Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 198.0    0Xt7.1-CABA4765.5                            2 PI      100      1166     1269                PREDICTED: similar to LOC446287 protein [Gallus gallus]

 This cluster: approximate FL confidence score = 93%

 1012073024 Xt7.1-CABG4542.3 - 62 ESTs
                                                                       .0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABG4542.3  AACTTCCTTGTTCCGAAGGGTGAAATTTCCAATGTCGCAAGCAAGAGGGGTGAAATTAGGTAGCCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGGACAGTGGATGACAGAACGCAGGGGAGGTTCAGATGTAGCGGGTGGTACAGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGTTTACATCTGCCACAGACTCGAACATGAGCTTGACCTTGGGCAGAGTAGTGGACAACCATGGTAACACAGTGCTTGGAACTAAAGGACTCTCTCTGTTTTATCTGGAAGTACGAGATGCTGAAGGAAATCTAAATGGAATTGAAGTTCAAAGGCTTAAGGAAAAGCTTGGTACTCGGCAAGTACCAACTGCTGAGCTGCTGCTGGATGGAGTTAAAGCCCTGAAGATTTCCCCTGAAGGCCGCGGTGTGGCTTCTATCTCCAGCATGCTGACTATAACCCGCATCTATAATACCATCTTTGCTGTAGCAGGAATGAGGAGAATAATCAATTTGGCAAGGGATTATGCAGCTAAACGATTTGTCTTTGGGAAACTGATAAAGGATCATCCCCTTCATATCCAGACCATGGCACGAATGGAGGTTGAGGCTCGTGGAGCTTTTCTTATCATGATGGAGATTTCTAGGCTTCTGGGACTGGAGGAAACAAACATGGCAACAGAGCAGGATCAGCTTCTCCTTCGCCTGTTAATTCCTGTCACTAAATTGTATACTGGCAAGCAGGCCCTTTCAGTTATATCGGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGTTATGCTGAGAGATACTCAGGTTCTGACTATCTGGGAAGGGACGACAAACATCTTGTCTTTAGACGTGCTGCGTTCCGTCATCAAGAGCAAAGGGGAAGTGCTAAGTGCATTGTTTTCAGTTACCCAGGAAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCTTTAAACAAACTTATGGCCTTCACCCAGCAAGCAGGACAGCGCGGGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGGCATCAGCTACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATTAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224828        CTTGTTCCGAAGGGTGAAATTTCCAATGTCGCAAGCAAGAGGGGTGAAATTAGGTAGCCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGGACAGTGGATGACAGAACGCAGGGGAGGTTCAGATGTAGCGGGTGGTACAGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGTTTACATCTGCCACAGACTCGAACATGAGCTTGACCTTGGGCAGAGTAGTGGACAACCATGGTAACACAGTGCTTGGAACTAAAGGACTCTCTCTGTTTTATCTGGAAGTACGAGATGCTGAAGGAAATCTAAATGGAATTGAAGTTCAAAGGCTTAAGGAAAAGCTTGGTACTCGGCAAGTACCAACTGCTGAGCTGCTGCTGGATGGAGTTAAAGCCCTGAAGATTTCCCCTGAAGGCCGCGGTGTGGCTTCTATCTCCAGCATGCTGACTATAACCCGCATCTATAATACCATCTTTGCTGTAGCAGGAATGAGGAGAATAATCAATTTGGCAAGGGATTATGCAGCTAAACGATTTGTCTTTGGGAAACTGATAAAGGATCATCCCCTTCATATCCAGACCATGGCACGAATGGAGGTTGAGGCTCGTGGAGCTTTTCTTATCATGATGGAGATTTCTAGGCTTCTGGGACTGGAGGAAACAAACATGGCAACAGAGCAGGATCAGCTTCTCCTTCGCCTGTTAATTCCTGTCACTAAATTGTATACTGGCAAGCAGGCCCTTTCAGTTATATCGGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGTTATGCTGAGAGATACTCAGGTTCTGACTATCTGGGAAGGGACGACAAACATCTTGTCTTTAGACGTGCTGCGTTCCGTCATCAAGAGCAAAGGGGAAGTGCTAAGTGCATTGTTTTCAGTTACCCAGGAAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCTTTAAACAAACTTATGGCCTTCACCCAGCAAGCAGGACAGCGCGGGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGGCATCAGCTACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATTAAAAAAAAAAAAA
                                                      consensus depths       2     2     6     6     7     7    10    11    10    11    11    11    11    11    12    12    13    13    13    13    13    13    13    13    13    14    13    14    13    14    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    15    14    14    14    14    14    14    14    14    12    12    12    12    11    11    11    11     9     9    10    10    10    10    11    11    11    11    11    11    11    11    11    11    10    10    11    11    11    11     8     8     7     8     7     8     7     8     9     9     7     8     8     8     7     8     7     9     8     9     8     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     8     9     8     9     8     9     7     9     7     9     7     8     7     8     7     8     7     8     7     8     7     9     7     9     7     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9    10    10    10    10    12    12    13    13    12    13    12    13    11    12    10    11    11    12    11    11    11    11    11    11    11    11    11    11    11    11    11    12    11    12    10    11    11    11    11    11    11    11    11    11    11    11    11    11    13    13    13    13    14    15    16    17    16    17    17    18    17    18    18    19    19    22    24    26    24    26    26    26    28    28    28    28    28    28    28    28    29    29    30    30    30    30    30    30    31    31    32    32    33    33    33    33    33    33    33    33    33    33    33    33    32    32    32    32    32    32    32    32    31    31    33    33    32    33    33    33    32    32    32    32    32    32    32    32    31    31    31    31    33    33    33    33    33    33    33    33    33    33    32    32    29    30    29    30    30    30    29    29    29    29    28    28    26    28    27    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    26    28    26    28    26    28    25    27    25    27    25    27    24    25    24    25    23    25    20    25     5     8     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          A-----------
