAAAGTCGAATGGTGGGTCCTCAGGGAAGTGGAGGAAACCCGGATGCCTGGGAACCTCCCTTGGCGGT
  5   1   2       add Neu0 FL                            IMAGE:6994310                                                                     TGCCCGGCAGGAGCCGAGGGGACACAGACAGGCGGCCGATCCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGAAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTTGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTGAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGTAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACCGAGAAGGGATTTCTGGAAACCAGTTTTTTCAGTCTCATTTATTTTCCACCGGGGACCGGCCTGAAACACCTGGGCGCCCCAAAAGAACCTGGTTTTGGT
  5   1   2       ext Gas  5g3  in                   TGas121l20.p1kSP6                                                                                        GGACACAGACAGGCGGCCGATCCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGGAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCG
  5   1   4      seed Te4       in                        CAAN12206.5p                                                                                                                       CACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGGAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACTGTTTGCAGAGTGCGCTAAAATGGACGAGAGAGGTCTAAAGTCGATGGTGTCT
  5   1   2       ext Egg  FL   in                   TEgg030a05.p1kSP6                                                                                                                                                                        GGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGG
  5   1   2       add Gas                            TGas099m13.p1kSP6                                                                                                                                                                                                                                                                                                                                                     GACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCGATGGGAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGACACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAACACCTAGCCGTGAGTCAGGTGATCAGCGC
  5   1   0       chi Gas7      in                         XZG47563.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCAGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTAAAAAAAACCNNAAAAAAAAAAAAAAAAAANAAAAAA
  5   1   2       add Gas1                               IMAGE:6988707                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTTGGGTTACCGGGGTCCTGGAATTCTCCGGGATGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTTGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTGAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGTAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACCGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCTATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGATGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAANAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCGAGTAATGGAATGAAACCCTTGTGCTGAATTGAAAAATCTGACAGGTATTTCATGGTCCACCCC
  5   1   2       ext Gas7      in                          XZG1105.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAATGCTGAAGGAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCAGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGATGCTCGCCGCCGGCCTCAGGAAGGACGATGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGAT
  3   1   0       chi Gas7      in                         XZG47563.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTTTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAACCAGGACGTGGGCATTTCGGCAGCGTTTTTGGCAGATGTTCGGCCACAGACTGAGGGCTGCAACGGATTCCGGTATACCCTGACGTCTGACATCATGGAATCCATATTCCGCAGGTTTCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGATTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCCCCGGGACGGGTTGAACACGGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTTTAAAGTCGATGGTGTTTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCCACGGAATAACTTGATCCTACTGACAAGTTTGTTTCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTTTTTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTCCCCGGGTTTTTAAAAAAAACC
  5   1   2       ext In63                            IMAGE:8958262.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGTATTATCATGGTCACCCCCATACAGTCCCAGCATACGCTCAGCAGAAATCTCAGCTCTTATCTAAGTATAACCACCAATGAACTATACCCAGGCTAACTCAGTTCTTGTCCAGCCGTGCCTGCCTAGTAATACGACTGACGCCTCCTTGAACCCGGAGGTGC
  5   1   2       ext In66                            IMAGE:8965194.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCTGGGATTATATACGATCCCACCACATTCGAATTCGTCCCCGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTGGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCTTGGCACCTCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTTTGTGGCACAGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCAAAGCATTGTGGGTGGTTGTGCTGCAGGACAGTCTGTTACGTATGCGAGAATTCTGTGCGCAAACTGATGCTGTATGGTCTTCTCTTGAACGGACCCTCTCGTGCA
  3   1   2       ext Gas  5g3  in                   TGas121l20.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATGAATGGCACCGGAACCAAAGCCGAGGCGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATCCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTANATTGCTTAAATTAAAAAAAAAAAAAAAAAA
  3   1   4      seed Te4       in                        CAAN12206.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCCAACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTCCTTTTTGTGGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTTAAAAAAA
