Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 90%

 1012073022 Xt7.1-EC1CBA002ZH10.5 - 58 ESTs
                                                                       ..-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xt7.1-EC1CBA002ZH10.5                                                                                             ATGTAATAAAACGTTTTATTATTGGGTCAACTTGCCCTTTAATGTTTGAACTTGCTGAATTGCAATTTCCCACATTCACCTGCAGCCCTTGTGCTCAAGTTGCCAAAGGCTCTGGCAGTGACATGGTTACATTCTCAGCCTCCCCTCACATCAGCTACTGTGTTCCATTCAACAATGCGAGATGTCATTACATGAGGGTTTGCAAGCCAATCGGAGGCACCGGATATCAGCAGACAGCTGACCCATATAAAAAGGAGGACGTGCTGCTGCATGTGCGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008225087                                                                                                   TAAAACGTTTTATTATTGGGTCAACTTGCCCTTTAATGTTTGAACTTGCTGAATTGCAATTTCCCACATTCACCTGCAGCCCTTGTGCTCAAGTTGCCAAAGGCTCTGGCAGTGACATGGTTACATTCTCAGCCTCCCCTCACATCAGCTACTGTGTTCCATTCAACAATGCGAGATGTCATTACATGAGGGTTTGCAAGCCAATCGGAGGCACCGGATATCAGCAGACAGCTGACCCATATAAAAAGGAGGACGTGCTGCTGCxxGxGCxxAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                  2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2    46    47    47    47    49    49    49    49    50    50    50    50    50    50    51    51    51    51    52    52    51    52    52    52    53    53    53    53    52    53    53    53    54    54    54    54    55    55    56    56    56    56    56    56    56    56    55    56    56    56    55    56    56    56    56    56    56    56    55    58    56    58    55    57    55    57    55    57    55    57    51    56    51    56    51    55    46    55    47    51    46    50    36    41    11    28    10    11     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                 CC----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------C-
                                               BLH ATG     334     434                                                                                             
                                               BLH MIN     334      37                                                                                             
                                               BLH MPR     334      37                                                                                             
                                               BLH OVR     334     170                                                                                             
                                               CDS MIN     334      90                                                                                             
                                               EST CLI     275      90                                                                                             
                                               ORF LNG     334       1                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Sc ==== 5e-016     NP_011551.1 Involved in transport of newly synthesized acyl-CoA esters from the fatty acidsynthetase to acyl-CoA-consuming processes; Acb1p [Saccharomyces cerevisiae] =========================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ==== 5e-017     XP_784299.1 PREDICTED: similar to CG8498-PA [Strongylocentrotus purpuratus] =======================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ==== 5e-022     NP_491412.1 Acyl-coA-binding protein, ACBP (9.4 kD) (1F204) [Caenorhabditis elegans] ===========================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dm ==== 4e-023     NP_609187.1 CG8498-PA [Drosophila melanogaster] =========================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Dr ==== 2e-026     NP_955902.1 diazepam binding inhibitor [Danio rerio] =================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === ?? ==== 2e-026     NP_001085947.1 MGC82877 protein [Xenopus laevis] ===============================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 3e-031     AAH99293.1 MGC116485 protein [Xenopus laevis] ===============================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 1e-034     NP_001034933.1 acyl-Coenzyme A binding domain containing 7 [Homo sapiens] ===============================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Mm ==== 1e-035     XP_484966.2 PREDICTED: hypothetical protein LOC78245 [Mus musculus] =====================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Gg ==== 2e-036     XP_429769.2 PREDICTED: similar to ACBP/DBI [Gallus gallus] ==============================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 3e-046     AAI18831.1 MGC146543 protein [Xenopus tropicalis] =======================================================================================================================================================================================
                                                 Xt7.1-EC1CBA002ZH10.5                                                                                                                                           TGA------TGA------------------------------------------------------------TGA------------------------------------------------------------ATG------------------------------------------------------TGA------TAA------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------TAA---------------------------------------------------TGA------------------TAG------------------------TAA---------ATG------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                 ]
  0   1   1           Brn2 FL                         CAAJ14212.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                              GCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3  -1   2       chi Fat1      in                         CABC5656.3p GAGAGGCTCCTATTTAGTTACATGTATATATATAAGGCATAATTCTAAGCAACTTTTTTACAAATGTTAAAAACATTAAATGTTATTTTCAAATGTAATAAAACGTTTTATTATTGGGTCAACTTGCCCTTTAATGTTTGAACTTGCTGAATTGCAATTTCCCACATTCACCTGCAGCCCTTGTGCTCAAGTTGCCAAAGGCTCTGGCAGTGACATGGTTACATTCTCAGCCTCCCCTCACATCAGCTACTGTGTTCCATTCAACAATGCGAGATGTCATTACATGAGGGTTTGCAAGCCAATCGGAGGCACCGGATATCAGCAGACAGCTGACCCATATAAAAAGGAGGACGTGCTGCTGCATGTGCCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGATATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGA
  5  -1   2       bld Fat1      in                         CABC5656.5p                                                                                             ATGTAATAAAACGTTTTATTATTGGGTCAACTTGCCCTTTAATGTTTGAACTTGCTGAATTGCAATTTCCCACATTCACCTGCAGCCCTTGTGCTCAAGTTGCCAAAGGCTCTGGCAGTGACATGGTTACATTCTCAGCCTCCCCTCACATCAGGTACTGTGTTCCATTCAACAATGCGAGATGTCATTACATGAGGGTTTGCAAGCCAATCGGAGGCACCGGATATCAGCAGACAGCTGACCCATATAAAAAGGAGGACGTGCTGCTGCATGTGCCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGATATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCAG
  3   1   2       bld BrSp 5g3  in                    EC0CBA003AF12.b1                                                                                                                                                                                                                                                                                                                                                                           GGGGGCCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGGGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAAGTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                    EC0CBA005BA11.b1                                                                                                                                                                                                                                                                                                                                                                           GGGGGCCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAAGCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                    EC0CBA005DD12.b1                                                                                                                                                                                                                                                                                                                                                                           GGGAGCCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCACCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                    EC0CBA005DH10.b1                                                                                                                                                                                                                                                                                                                                                                           GGGGGCCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTTCAAATAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                    EC1CBA002ZA12.b1                                                                                                                                                                                                                                                                                                                                                                           GGGGGCCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAAGCAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp 5g3  in                    EC0CBA003AF12.g1                                                                                                                                                                                                                                                                                                                                                                            GGGGCCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGGGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAAG
  5   1   2       bld BrSp 5g3  in                    EC0CBA005BA11.g1                                                                                                                                                                                                                                                                                                                                                                            GGGGCCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAAGCA
  5   1   2       bld BrSp 5g3  in                    EC0CBA005DD12.g1                                                                                                                                                                                                                                                                                                                                                                            GGAGCCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATC
  5   1   2       bld BrSp 5g3  in                    EC0CBA005DH10.g1                                                                                                                                                                                                                                                                                                                                                                            GGGGCCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATAAAAA
  5   1   2       bld BrSp 5g3  in                    EC1CBA002ZA12.g1                                                                                                                                                                                                                                                                                                                                                                            GGGGCCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAAGCAAA
  5   1   2       bld BrSp 5g3  in                    EC1CBA002ZG08.g1                                                                                                                                                                                                                                                                                                                                                                            GGGGCCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATTCAGAAAA
  3   1   2       bld BrSp 5g3  in                    EC0CBA002BG05.b1                                                                                                                                                                                                                                                                                                                                                                             GGGGCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAACAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                    EC0CBA003BB04.b1                                                                                                                                                                                                                                                                                                                                                                             GGGGCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGATATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp 5g3  in                    EC0CBA002BG05.g1                                                                                                                                                                                                                                                                                                                                                                              GGGCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTT
  5   1   2       bld BrSp 5g3  in                    EC0CBA003BB04.g1                                                                                                                                                                                                                                                                                                                                                                              GGGCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGATATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTA
  3   1   2       bld BrSp 5g3  in                    EC0CBA001AC07.b1                                                                                                                                                                                                                                                                                                                                                                               GGGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCAGAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                    EC0CBA001AD07.b1                                                                                                                                                                                                                                                                                                                                                                               GGGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTATAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp FL   in                    EC0CBA004AE03.b1                                                                                                                                                                                                                                                                                                                                                                               GGGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGCTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAACCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                    EC0CBA005AC03.b1                                                                                                                                                                                                                                                                                                                                                                               GGGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                    EC0CBA005BA12.b1                                                                                                                                                                                                                                                                                                                                                                               GGGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGATATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                    EC1CBA001ZB01.b1                                                                                                                                                                                                                                                                                                                                                                               GGGGAGACTGTCTCTGTATTGCATCTATATTGTGCTGCCACTGCTACTTCTGTACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                     EC2BBA12CE07.b1                                                                                                                                                                                                                                                                                                                                                                               GGGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTAATCCTGTTCCCTGC
  3   1   2       bld BrSp 5g3  in                     EC2BBA15DF04.b1                                                                                                                                                                                                                                                                                                                                                                               GGGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTTCTTCTTCCTGTTCCCTGC
  3   1   2       bld BrSp                             EC2BBA15DF05.b1                                                                                                                                                                                                                                                                                                                                                                               GGGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCATACATCTTTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATACGTACTATAGATTCCTGCT
  3   1   2       bld BrSp                             EC2BBA30BF03.b1                                                                                                                                                                                                                                                                                                                                                                               GGGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAAAAAAAGGCATGTTTGTCCC
  5   1   2       bld BrSp 5g3  in                    EC0CBA001AC07.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCA
  5   1   2       bld BrSp 5g3  in                    EC0CBA001AD07.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTATA
  5   1   2       bld BrSp 5g                         EC0CBA001AE12.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATTGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTGGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAAT
  5   1   2       bld BrSp 5g3  in                    EC0CBA002CG02.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTCCATTAAACCC
  5   1   2       bld BrSp 5g                         EC0CBA002DA01.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGTACTGACCTATTAAACAGTTTTA
  5   1   2       bld BrSp 5g                         EC0CBA003AD02.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTT
  5   1   2       bld BrSp FL   in                    EC0CBA004AE03.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGCTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAACCAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp 5g3  in                    EC0CBA004CC04.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAG
  5   1   2       bld BrSp 5g                         EC0CBA004DB12.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAGGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTA
  5   1   2       bld BrSp 5g3  in                    EC0CBA005AC03.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAAT
  5   1   2       bld BrSp 5g3  in                    EC0CBA005BA12.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGATATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTT
  5   1   2       bld BrSp 5g                         EC0CBA005BC10.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGATATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCAGAAAAAAAAAAAAAAAAGGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp 5g3  in                    EC1CBA001ZB01.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGTATTGCATCTATATTGTGCTGCCACTGCTACTTCTGTACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCTAAAA
  5   1   2       bld BrSp 5g                         EC1CBA001ZD02.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGTACTGACCTATTAAACAGTTTTA
  5   1   2       bld BrSp 5g3  in                    EC1CBA002ZF03.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAGGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTTCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATC
  5   1   2      seed BrSp 5g3  in                    EC1CBA002ZH10.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCAAAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp 5g3  in                     EC2BBA12CE07.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAACCAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp 5g3  in                     EC2BBA15DF04.g1                                                                                                                                                                                                                                                                                                                                                                                GGGAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCAGAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                     EC2BBA22AC05.b1                                                                                                                                                                                                                                                                                                                                                                                GGGGGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTGCTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTTCATCTTCCTGTTC
  5   1   2       bld 1030 5g                         IMAGE:7029588.5p                                                                                                                                                                                                                                                                                                                                                                                GCCAGACTGTCTCTGCATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCAAAAAAAAAAAAAAAAGGATCC
  3   1   2       bld Brn2 FL   in                        CAAJ14212.3p                                                                                                                                                                                                                                                                                                                                                                                               CATTGCATTTATATTGTGCTGCCACTGCTATTTTTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTGGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATTTTTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTCCAATTC
  5   1   2       bld Brn2 FL   in                        CAAJ14212.5p                                                                                                                                                                                                                                                                                                                                                                                               CATTGCATCTATATTGTGCTGCCACTGCTACTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCANaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld BrSp 5g3  in                    EC1CBA002ZH10.b1                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGCACCAGCCATGTCTCCACAGGCGGACTTTGATAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTCTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACGTGACCTATTAAACAGTTTTACAAATCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                    EC1CBA002ZF03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAGGCTGCAGAAGATGTAAAGAAGTTGAAAACCAGGCCAACTGATGAGGAACTGAAGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAGGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp 5g3  in                     EC2BBA22AC05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGTAGAAAACCATGCCAACTGATGAAGAACTGAAGGAACTATATGGGCTATACAAACAGACAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAACAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTGCTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAAAAAAAAAAATAAAAAAAAAAAAAAAA
  5   1   2       bld Brn3                                CAAK10895.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGAACTATATGGGCTTTACAAACAGTCAACTGTCGGAGACATAAATATAGACTGCCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCAGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGGGGCCCCCCCTAAAATACCCCTGGGGGGGCCCAAGTTTACCCGACCCCGTTTTTTTTGAAAAAAGGGGCCCCTAAAGGGGGCCGATTTAAAACCAAGGCCCGGGCCGTCTTTTTAAAACCCCGGGACGGGAAAAACTCCTACTTGGGAACCTTTGGAAAGAAACCTTACTTTGGGGGGGGGCCAAATTGGGACAACCTCC
  3   1   2       bld BrSp 5g3  in                    EC0CBA004CC04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCTGGAATGTTAGATCTCAAGGCAAAAGCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCGAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                    EC0CBA002CG02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATCTCAAGACAAAAACAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAGCAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTGAAAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAATCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                    EC1CBA002ZG08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAAAATGGGATGCGTGGAATTTAAAAAAAGGATTGTCAAAAGAAGAAACAATGCATGCCTACATCTCTAAAACAAATGAGCTGGTTTAGAAATATGGGCTGTAACGTTCCTCCCTCATTGTGAAAAAAAATGTGATATGTACTATAGATTCCTGCTGATGGTACTATAATCGGCTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTTTTCCTGTTCCCTGCACTGGCCTATTAAACAGTTTTTCGAATCAGAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp      in                     EC2BBA23DE04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTTCTTCTTCCTGTTCCCTGC
  5   1   2       bld BrSp      in                     EC2BBA23DE04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTGAAAAAGAATGTGATATGTACTATAGATTCCTGCTGATGCTACTATAATCGACTGTAGGTTTGTACAAGGTTGGGGGTTCATTAAACCTTAGGCATGTTTGTCCCAGCTATAGAACTGTCTTCTTCCTGTTCCCTGCACTGACCTATTAAACAGTTTTACAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)