                                               BLH ATG     211     583  
                                               BLH MIN      64     162  
                                               BLH MPR      64     162  
                                               BLH OVR      31      19  
                                               CDS MIN      31      23  
                                               EST CLI       0      23  
                                               ORF LNG      31       7  
                                                                                                                                                                PROTEIN --- Dr ---- 8e-012     NP_997776.1 acyl-Coenzyme A dehydrogenase, very long chain; wu:fb52d04 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                            PROTEIN --- Dm ---- 1e-012     NP_611409.1 CG7461-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                       PROTEIN --- Hs ---- 2e-013     NP_001029031.1 acyl-Coenzyme A dehydrogenase, very long chain isoform 2 precursor [Homo sapiens] -------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 7e-014     NP_766266.3 very-long-chain acyl-CoA dehydrogenase VLCAD homolog [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 2e-134     XP_787606.2 PREDICTED: similar to LOC446287 protein, partial [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 6e-153     NP_001033379.1 Y45F3A.3b [Caenorhabditis elegans] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PREDICTED = Gg ==== 0          XP_415303.2 PREDICTED: similar to LOC446287 protein [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PREDICTED = ?? ==== 0          NP_001086464.1 hypothetical protein LOC446287 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                        PROTEIN === Xl ==== 0          AAH80048.1 LOC446287 protein [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 0          AAH91017.1 Unknown (protein for MGC:107841) [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABG4542.3                                 ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------ATG------ATG------------------------------ATGATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------TAA---------------------------------------TAA------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------TGAATG------------------------------------------TAA------------------------------------------------------------TAGATG------TAAATG------------ATGTAA------------------------------------------------------------TGA---------------------------------------------------------------------------------------ATG------------------------------------------------------------------TAAATG------------------ATG---------------------------------------------------------ATG---------------------------TAA---TAA------------TGA---------ATG---------------TAA---------------ATG------------------------------------------TAA
                                                                   ORF                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  0   1   1           Egg  FL                     TEgg002p08.FL-Sanger                         AATTTCCAATGTCGCAAGCAAGAGGGGTGAAATTAGGTAGCCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGGACAGTGGATGACAGAACGCAGGGGAGGTTCAGATGTAGCGGGTGGTACAGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGTTTACATCTGCCACAGACTCGAACATGAGCTTGACCTTGGGCAGAGTAGTGGACAACCATGGTAACACAGTGCTTGGAACTAAAGGACTCTCTCTGTTTTATCTGGAAGTACGAGATGCTGAAGGAAATCTAAATGGAATTGAAGTTCAAAGGCTTAAGGAAAAGCTTGGTACTCGGCAAGTACCAACTGCTGAGCTGCTGCTGGATGGAGTTAAAGCCCTGAAGATTTCCCCTGAAGGCCGCGGTGTGGCTTCTATCTCCAGCATGCTGACTATAACCCGCATCTATAATACCATCTTTGCTGTAGCAGGAATGAGGAGAATAATCAATTTGGCAAGGGATTATGCAGCTAAACGATTTGTCTTTGGGAAACTGATAAAGGATCATCCCCTTCATATCCAGACCATGGCACGAATGGAGGTTGAGGCTCGTGGAGCTTTTCTTATCATGATGGAGATTTCTAGGCTTCTGGGACTGGAGGAAACAAACATGGCAACAGAGCAGGATCAGCTTCTCCTTCGCCTGTTAATTCCTGTCACTAAATTGTATACTGGCAAGCAGGCCCTTTCAGTTATATCGGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGTTATGCTGAGAGATACTCAGGTTCTGACTATCTGGGAAGGGACGACAAACATCTTGTCTTTAGACGTGCTGCGTTCCGTCATCAAGAGCAAAGGGGAAGTGCTAAGTGCATTGTTTTCAGTTACCCAGGAAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCTTTAAACAAACTTATGGCCTTCACCCAGCAAGCAGGACAGCGCGGGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGGCATCAGCCACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAATGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCATATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAAAAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATTAAAAAAAAAAAAAAAAAA
  5   1   1           AbdN FL                     IMAGE:7021893.FL-MGC                            TTCCAATGTCGCAAGCAAGAGGGGTGAAATTAGGTAGCCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGGACAGTGGATGACAGAACGCAGGGGAGGTTCAGATGTAGCGGGTGGTACAGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGTTTACATCTGCCACAGACTCGAACATGAGCTTGACCTTGGGCAGAGTAGTGGACAACCATGGTAACACAGTGCTTGGAACTAAAGGACTCTCTCTGTTTTATCTGGAAGTACGAGATGCTGAAGGAAATCTAAATGGAATTGAAGTTCAAAGGCTTAAGGAAAAGCTTGGTACTCGGCAAGTACCAACTGCTGAGCTGCTGCTGGATGGAGTTAAAGCCCTGAAGATTTCCCCTGAAGGCCGCGGTGTGGCTTCTATCTCCAGCATGCTGACTATAACCCGCATCTATAATACCATCTTTGCTGTAGCAGGAATGAGGAGAATAATCAATTTGGCAAGGGATTATGCAGCTAAACGATTTGTCTTTGGGAAACTGATAAAGGATCATCCCCTTCATATCCAGACCATGGCACGAATGGAGGTTGAGGCTCGTGGAGCTTTTCTTATCATGATGGAGATTTCTAGGCTTCTGGGACTGGAGGAAACAAACATGGCAACAGAGCAGGATCAGCTTCTCCTTCGCCTGTTAATTCCTGTCACTAAATTGTATACTGGCAAGCAGGCCCTTTCAGTTATATCGGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGTTATGCTGAGAGATACTCAGGTTCTGACTATCTGGGAAGGGACGACAAACATCTTGTCTTTAGACGTGCTGCGTTCCGTCATCAAGAGCAAAGGGGAAGTGCTAAGTGCATTGTTTTCAGTTACCCAGGAAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCTTTAAACAAACTTATGGCCTTCACCCAGCAAGCAGGACAGCGCGGGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGGCATCAGCTACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATTAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Te4       in                        CAAN11732.5p AAACTTCCTTGTTCCGAAGGGTGAAATTTCCAATGTCGCAAGCAAGAGGGGTGAAATTAGGTAGCCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGGACAGTGGATGACAGAACGCAGGGGAGGTTCAGATGTAGCGGGTGGTACAGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGTTTACATCTGCCACAGACTCGAACATGAGCTTGACCTTGGGC
  5   1   2   14  bld Te4  5g3  in                         CAAN9973.5p .AACTTCCTTGTTCCGAAGGGTGAAATTTCCAATGTCGCAAGCAAGAGGGGTGAAATTAGGTAGCCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGGACAGTGGATGACAGAACGCA
  5   1   2   14  bld Te5  5g3  in                         CAAO2140.5p ...CTTCCTTGTTCCGAAGGGTGAAATTTCCAATGTCGCAAGCAAGAGGGGTGAAATTAGGTAGCCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGGACAGTGGATGACAGAACGCAGGGGAGGTTCAGATGTAGCGGGTGGTACAGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGTTTACATCTGCCACAGACTCGAACATGAGCTTGACCTTGGGCA
  5   1   2   10  bld Te1  5g3  in                        CBWN17066.b1 ...CTTCCTTGTTCCGAAGGGTGAAATTTCCAATGTCGCAAGCAAGAGGGGTGAAATTAGGTAGCCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCAACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGAAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTG
  5   1   2       bld Te1       out                       CBWN16555.b1        CTTGTTCCGAAGGGTGAAATTTCCAATGTCGCAAGCAAGAGGGGTGAAATTAGGTAGCCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGGACAGTGGATGACAGAACGCAGGGGAGGTTCAGATGTAGCGGGTGGTACAGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGGTTACAT
  5   1   2   20  bld Te1  5g                              CBWN9617.b1 .......CTTGTTCCGAAGGGTGAAATTTCCAATGTCGCAAGCAAGAGGGGTGAAATTAGGTAGCCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAG
  5   1   2   10  bld Thy1 5g3  in                         CBST562.fwd ....................GTGAAATTTCCAATGTCGCAAGCAAGAGGGGTGAAATTAGGTAGCCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGGACAGTGGATGACAGAACGCAG
  5   1   2       bld Egg  FL   in                   TEgg002p08.p1kSP6                           TTTCCAATGTCGCAAGCAAGAGGGGTGAAATTAGGTAGCCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGG
  5   1   2       bld TbA  5g3  in                   TTbA076k10.p1kSP6                           TTTCCAATGTCGCAAGCAAGAGGGGTGAAATTAGGTAGCCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCANGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGG
  5   1   2   14  bld Te4  5g3  in                        CAAN10157.5p ...........................TTCCAATGTCGCAAGCAAGAGGGGTGAAATTAGGTAGCCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTC
  5   1   2       bld AbdN FL                            IMAGE:7021893                                  TCCATGTCCAAGCAAGAGGGGGAAATTAGTACCTTCTATTGGCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGGACAGTGGATGACAGAACGCAGGGGAGGTTCAGATGTAGCGGGTGGTACAGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGTTTACATCTGCCACAGACTCGAACATGAGCTTGACCTTGGGGCA