  3   1   3        nb Te4  5g3  in                        CAAN12491.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTNTGTGGCGCAGGGTATGTGGGTGTACATCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCGGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAGCAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTTAATAAACGTGTAATTGCTT
  3   1   2       ext Te4  5g3  in                         CAAN4112.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACATCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCGGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAGCAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTTAATAAACTGTAATTGCTT
  5   1   3        nb TbA                           TTbA008i08.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATCCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCT
  3   1   2       ext Gas7      in                          XZG1105.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTCGGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTTTGAACGGACCTCTCTGCAAATTGCTAAATCCGCTGCTCACGTTTTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCGGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAGCAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCGGGGTTTGTTTTTTGTTTTTTTTTAATAAAC
  3   1   2       ext Egg  FL   in                    TEgg030a05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCCTTAGATAAAGCAGAGTCATTGACTGTCAGTTGTTCAGTTAAACCCTTTATGTTGCCCCCCCACCAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTTCCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGTTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACGTGTGATGGAGCTGCCTGCCCGCCATGGGAACCTTGGTGCCATTTTGGGGGCAGTGCCCCGGAATAACTTGATCCTAGTGACAAGTATGTATTGGAAGCAGAACCGATATCTCCCTCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTTAAATTTAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAQ5578.3                                                                                                             CCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGAAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTTGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTGAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGTAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACCGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCTATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGCTTATAAAAAAAAAAA
                                                  Xt7.1-CHK-1008277828                                                                                                                   CCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGAAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTTGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTGAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGTAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACCGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCTATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGCTTAxAxxxx
  5   1   2       ext Egg  5g                        TEgg118a13.p1kSP6                                                                           GCAGGAGCCGAGGGGACACAGACAGGCGGCCGATCCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGAAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTTGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTGAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTG
  5   1   3        nb Gas  5g                        TGas029i23.p1kSP6                                                                                                             CCGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGGAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTNCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTNCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGNCTGAACTNACTGGACAGNAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCG
  5   1   4   10 seed Thy1 5g3  in                       CBST12042.fwd .............................................................................................................CGCGTCCCGCACCGACTTATGTGCAGCGGGGCTGCCCCCAATAGCGGGACTCCGGGCCGGGATGGTGCAACATGAGAGGACCTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGAAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTTGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTGAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGTAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACCGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGG
  5   1   2       add Tad0      in                       IMAGE:6981975                                                                                                                                                                                               CTGCTGCCCGTAGTGACATGGCCACCTCCTCCGAAGAAGTCTTACTGATCGTTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCTCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAAGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGGAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGGACCGGCTGAACACTGGCGCCAAAGACCTNGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAAGTCGATGGGTGTCTCAAGGGAGTGAAAGAACCCGGATGGCTGGACCCTCATTGGCCGCTGGGAAAGACAAATT