  5   1   2       bld Egg                            TEgg112c08.p1kSP6                                                                           GCAAGACAACATGGAAGAAACGTAAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAGACATTGCAGGATGCCTATAAACATTTGACTTC
  5   1   2       bld Te3                                 CAAM15535.5p                                                                                                CGTAATCCCTGGCTACTGTGCCAACCTTCATGTTACATGGGGAGCAAAAGTGCTCTGTCACCAGCCCTCGGCCATCCAGGCGATATTCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGGACAGTGGATGACAGAACGCAGGGGAGGTTCAGATGTAGCGGGTGGTACAGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGTTTACATCTGCCACAGACTCGAACATGAGCTTGACCTTGGGCAGAGTAGTGGACAACCATGGTAACACAGTGCTTGGAAACTAAGGACTCTCTCTGTTTTATCTGGGAG
  5   1   2       bld In62                            IMAGE:8952398.5p                                                                                                                                       ACCCGAAATATTTTTAGAGGGATCTTAAAAAGTATTCGAATTCGTCCCCAGCTACAGGGGATTTTGGATGAGTTAAAGATGCCTTTCTCCCGTGCGGCGATAGGGAATTTTTTCCAACAAATGCCTTCTTTAGGAAACCAGTTCTTAGAGGATGCTCTGCTCCAAAGTTACCTAAAGAGGCACCTTCCTCCTCAGGTTCTCAGTGAGATGAGTCAGGACTGTAAACGATTCGCTCAACGCTTAGTGGAGGAAATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGGACAGTGGATGACAGAACGCAGGGGAGGTTCAGATGTAGCGGGTGGTACAGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGTTTACATCTGCCACAGACTCGAACATGAGCTTGACCTTGGGCAGAGTAGTGGACACCATGGTAACACAGTGCTTGGAACTAAAGGACTCTTCTCTGTTTTTATCTGGAGTACGAGATGCTGAAGAAATCTAAATGACTGAGTCAAAGCTAAGAAAGCTTGGTACTTCGGCAGTACCAACTGCTGAGACCTGCCTTGCCTGGAT
  5   1   2       bld Te5       in                         CAAO7289.5p                                                                                                                                                                                                                                                                                                                                                                                                  AATAGATTCTCTAGGAAGGGACTGTGAGCTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGGACAGTGGATGACAGAACGCAGGGGAGGTTCAGATGTAGCGGGTGGTACAGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGTTTACATCTGCCACAGACTCGAACATGAGCTTGACCTTGGGCAGAGTAGTGGACAACCATGGTAACACAGTGCTTGGAACTAAAGGACTCTCTCTGTTTTATCTGGAAGTACGAGATGCTGAAGGAAATCTAAATGGAATTGAAGTTCAAAGGCTTAAGGAAAAGCTTGGTACTCGGCAAGTACCAACTGCTGAGCTGCTGCTGGATGGAGTTAAAGCCCTGAAGATTTCCCCTGAAGGCCGCGGTGTGGCTTCTATCTCCAGCATGCTGACTATAACCCGCATCTATAATACCATCTTTGCTGTAGCAGGAATGA
  5   1   2       bld Spl1      in                         CABK8842.5p                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAATCCACCACGCTTACAGCAGTACGATGCCTGGGGACGCAGGGTGGATCAGATTATTACCTGCTCAGCTTGGAAGAAAATGAAAGAACTTTCAGCAGAGGAAGGTCTGGTTGCAGAAGCGTATGAGAGGAGATATTCCAGCTGGAGCCGTCTTATCCAGGTTGTCAAGCTCTATCTGTATTCTCCATCTGCTGGACTCTTCACCTGCCCCCTAGCTATGACTGATGGCGCTGCCAAGGTTATTGAGTCTCTGGGTGTCCCAGAACCATTGCAGGATGCCTATAAACATTTGACTTCAAGAAATCCCAGCAATTTCTGGACCTCTGGACAGTGGATGACAGAACGCAGGGGAGGTTCAGATGTAGCGGGTGGTACAGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGTTTACATCTGCCACAGACTCGAACATGAGCTTGACCTTGGGCAGAGTAGTGGACAACCATGGTAACACAGTGCTTGGAACTAAAGGACTCTCTCTGTTTTATCTGGAAGTACGAGATGCTGAAGGAAATCTAAATGGAATTGAAGTTCAAAGGCTTAAGGAAAAGCTTGGTACTCGGCAAGTACCAACTGCTGAGCTGCTGCTGGATGGAGTTAAAGCCCTGAAGATTTCCCCTGAAGGCCGCGGTGTGGCTTCTATCTCCAGCATGCTGACTATAACCCGCATCTATAATACCATCTTTGCTGTAGCAGGAATGAGGAGAATAATCAATTTGGCAAGGGATTATGCAGCTAAACGATTTGTCTTTGGGAAACTGATAAAGGATCATCCCCTTCATATCCAGACCATGGCACGAATGGAGGTTGAGGCTCGTGGAGCTTTTCTATCATGATGGAGATTTCTAG
  3  -1   2       bld Int1      in                        CAAP10947.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTGGACCTCTGGACAGTGGATGACAGAACGCAGGGGAGGTTCAGATGTAGCGGGTGGTACAGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGTTTACATCTGCCACAGACTCGAACATGAGCTTGACCTTGGGCAGAGTAGTGGACAACCATGGTAACACAGTGCTTGGAACTAAAGGACTCTCTCTGTTTTATCTGGAAGTACGAGATGCTGAAGGAAATCTAAATGGAATTGAAGTTCAAAGGCTTAAGGAAAAGCTTGGTACTCGGCAAGTACCAACTGCTGAGCTGCTGCTGGATGGAGTTAAAGCCCTGAAGATTTCCCCTGAAGGCCGCGGTGTGGCTTCTATCTCCAGCATGCTGACTATAACCCGCATCTATAATACCATCTTTGCTGTAGCAGGAATGAGGAGAATAATCAATTTGGCAAGGGATTATGCAGCTAAACGATTTGTCTTTGGGAAACTGATAAAGGATCATCCCCTTCATATCCAGACCATGGCACGAATGGAGGTTGAGGCTCGTGGAGCTTTTCTTATCATGATGGAGATTTCTAGGCTTCTGGGACTGGAGGAAACAAACATGGCAACAGAGCAGGATCAGCTTCTCCTTCGCCTGTTAATTCCTGTCACTAAATTGTATACTGGCAAGCAGGCCCTTTCAGTTATATCGGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGTTATGCTGAGAGATACTCAGGTTCTGACTATCTGGGAAGGGACGACAAACATCTTGTCTTTAGACGTGCTGCGTTCCGTCATCAAGAGCAAAGGGGGAGTGCTAAGTGCATTGTTTTCAGTTAC