  5   1   2       add Gas6      in                         ANBT2246.5p                                                                                                                                                                                                                                                  CTAAAAAGGTGCGGCACAAGAAGCAGGATGGGGCCCTCTACCTCATGGCCGAGAGGGTCGCCTGGGCCCCGGAGGGCAAGGACCGGTTCACCATAAGCCACATGTATGCAGATATCAAATGTCAGAAAATCAGCCCCGATGGAAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTTGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTGAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGATGTTCGGCCACAGACTGACGGCTGTAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACCGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCTATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCCTCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGGCATCATC
  5   1   2       add Tbd0      in                       IMAGE:6978049                                                                                                                                                                                                                                                                                                                        AAGCCGGGCTGGTACNCTGGTCCGGAATTCTCCGGGATCAGATATCAAATGTCAGAAAATCAGCCCCGATGGGAAAGCTAAAGTGCAGCTCCAGCTCGTGCTCCATGTCGGCGAGACCACCAACTTCCACTTCTCTAACGATGCGACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAGTTCAAGAGAAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTAAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTTCCACCTCCAGCACCCAAATCCATCCAAAGAGAACAGTTAATGCCGGCCATCATCCAAGCGCTTCAACCCATCAAAAGTGCCATTGGTGGCTCCGCCGCCCGGCCCTCAGGAAGGGACGAAGGCGCCACAGTGGACCCAATGGCCAGCGAGAACCAGCCAGCACCCGAGGGGCAAATTTCCAGAAGACCTTGGGAATT
  5   1   2       add Tbd1      in                        CBXT15000.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAGAAGAACAGAATGCTGAAGGAAGATCCTGTCTTATTCCAGCTGTATAAAGACCTTGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTCTGGGCCAACCGGTTGAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGTAACGGACTTCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCTATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAATGGAATG
  5   1   2       add In63                            IMAGE:8961295.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGAGTTCTGGGCCAACCGGTTGAGCCTGAACTCACTGGACAGCAGCGTGTTGGCGAGCAAGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGTAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACCGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCTATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGATGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAATGAATGAAACCCCTTGTGCTGAATCTGAAGAATCTGACAGGTATATCATGGTCCAACCCCATACAGTCCCAGCATACGCCTTCAGCCAGGATATCTCAGCTCTATCATAGTATAACACAATGGAACTATACCCAGGCTTACTCAGTCTGTCGGCGGTGCTGCTAGTATACGACTGCCGCTCTGACCCGGGGAGCGCTGATGCAGTGTGAATCAGCAGCATTACGCTGGGCACGATTCAATCAGTGAGCTGTACTGGCATGGAACTCTGCCATCTGTCGGTCGTAACTTCAGAGTAGAATGAACTGAAGTTCAGGACTGCCTCGATGGATTAGACCAGCCTGGAATTCAGTCATGTC
  5   1   2       ext Gas6      in                          ANBT449.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGTGTTGGCGAGCATGCAGGACGTGGGCATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGTAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACCGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCTATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGATGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAATGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAAT
  5   1   2       add Gas8      in                          st40f21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCAGCAGGACGTGGGCATATCGGCGGCGTTTTCTGGCAGATGTTCGGCCACAGACTGACGGCTGTAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACCGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCTATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGATGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTACCAGTTTGGCACTCGGGGTACCCCCTGTGTCTCTGTCGCTGCCCTGACTTGGGGTAACATTAAGTGACTCTT
  5   1   3        nb HeRe      in                     EC2CAA10BB07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGACTGACGGCTGCAACGGACTCCGGTATAACCTGACGTCTGACATCATTGAATCCATATTCCGCACGTATCCTGCAGTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACCGAGAAGGATTTCTGGAAGCAGTTCTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCTATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAATGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCCGCCAGGATATTCTCAGCTCTA
  5   1   0       chi In66                            IMAGE:8966442.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTTGAAGCTGAAATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTTCAGTCTCATTATTTCCACCGGGACCGGCTGAACACTGGCGCCAAAGACCTGTTTGCAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTACCAGTTTGGCACTCGGGGTACCCCTTGTGTCTCTGTCGCTGCCCTGACTTGGGGTAACATTAAGTGACTCTTGGGCTCCCCCCACAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAACACAATGGAAACTATACCCCAAGGCTTACTCATGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCGGGGGGAGCGCTGATGCAGTGTGACTCAGCAGGCATTACAGCTGTGCAACGACATCCATCAGCTGAGGCACCTGTACCTGGCAGTGGGGGACTTGCTGGATCATTCTGGGTCCTGCCTTCCCGGTCAACATC
  5   1   3        nb Te4       out                       CAAN12494.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGAGTGCGCCAAAATGGACGAGAGAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTC
  5   1   2       add Gas7      in                         XZG62767.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGCGCGCAC
  5   1   2       add Gas7      in                          XZG4396.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAA
  5   1   2       add Gas8      in                          st39h08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGGCACCGTCCACCTCCAGGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGATGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAATGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGCTGACGGGGCACCTGGAGGAGATGCTACA
  5   1   2       ext TpA       in                   TTpA009o17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGCGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAA
  5   1   3        nb TpA       in                   TTpA009o20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGCGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAAC
  5   1   2       add Neu       in                   TNeu106i24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGCCCCCACGTTTATGTTTCCATAGCGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGACAAATCTGACGGGGCACCT
  5   1   3        nb Egg                            TEgg112m14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATG
  5   1   3        nb Gas8      in                           st1n17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGCCTTGTACATATGGGAGGTGAGTCCGTGGGTAGCTACAGTGCAACTGGGTGCCCGTGGGCCCATCCGTAACCTTCAGGGGATATACACTAAAGTCAGTTCCAGCTGGGGGCACATTTGGCTTTATGGGGGGGCAGATAGGCATTGGGCCCTTTCCTATAGGGGAGCCACATGGAGCCCTCCAGCTATTGCAGAACTCCCAGCTTCCCACCAGTGTAACTGGACTGCAGTTTGGGTACAACCTTAATTAGGGTTTTCAAAATCCATGGAAAATAAAGACCAATTGCAGAGATGTTTAGCATGATGTAGGGAGTGCTATTCTGAGACAACTTACAATTGGTCTTCGTTTATTATTTGTGTTTTTGTCTAGTTTTTACTTTTTGTATCTGGTTGCTAAGGGTCCAAATAATTCAAAAACTAGAAAAAAATAGAGACCAATTGAAAAGTTGCTTAGAACTGACCCAACATACTAAGAGTTAAGTTAAAGGGACAGCTGGGGGCTAACGGCTTGATGACTTGCCCTTGCAGCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGG
  5   1   3        nb Fat1      in                        CABC10444.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAATGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTGGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCANGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGGTCTTTATTCTTTTCTTTTTGTGGCGCAGGGTATGTGGGTGTACG
  5   1   3        nb Gas8      in                           st6j04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTCCGTGGGTAGCTACAGTGCAACTGGGTGCCCGTGGGCCCATCCGTAACCTTCAGGGGATATACACTAAAGTCAGTTCCAGCTGGGGGCACATTTGGCTTTATGGGGGGGCAGATAGGCATTGGGCCCTTTCCTATAGGGGAGCCACATGGAGCCCTCCAGCTATTGCAGAACTCCCAGCTTCCCACCAGTGTAACTGGACTGCAGTTTGGGTACAACCTTAATTAGGGTTTTCAAAATCCATGGAAAATAAAGACCAATTGCAGAGATGTTTAGCATGATGTAGGGAGTGCTATTCTGAGACAACTTACAATTGGTCTTCGTTTATTATTTGTGTTTTTGTCTAGTTTTTACTTTTTGTATCTGGTTGCTAAGGGTCCAAATAATTCAAAAACTAGAAAAAAATAGAGACCAATTGAAAAGTTGCTTAGAACTGACCCAACATACTAAGAGTTAAGTTAAAGGGACAGCTGGGGGCTAACGGCTTGATGACTTGCCCTTGCAGCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGC
  5   1   2       ext Fat1      in                         CABC8186.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCTACAGTGCAACTGGGTGCCCGTGGGCCCATCCGTAACCTTCAGGGGATATACACTAAAGTCAGTTCCAGCTGGGGGCACATTTGGCTTTATGGGGGGGCAGATAGGCATTGGGCCCTTTCCTATAGGGGAGCCACATGGAGCCCTCCAGCTATTGCAGAACTCCCAGCTTCCCACCAGTGTAACTGGACTGCAGTTTGGGTACAACCTTAATTAGGGTTTTCAAAATCCATGGAAAATAAAGACCAATTGCAGAGATGTTTAGCATGATGTAGGGAGTGCTATTCTGAGACAACTTACAATTGGTCTTCGTTTATTATTTGTGTTTTTGTCTAGTTTTTACTTTTTGTATCTGGTTGCTAAGGGTCCAAATAATTCAAAAACTAGAAAAAAATAGAGACCAATTGAAAAGTTGCTTAGAACTGACCCAACATACTAAGAGTTAAGTTAAAGGGACAGCTGGGGGCTAACGGCTTGATGACTTGCCCTTGCAGCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGG
  5   1   3        nb HdA       ?                    THdA034f07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGCCTCCAGCCAGAATATTCTCATCTCTAGCCATAGGATTACACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAATACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGA
  5   1   3        nb TpA                            TTpA030c13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGGGGGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGCGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACCAAAGCCGAGGCGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCAACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCATGGTATGTGGGTGTACGTC
  5   1   3        nb Gas8      in                          st36m21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTGGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTT
  5   1   3        nb Tad5                                 XZT32280.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGCGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACCAAAGCCGAGGCGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCAACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGNGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAATTTACCCTTTCTGTTGC
  5   1   3        nb Tad5                                 XZT61490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTAGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGCGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACCAAAGCCGAGGCGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATG
  5   1   3        nb Gas8      in                          st62f08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTGGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCCC
  5   1   3        nb Gas8      in                          st62g08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTGGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTA
  5   1   2       add Gas8      in                          st28p08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTCTTCGTTTATTATTTGTGTTTTTGTCTAGTTTTTACTTTTTGTATCTGGTTGCTAAGGGTCCAAATAATTCAAAAACTAGAAAAAAATAGAGACCAATTGAAAAGTTGCTTAGAACTGACCCAACATACTAAGAGTTAAGTTAAAGGGACAGCTGGGGGCCGGCTTGATGACTTGCCCTTGCAGCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTA
  3  -1   3        nb Gas8                                  st96c04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGTTGCTTAGAACTGACCCAACATACTAAGAGTTAAGTTAAAGGGACAGCTGGGGGCTAACGGCTTGATGACTTGCCCTTGCANCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCANGCTGCGCAGTATCCCACGGCCTGCGTGGNGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCANGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGNGGGCCCCGGCTGTACTTGTGGCACAG
  5   1   3        nb Gas7                                 XZG37213.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGCGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACCAAAGCCGAGGCGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCC
  5   1   2       ext Eye       in                         CCAX2645.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAAC
  5   1   2       ext Gas6      in                         ANBT3135.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTAC
  5   1   2       ext Gas8      in                          st97k16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACNCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTANATAAAGCANAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGNGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGANCTGCCTGCCCGCCAT
  5   1   2       ext Hrt1      in                         CAAQ5578.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCAATCCCTTCCCGGTGCGCACGGAGCGGCTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCTCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTAT
  5   1   3        nb Tad0      in                     NISC_no12b01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGGTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACCAAAGCCGAGGCGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCAACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTA
  5   1   2       add Tad0                               IMAGE:6983685                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTATCCTGGCGCAACCCCTGGCACCGCGGCCGGACAATGAATGGCACCGGAACCAAAGCCGAGGCGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCAACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCATGACCAAGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTGTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCAGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGACAATTTGGGGGCAGTGCCACTGAATCACTTGATCCTACTGACAAGTCTGTATCGGAAGCACACCGTATTCCCCCCTGACATCGCATCTATCATACATACATGGATATAAACGAGACTCTGTGAGGAACTGTGATACGTAATCTGCATACTACG
  3   1   2       add Tad0      in                       IMAGE:6981975                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   NAGGGGCCCCCCGGGAAATTAAAAGGCCGAAGGGATGTGAGGAAGGAACGCCGCCCACGCCCGCCGTTTTCCACTCCAGGGGCCCCTTTTCCCGTTGCCCCGCGGGTTTTTTTTCTTCTTTTGGCGCCCGACCGGCCATGGATGGCAACTTTGGGTTCTTTTTATTCTTTTCCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCTGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGGCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATCCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTTGTTTTTGTT
  5   1   3        nb Gas6      in                         ANBT3327.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGACAATGAAGTGGCACCGCGAACTAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGATTTCACTCAGGGGCCCCTTTCCGATGCCCGCGGGTCTCTCTCTTCTCTCGCACCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCATGGTATGAGGGTGTACATCTCCTGTGGTGGGGCCCCCGCTTGTACATTTCCTGTGAGAGCCCCAGCTGCAGATGTAGCACAGGGTATACACCTGCTCTATTTCCTTCTGCC
  5   1   3        nb Gas                            TGas037m13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACCGGACCAAACCGAGCGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCANGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCG
  3  -1   3        nb Ova1      in                         CABE3957.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAACAAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCCGGGATATTTTCTGTGCTTCCCCCCCA
  5   1   3        nb Tad5                                 XZT37706.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGCCGAGGAGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACATCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCGGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAGCAAACTGGTAACGTGGCAGCATAACAGCAATGAG
  5   1   3        nb Ova1      in                         CABE2622.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTGAGAAGAACGCGCCACGCCGCCGTTTCACTCAGGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCAGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAAT
  3   1   0       chi Tbd0      in                       IMAGE:6978049                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGTCTATGTTCATTAGATTAGGGGCCTTTGATTGAGAGAAGGTTTTTTTTTTTATGTGGCTATCGCCGTGAAGCAAGATAGGGTTGTTATTTTTTGCANATATGAGGAGCGAGGATAGTGGGAGGTAGTATTCAAGGGGGGAGGGGATTTGGTTGTCCATTTCCTGTGGGGGCCCCGGGTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTGTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGATGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCATAATGACAAGTATGTACGGAAGCAGAACAGTATTCCCCCCCGACCCCCCCACTATATATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCATGGGAGATGTTGCCCGGGATATTTATGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGATGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGG
  5   1   3        nb Gas7                                 XZG29443.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGGCCCCTTTCCGTTGCCCGCGGGTCTCTCTCTTCTCTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCC
  3   1   2       ext Hrt1      in                         CAAQ5578.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTNTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGCTTAAATTGAAAAAA
  3   1   2       ext Fat1      in                         CABC8186.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAAATTGCTTAAAA
  3   1   3        nb Fat1      in                        CABC10444.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTTTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAAATTGCTTAAATTT
  3   1   4      seed Thy1 5g3  in                       CBST12042.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACGTGTAATTGCTC
  3   1   2       add Gas6      in                         ANBT2246.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGCT
  3   1   2       add TpA       out                   TTpA061g04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     aaaaaaaaaaaaaaaaaagcggccgcTTTTTTTTTTTTTTTTTTTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATCCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTTAAAAAAAAAAAAAAAAAAAG
  3   1   3        nb Ova1      in                         CABE2622.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCAGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGCTTAAATTGG
  3   1   2       add Neu       in                    TNeu106i24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCCGACCGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGTCTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGNTAATTGCTAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas8      in                          st62f08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGNTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACAGCGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGC
  3   1   3        nb Gas8      in                          st62g08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTGTT
  3   1   2       add Gas8      in                          st28p08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATGGATGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTGTTTTTGTTTT
  3   1   2       ext Gas8      in                          st97k16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATGCAACTTTGGGTTCTTTATTCTTTTNCCTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTNTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTGTTT
  3   1   2       add Tbd1      in                        CBXT15000.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCTTTCCGTTGCCCACGGGTGTCTCTCTTCTCTCGCGCCGACCGCCATGGACGCAACTTTGGGTTCTTTATTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACCGGTTCTGTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGATTCTCAGCTGTTCAGTTTAACCCTTTCTGTTGCCCCCCCAATGCATTGTGGGTGGTTTGTGCTGCAGGACCGGGTCTGGTACCGTATGCGAGATTTTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTTTGCTTCATCCGGCGATTTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCGTGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTGACAAGTCTGTATCGGAAGCAGAACTGTATCCCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTCCCCAGTGGGTGGGTGCAAGCAAACTGGTAACGTGGCAATATAACAGCAATGAGCCAACCTGGAACTGCTGAGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTTAAAAAAAAAAAAAAA
  3   1   2       ext Gas6      in                          ANBT449.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTTTATTCTTTTCCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACTCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGCTT
  3  -1   3        nb Gas6      in                          ANBT861.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTTTTTTTGCTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTT
  5  -1   3        nb Gas6      in                          ANBT861.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTTTTTTTGCTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGCTTAAATTTG
  3   1   3        nb Gas8      in                           st6j04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCTTTTCCTTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCCAATGAACCCTGGAAACTGCCTGGGTTTGTTTTTGTTTT
  3   1   3        nb Gas8                                  st29p08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCNCCCGNTTGTACATTTCCTGTGGGGNCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGNTGNTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTNTGCAAATTGCTAAACCCGCTGCTCACGTTNTGCTCCATCCGGCGATATGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCNGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAATCTGGTAATCGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGT
  3   1   3        nb Gas8      in                           st1n17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCGGAACTGCTGG
  3   1   3        nb HeRe      in                     EC2CAA10BB07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACTGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCTTGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAGCAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTT
  3   1   3        nb Gas8      in                          st36m21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCCTGGAACTGCT
  3   1   2       add Gas8      in                          st39h08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCAGGGTATGTGGGTGTACGTCTCCTGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGNCCCCGGCTGTANTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGNTCTTTTTCATTAGATAAAGCAGAGTCANTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGNTGCAGGACCAGGTCTGGTACCGTATGCGAGATTNTGTGGCGCAGANTGAATGTTGATGGGTCTCTCTGAACGGACCTATCTGCAAATTGCTAAACCCGCTGCTCACGTTNTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTNTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAANCTGGTAACCGTGGCAGCATAACAGCAATGAAC
  5   1   3        nb Tbd1      in                         CBXT2195.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTGTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTTAAAAAAAAAAAAAAA
  3   1   3        nb Tbd1      in                         CBXT2195.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTGTACGTCTCCTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTGTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTTAAAAAAAAAAAAAAA
  3   1   2       ext Gas6      in                         ANBT3135.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGCTTAAATTTG
  3   1   3        nb Gas6      in                         ANBT3327.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTGGGGGGGCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTTTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGCTTAAATTTG
  3   1   2       ext TpA       in                    TTpA009o17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCAAAGACATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTGTTTTTGAACGGACCTCTTTGCAAATTGCTAAACCCGCTGCTCACGTTTTGCTCCATCCGGCGATTTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCCCTATTTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTTAAATTTAAAAAAAAAAAAAAAAAAAAAAANAAGC
  3   1   3        nb HeRe                             EC2CAA16BD04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCCCGGTTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACTGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCTTGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAGCAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTT
  3   1   2       add Gas7      in                         XZG62767.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATCCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAGCCAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTTAAATTT
  3   1   2       ext Eye       in                         CCAX2645.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTGTGGGGGCCCCCGGCTGTACTTGTGGCACAGGGTATACGCCCTGTACATTTTCCTTTGGGAGCCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTTTGTGGCGCAGACTGAATGCTGATGGGTCTCTTTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTTTGCTCCATCCGGCGATTTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATTTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTTTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATTTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGCTTAAATTTG
  3   1   3        nb TpA       in                    TTpA009o20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTGTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTTTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATTTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTTAAATTTAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add TpA                             TTpA055m03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGGCGCAGGGTATGTGGGTGTACGTCTCCNTGTGGGGGCCCGGCGGTACCGGTTCTGTTTATATGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTTTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCTACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAAACTAATTGCTTAAATTGAAAAAAAAAAAAAAAAAAAA
  3   1   2       add Gas7      in                          XZG4396.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGGACCGGTTCGGTTTAAATGTTCTTTTTCCTTAGAAAAAGCAGAGTCATTGACTTTCAGCTGCTCAGTTTAACCCTTTTTGTTGCCCCCCCAAAACATTGTGGGTGGTTTTTGCTGCAGGACCAGGTTTGGTACCGTATGCGAGATTTTGTGGCGCAGACTGAATGCTGATGGGTTTTTTTGAACGGACCTTTTTGCAAATTGCTAAACCCGCTGCTCACGTTTTGCTCCATCCGGGGATTTGATAATCCCCTGTGAGGGAGCTGCCTGCCCCCCATGGGAACCTTGCTGCCATTTTGGGGGCAGGGCCCCGGAATAACTTGATCCTACTGACAAGTTTGTTTTGGAAGCAGAACCGTATCCCCCCCCGACCCCCCCCCTTTTTTTGCAGAAATGGAAGTATAAGGGGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTTTGTGCATTCCCCCCCAGGGCAGACACGTTGGCATGCTGTGGCATTTTTTCCCAGGGGGGGGGGGCAAACAAACTGGTAACGGGGCAGCATAACAGCAATGAGCCAACCCGGAACTGCGGGGTTTGTTTTTTGTTTTTTTTAATAAACGGTAATT
  3   1   2       add Tbd1      in                        CBXT13338.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGAATTTGTGGACCCCCGGGTCCCCCTTTTTGTTGCCCCCCCCCCCCCCCCAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCGGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTTCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTGACAAGTCTGTATCGGAAGCAGAACCGTATCCCCCCCCAACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTGGATGGGTTCCTGGGAGATGTTGCCTGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTCCCCAGTGGGTGGGTGCAAGCAAACTGGTAACGTTGCAATATAACAGCAATGAGCCAACCTGGAACTGCTGAGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTTAAAAAAAAAAAAAAA
  5   1   2       add Tbd1      in                        CBXT13338.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTTTCTGTTGCCCCCCCCCCCCCCCCCAAACATTGGGGGTGGGTTGGGCTGCAGGAACGGGTCTGGGACCGTATGCGAAATTTTGTGGGGCAAAATGAATGGTGATGGGTCTCTCTGAACGGACCTCTCTGCAAATTGGTAAACCCCCTGCTCACGTTCTGCTTCAT
  3   1   3        nb Tad0      in                     NISC_no12b01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTGTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTTAAAAAGAAAAAAAAAAG
  3   1   3        nb Gas8                                  st70h17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTNTGCTCCATCCGNCGATGTNATAATCACCTGTGACGGAGATGCCTGCCCGCCATNGGAACCTTGCTGCCATTTTGGGGGCANTGCTANGGAATAACTTGATCATANTGNCAAGTCTGTATCGGAAGCAGAACCGTATTNCCCCCCGACCCCCCCACNATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCATGTGCATTCCCCCCCAGTGCAGATCAGCGCNTGGCATGCTGTGAGCATCTTTTCCCANGTGGGTGGGTGCAAACAAACTGGTAACCGTGGCAGCATAACAGCAATGAACCTNGAACTGCTGGGTTG
  3   1   2       add Gas8      in                          st40f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCCTGGAACTGCTGGGTTTGTTTT
  5  -1   3        nb Ova1      in                         CABE3957.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGGGAAGTATGAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGGGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGGGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTAATTGCTTAAATTG
  5   1   2                                         Xt7.1-TNeu088l23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGAGGGTTACATATTTGCCCATTGGGTGGGTACGTGGGTGATGGCGCCAATGAGTAGAACCACCTGGACCTTCTCTCCTTAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTGGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCATCCCTTCCGGTGCGCACGGAGCGCTGGTATCTGGCGCAACCCTGGCACGCGGCGGACATGATGGCACCGACTAAGCGAAGATGAGAGAGCGCACGCGCGGTCATCAGGCCCCTCCGTGCCGGGTTTTCTTCTTGGCCACGCAGAGCACTGGTCTTATTTTCTTGGG------------------------------------------------TTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCNTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATAGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCNAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTGTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTT
                                                  Xt7.1-CHK-1008277820                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTTACATATTTGCCCATTGGGTGGGTACGTGGGTGATGGCGCCAATGAGTAGAACCACCTGGACCTTCTCTCCTTAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTGGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCATCCCTTCCGGTGCGCACGGAGCGCTGGTATCTGGCGCAACCCTGGCACGCGGCGGACATGATGGCACCGACTAAGCGAAGATGAGAGAGCGCACGCGCGGTCATCAGGCCCCTCCGTGCCGGGTTTTCTTCTTGGCCACGCAGAGCACTGGTCTTATTTTCTTGGGCCAGAT------------------------------------------------GGCGCAGGGTATGTGGGTGTACGTCTCNTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATAGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCNAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTGTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTTAAATTT
  5   1   2       ext HdA                            THdA043k11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGAGGGTTACATATTTGCCCATTGGGTGGGTACGTGGGTGATGGCGCCAATGAGTAGAACCACCTGGACCTTCTCTCCTTAGGTCTAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCTTCAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCAATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGANCCCCGGGGGGAGCGCTGNATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCT
  5   1   4      seed Neu       in                   TNeu088l23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCCAATGAGTAGAACCACCTGGACCTTCTCTCCTTAGGGGAAAGTCGATGGTGTCTCAGGGAGTGAAGAACCCGATGCTGGACCTCATGGCGCTGGAAGACAAATGCTTGGAAGAGGGCTACGGAATCTCGTCGGCACCGTCCACCTCCAGCACCAAATCCATCAAAGAGAACAGTAATGCGGCCATCATCAAGCGCGGGAACCATCACAGTGCCATGGTGCTCGCCGCCGGCCTCAGAAGGACGAGGCGCAGAGTGACCAATGCAGCGAGACCAGCAGCACCGACGGCGATTCCAGAGACTCGGATTTCTTTCTGCCTCCTGTCAAAAAGGTGAAGTTACAGGAGGCGATAGAATATGAAGACTTGGACCAGAGTAACGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTGTTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATC
  5   1   2       ext Tbd0                               IMAGE:6978823                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTCCGGGATTGAAGTTACAGGAGGCAATAGAATATGAAGACTTGGACCAGAGTAATGGAATGAAACCCCTTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCCATACAGTCCCAGCAATACGCCTCCAGCCAGGATATTCTCAGCTCTATCCATAGTATTAAACAACAAATGGAAAACTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGGTGCTGCTAGTAGTACGACTGCCGCTCTGACCCCGGGGGGAGCGCTGATGCAGGGTGTGACTCAGCAAGCCATTAACCAGCTGGTGCCAAACGACATCCAATCAGAGCTGAAGCACCTGTACGTGGCAGTTGGGGAGCTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTCAACACCCCCTTCCTAGAGGAAAAGGTAATGAAAATGAAGAGTAACTTGGAGCGGTTCCAGGTGACCAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACAAATCTGACGGGGCACCTGGAGGAGATGCTACAGACGGCCTACACCAAGTTCCACACGTGGCAGTCCAGGCGAATGTTCAAGAAGACGTGAGCGCCTCCCTGCCAGGCTGCGCAGTATCCCACGGCCTGCGTGGGGCCATCCCTTCCGGTGCGCACGGAGCGCTGGTATCTGGCGCAACCCTGGCACGCGGCGGACATGATGGCACCGACTAAGCGAAGATGAGAGAGCGCACGCGCGGTCATCAGGCCCCTCCGTGCCGGGTTTTCTTCTTGGCCACGCAGAGCACTGGTCTTATTTTCTTGGGCCAGATTGTGC
  3   1   4      seed Neu       in                    TNeu088l23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTGTGGCGCAGGGTATGTGGGTGTACGTCTCNTGTGGGGGGGCCCCGGCTGTACATTTCCTGTGGGGGCCCCGGCTGTACTTGTGGCACAGGGTATACGCCTGTACATTTTCCTTTGGGAGCCCGGCGGTACCGGTTCTGTTTATAGTTCTTTTTCCTTAGATAAAGCAGAGTCATTGACTCTCAGCTGCTCAGTTTAACCCTTTCTGTTGCCCCCCCNAAAGCATTGTGGGTGGTTTGTGCTGCAGGACCAGGTCTGGTACCGTATGCGAGATTCTGTGGCGCAGACTGAATGCTGATGGGTGTCTCTGAACGGACCTCTCTGCAAATTGCTAAACCCGCTGCTCACGTTCTGCTCCATCCGGCGATCTGATAATCACCTGTGACGGAGCTGCCTGCCCGCCATGGGAACCTTGCTGCCATTTTGGGGGCAGTGCCACGGAATAACTTGATCCTACTGACAAGTCTGTATCGGAAGCAGAACCGTATTCCCCCCCGACCCCCCCACTATCTATGCAGAAATGGAAGTATAAGGAGAATTTGGTGGGTTCCTGGGAGATGTTGCCCGGGATATTTCTGTGCATTCCCCCCCAGTGCAGACACGTTGGCATGCTGTGGCATCTTTTCCCAGTGGGTGGGTGCAAACAAACTGGTAACGTGGCAGCATAACAGCAATGAACCTGGAACTGCTGGGTTTGTTTTTTGTTTTTTTTAATAAACTGTAATTGCTTAAATTTAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)