  5   1   2       bld Ova1      in                         CABE5982.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCAGGGGAGGTTCAGATGTAGCGGGTGGTACAGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGTTTACATCTGCCACAGACTCGAACATGAGCTTGACCTTGGGCAGAGTAGTGGACAACCATGGTAACACAGTGCTTGGAACTAAAGGACTCTCTCTGTTTTATCTGGAAGTACGAGATGCTGAAGGAAATCTAAATGGAATTGAAGTTCAAAGGCTTAAGGAAAAGCTTGGTACTCGGCAAGTACCAACTGCTGAGCTGCTGCTGGATGGAGTTAAAGCCCTGAAGATTTCCCCTGAAGGCCGCGGTGTGGCTTCTATCTCCAGCATGCTGACTATAACCCGCATCTATAATACCATCTTTGCTGTAGCAGGAATGAGGAGAATAATCAATTTGGCAAGGGATTATGCAGCTAAACGATTTGTCTTTGGGAAACTGATAAAGGATCATCCCCTTCATATCCAGACCATGGCACGAATGGAGGTTGAGGCTCGTGGAGCTTTTCTTATCATGATGGAGATTTCTAGGCTTCTGGGACTGGAGGAAACAAACATGGCAACAGAGCAGGATCACCTTCTCCTTCGCCTGTTAATTCCTGTCCCTAAATTGTATACCGTCCAGCAG
  5   1   2       bld Mus1      in                         CABH1246.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAAACTATTGCACACAGACAGGACGATGGCACATATAGGTTACGTGGCTACAAGTGGTTTACATCTGCCACAGACTCGAACATGAGCTTGACCTTGGGCAGAGTAGTGGACAACCATGGTAACACAGTGCTTGGAACTAAAGGACTCTCTCTGTTTTATCTGGAAGTACGAGATGCTGAAGGAAATCTAAATGGAATTGAAGTTCAAAGGCTTAAGGAAAAGCTTGGTACTCGGCAAGTACCAACTGCTGAGCTGCTGCTGGATGGAGTTAAAGCCCTGAAGATTTCCCCTGAAGGCCGCGGTGTGGCTTCTATCTCCAGCATGCTGACTATAACCCGCATCTATAATACCATCTTTGCTGTAGCAGGAATGAGGAGAATAATCAATTTGGCAAGGGATTATGCAGCTAAACGATTTGTCTTTGGGAAACTGATAAAGGATCATCCCCTTCATATCCAGACCATGGCACGAATGGAGGTTGAGGCTCGTGGAGCTTTTCTTATCATGATGGAGATTTCTAGGCTTCTGGGACTGGAGGAAACAAACATGGCAACAGAGCAGGATCAGCTTCTCCTTCGCCTGTTAATTCCTGTCACTAAATTGTATACTGGCAAGCAGGCCCTTTCAGTTATATCGGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGTTATGCTGAGAGATACTCAGGTTCTGACTATCTGGGAAGGGACGACAAACATCTTGTCTTTAGACGTGCTGCGTTCCGTCATNCAGAGCAAAGGGGAAGTGCTAAGTGCATTGTTTTCAGTTACCCAGGAAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCT
  5   1   2       bld Int1                                 CAAP7281.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGCCACAGACTCGAACATGAGCTTGACCTTGGGCAGAGTAGTGGACAACCATGGTAACACAGTGCTTGGAACTAAAGGACTCTCTCTGTTTTATCTGGAAGTACGAGATGCTGAAGGAAATCTAAATGGAATTGAAGTTCAAAGGCTTAAGGAAAAGCTTGGTACTCGGCAAGTACCAACTGCTGAGCTGCTGCTGGATGGAGTTAAAGCCCTGAAGATTTCCCCTGAAGGCCGCGGTGTGGCTTCTATCTCCAGCATGCTGACTATAACCCGCATCTATAATACCATCTTTGCTGTAGCAGGAATGAGGAGAATAATCAATTTGGCAAGGGATTATGCAGCTAAACGATTTGTCTTTGGGAAACTGATAAAGGATCATCCCCTTCATATCCAGACCATGGCACGAATGGAGGTTGAGGCTCGTGGAGCTTTTCTTATCATGATGGAGATTTCTAGGCTTCTGGGACTGGAGGAAACAAACATGGCAACAGAGCAGGATCAGCTTCTCCTTCGCCTGTTAATTCCTGTCACTAAATTGTATACTGGCAAGCAGGCCCTTTCAGTTATATCGGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGTTATGCTGAGAGATACTCAGGTTCTGACTATCTGGGAAGGGACGACAAACATCTTGTCTTTAGACGTGCTGCGTTCCGTCATCAAGAGCAAAGGGGAAGTGCTAAGTGCATTGTTTTCAGTTACCCAGGAAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGCAGCAAAGCACACACTGAGAGCTTTAACAAACTTATGGCCTTCACCCAGCAAGCAGGA
  5   1   2       bld Spl1      in                         CABK9199.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCTCTCTGTTTTATCTGGAAGTACGAGATGCTGAAGGAAATCTAAATGGAATTGAAGTTCAAAGGCTTAAGGAAAAGCTTGGTACTCGGCAAGTACCAACTGCTGAGCTGCTGCTGGATGGAGTTAAAGCCCTGAAGATTTCCCCTGAAGGCCGCGGTGTGGCTTCTATCTCCAGCATGCTGACTATAACCCGCATCTATAATACCATCTTTGCTGTAGCAGGAATGAGGAGAATAATCAATTTGGCAAGGGATTATGCAGCTAAACGATTTGTCTTTGGGAAACTGATAAAGGATCATCCCCTTCATATCCAGACCATGGCACGAATGGAGGTTGAGGCTCGTGGAGCTTTTCTTATCATGATGGAGATTTCTAGGCTTCTGGGACTGGAGGAAACAAACATGGCAACAGAGCAGGATCAGCTTCTCCTTCGCCTGTTAATTCCTGTCACTAAATTGTATACTGGCAAGCAGGCCCTTTCAGTTATATCGGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGTTATGCTGAGAGATACTCAGGTTCTGACTATCTGGGAAGGGACGACAAACATCTTGTCTTTAGACGTGCTGCGTTCCGTCATCAAGAGCAAAGGGGAAGTGCTAAGTGCATTGTTTTCAGTTACCCAGGAAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCTTTAAACAAACTTATGG
  5   1   2       bld Gas7                                 XZG11752.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATCTAAATGGAATTGAAGTTCAAGGCTTAAGGAAAAGCTTGGTACTCGGCAAGTACCAACTGCTGAGCTGCTGCTGGATGGAGTTAAAGCCCTGAAGATTTCCCCTGAAGGCCGCGGTGTGGCTTCTATCTCCAGCATGCTGACTATAACCCGCATCTATAATACCATCTTTGCTGTAGCAGGAATGAGGAGAATAATCAATTTGGCAAGGGATTATGCAGCTAAACGATTTGTCTTTGGGAAACTGATAAAGGATCATCCCCTTCATATCCAGACCATGGCACGAATGGAGGTTGAGGCTCGTGGAGCTTTTCTTATCATGATGGAGATTTCTAGGCTTCTGGGACTGGAGGAAACAAACATGGCAACAGAGCAGGATCAGCTTCTCCTTCGCCTGTTAATTCCTGTCACTAAATTGTATACTGGCAAGCAGGCCCTTTCAGTTATATCGGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGTTATGCTGAGAGATACTCAGGTTCTGACTATCTGGGAAGGGACGACAAACATCTTGTCTTTAGACGTGCTGCGTTCCGTCATCAAGAGCAAAGGGGAAGTGCTAAGTGCATTGTTTTCAGTTACCCAGGAAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCANAGCACACACTGAGAGCTTTAAACAAACTTATGGCCTTCACCCAGCAAGCAGGACAGCGCGNGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGC
  5   1   2       bld Gas       in                   TGas140i23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACGATTTGTCTTTGGGAAACTGATAAAGGATCATCCCCTTCATATCCAGACCATGGCACGAATGGAGGTTGAGGCTCGTGGAGCTTTTCTTATCATGATGGAGATTTCTAGGCTTCTGGGACTGGAGGAAACAAACATGGCAACAGAGCAGGATCAGCTTCTCCTTCGCCTGTTAATTCCTGTCACTAAATTGTATACTGGCAAGCAGGCCCTTTCAGTTATATCGGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGTTATGCTGAGAGATACTCAGTTCTGACTATCTGGGAAGGGACGACAAACATCTTGTCTTTAGACGTGCTGCGTTCCGTCATCAAGAGCAAAGGGGAAGTGCTAAGTGCATTGTTTTCAGTTACCCAGGAAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCTTTAAACAAACTTATGGCCTTCACCCAGCAAGCAGGACAGCGCGGGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGGCATCAGCTACAG
  3   1   2       bld Te5       in                         CAAO7289.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCATATCCAGACCATGGCACGAATGGAGGTTGAGGCTCGTGGAGCTTTTCTTATCATGATGGAGATTTCTAGGCTTCTGGGACTGGAGGAAACAAACATGGCAACAGAGCAGGATCAGCTTCTCCTTCGCCTGTTAATTCCTGTCACTAAATTGTATACTGGCAAGCAGGCCCTTTCAGTTATATCGGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGTTATGCTGAGAGATACTCAGGTTCTGACTATCTGGGAAGGGACGACAAACATCTTGTCTTTAGACGTGCTGCGTTCCGTCATCAAGAGCAAAGGGGAAGTGCTAAGTGCATTGTTTTCAGTTACCCAGGAAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCTTTAAACAAACTTATGGCCTTCACCCAGCAAGCAGGACAGCGCGGGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGGCATCAGCCACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAATGGAAAATTATAAAAATTGACCTCGGCAACAGT
  5   1   2       bld Gas       in                   TGas127m08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCTCCTTCGCCTGTTAATTCCTGTCCTACCTTAATACTGGCAAGCAGGCCCTTTCAGTTATATCGGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGTTATGCTGAGAGATACTCAGGTTCTGACTATCTGGGAAGGGACGACAAACATCTTGTCTTTAGACGTGCTGCGTTCCGTCATCAAGAGCAAAGGGGAAGTGCTAAGTGCATTGTTTTCAGTTACCCAGGAAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCTTTAAACAAACTTATGGCCTTCACCCAGCAAGCAGGACAGCGCGGGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGGCATCAGCTACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCG
  5   1   2       bld Sto1      in                         CABG1628.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGACGTGCTGCGTTCCGTCATCAAGAGCAAAGGGGAAGTGCTAAGTGCATTGTTTTCAGTTACCCAGGAAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCTTTAAACAAACTTATGGCCTTCACCCAGCAAGCAGGACAGCGCGGGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGGCATCAGCTACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTANACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCANAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGG
  5   1   2       bld Gas8      in                           st5c08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCATTGTTTTCAGTTACCCAGGAAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCTTTAAACAAACTTATGGCCTTCACCCAGCAAGCAGGACAGCGCGGGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGGCATCAGCTACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAAT
  5   1   2       bld Te4       in                         CAAN6088.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTCAGTTACCCAGGAAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCTTTAAACAAACTTATGGCCTTCACCCAGCAAGCAGGACAGCGCGGGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGGCATCAGCCACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAATGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCATATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGC
  5   1   2       bld Gas                            TGas016n08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCTTTAAACAAACTTATGGCCTTCACCCAGCAAGCAGGACAGCGCGGGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGGCATCAGCCACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAATGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCATATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATNAGGAAATAGATGCAATCTTAAA
  3  -1   2       bld Ovi1      in                         CABI7005.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAAACTAGATGCTGCATCTTGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCTTTAAACAAACTTATGGCCTTCACCCAGCAAGCAGGACAGCGCGGGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGGCATCAGCTACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGAAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCCAATGTATCATGCAGG
  5   1   2       bld Sto1      in                         CABG4542.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGTGTCCCTAGCTTGTCCCAGGCAGCAAAGCACACACTGAGAGCTTTAAACAAACTTATGGCCTTCACCCAGCAAGCAGGACAGCGCGGGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGGCATCAGCTACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACANGCACAAAGATAGCAAATGTATCATGCAGGGACACAAGTACATCACGTGGGTA
  5   1   2       bld Tad5      in                         XZT25944.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCCTTCACCCAGCAAGCAGGACAGCGCGGGGGCAACTATATGGAGCTTGCTGCACGAGACTTCGCTTATAGCCTGGCTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGGCATCAGCCACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAATGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCATATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGC
  5   1   2       bld Gas                            TGas034e01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTAAGATCTATATCGGTACTCTTTTACTGGACCATGCAGCCTGGAAAGGGCATCAGCTACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCC
  5   1   2       bld HeRe      in                     EC2CAA17BE01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTACAGACATCTACTGTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCTGTGGATACTGCCATGGAATCAGGCTGTTATGACTCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAAAATTGACCTTGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAACTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACCAAGGATATATAGAAATTACTTTAACTC
  3   1   2       bld Gas       in                    TGas140i23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACCAGTTAATAAAAGCCAGTCAATTTATATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te5  5g3  in                         CAAO2140.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCATGGAATCAGGCTGTTATGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAATGGAAAATTATAAAAATTGACTTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCATATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACTAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAAAAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATT
  3   1   2      seed Sto1      in                         CABG4542.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGACCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATAT
  3   1   2       bld Spl1      in                         CABK8842.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTGAGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTAAAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTT
  3   1   2       bld Gas       in                    TGas127m08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCCAGTCAATTTATATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4       in                         CAAN6088.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCAGTGTCCCTAGACAGACAGCTAGTGTATGACAATAGCCCTCTTTTTAAATGAAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCATATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAAAAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATT
  3   1   2       bld Spl1      in                         CABK9199.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATAT
  3   1   2       bld Mus1      in                         CABH1246.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGGAAAATTATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATT
  5  -1   2       bld Int1      in                        CAAP10947.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATAAAAATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGA
  3   1   2       bld Sto1      in                         CABG1628.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTGACCTCGGCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATT
  3   1   2       bld Te4  5g3  in                        CAAN10157.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGACCTCGGCANCAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCATATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAAAAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATT
  3   1   2       bld Te4       in                        CAAN11732.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGCAACAGTAAGATTGACCCATCATTTTTATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATT
  3   1   2       bld Gas8      in                           st5c08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCANCAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTAC
  3   1   2       bld Te4  5g3  in                         CAAN9973.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAACAGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAGAGGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCATATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAAAAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATT
  5  -1   2       bld Ovi1      in                         CABI7005.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAGTAAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCCAGTCAATTTATATT
  3   1   2       bld TbA  5g3  in                    TTbA076k10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTAAGATTGACCCATCATTTTTAATTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTTTGAACACTCTTCTTTTTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTTTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCCAGTCAATTTATATTAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Ova1      in                         CABE5982.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTGCTCAAAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATT
  3  -1   2       bld Gas5                                   XZF767.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAATGTGCAATAGAAAATGATAGTAGTATAATTCAAGAGGATAATGTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATG
  3   1   2       bld Thy1 5g3  in                         CBST562.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTATCGCCTTCTGGAATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATTAAAAAAAAAAAAAA
  3   1   2       bld Te5       ?                          CAAO9639.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATATATAAAAGGCTATTACAAGTAAGAAGTTTGGTGACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCATATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAAAAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTACAATACAGTTAATAAAAGCAGTCAATTTATAT
  3   1   2       bld Te1  5g3  in                        CBWN17066.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCATAGAATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAACTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACCAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATATGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCATGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGGAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCAGAACACTCTTCTTTCTGCACAAAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTAAATTTATATTAAAAAAAAAAAAAAAGA
  3   1   2       bld Egg  FL   in                    TEgg002p08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATAATACAAGGCTGCTGGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCATATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAAAAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT25944.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGCAAGGGGCCATAATATCCCAATTCTTGAATTACCCCATTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCATATCTTAAACTTCAAATAACTAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTCCAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCCCCAGTCACAGCACTACCCCCACAGTGCCCCCAGCAAAAAAGATAGCAAATGTTTCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTTTGAACACTTTTCTTTTTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCCCAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTTTGACATCAGAACATGCCATTTATAAAGATTTAATTTCCAAGATGTACAATGTTTGATTGTATAATCCAGTTAATAAAAGCAGTCAATTTTTTTTT
  3   1   2       bld HeRe      in                     EC2CAA17BE01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTAATTTCTGAATGCCGGATAAATATCCAAAATTGGATCAAATCTTAAACTTCAAATAACCAAGGATATATAGAAATTACTTTAACTCAAAAAGCCACTTTGTCCCATTGATATGGAAATAGATGCAATCTTAAATGGGTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCATGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGGAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCAGAACACTCTTCTTTCTGCACAAAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATG
  3   1   2       bld Int1      in                         CAAP1249.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATT
  5   1   2       bld Int1      in                         CAAP1249.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACTTTGTCCCATTGATAAGGAAATAGATGCAATCTTAAATGGTTCCAGTTCTAATGTAATGTGCATCACTCCCACCTGCACCAAGTTGGAACAGCCGTGTTGGAATCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAACAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4       in                         CAAN7976.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAAAAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATT
  5   1   2       bld Te4       in                         CAAN7976.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTACATTCTACAGTGAGGAACACTGAAACATGAAGGGACTGCAAAGCACCAGTCACAGCACTACCCCCACAGTGCCCACAGCAAAAAAGATAGCAAATGTATCATGCAGGAACACAAGTACATCACGTGGGTAGTACCAACACATGCCTCTGAACACTCTTCTTTCTGCACATAAATGAGTGCTTTTCAGCTTACTATGGGCATTGTTTTGACAGCAGCACAGTTAGTGCTGATTATAGTATGTACTGTTGGAAAAATGTCAGTAGGGCAGCAATTTGTACATCTCTAAGTTTAAAACAGCTTATTCTGACATCAGAACATGCCATTTATAAAGATTTAATTTACAAGATGTACAATGTTTGATTGTATAATACAGTTAATAAAAGCAGTCAATTTATATTAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)