Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012073033 Xt7.1-TGas121i13.3 - 107 ESTs
                                                                       .........-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas121i13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACTTTTTTTTATTTGCCTTCCAAGTCCTGATCTGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAATAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008223029                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTATTTGCCTTCCAAGTCCTGATCTGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAATGAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   3     6     4     9     5    12    11    22    11    22    13    23    13    25    14    25    14    26    13    29    15    29    15    29    14    28    14    28    15    29    17    31    17    31    17    31    17    31    17    31    17    31    28    31    28    31    28    31    28    31    28    31    29    33    31    33    29    33    28    33    29    33    29    33    30    34    30    35    29    35    30    35    28    36    32    36    32    36    29    36    29    36    32    36    31    35    30    35    24    34    25    35    31    35    26    32    28    31    28    32    26    31    23    30    27    32    29    34    31    35    28    31    24    26    24    26    24    26    24    26    25    27    25    27    25    27    25    26    25    25    24    24    24    24    24    24    26    26    26    26    25    25    24    24    24    24    24    24    23    23    23    23    25    25    25    25    27    28    28    28    29    29    32    33    32    33    32    33    31    32    33    33    33    33    34    35    33    35    34    36    34    36    35    37    35    37    35    40    37    40    38    42    38    43    40    45    40    46    42    47    45    51    43    51    43    51    46    53    42    51    44    51    45    52    45    51    43    50    43    51    42    51    41    51    43    51    44    52    43    52    44    52    42    52    44    53    43    53    43    52    40    51    38    51    44    51    35    51    35    51    35    51    35    51    34    51    34    51    34    51    33    51    34    51    32    50    32    51    32    51    32    50    32    49    29    45    26    44    26    44    23    40    21    37    22    37    21    37    21    36    22    37    22    36    21    35    21    32    23    31    22    31    22    31    22    30    19    29    18    25    18    23    10    16     4     6
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------T----
                                               BLH MIN     785       3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH MPR     125       3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 2e-007     NP_511061.1 Protein phosphatase V CG12217-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 9e-011     XP_791318.2 PREDICTED: similar to phosphoprotein phosphatase (EC 3.1.3.16) PPV - rat, partial [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------============================================================================================================
                                                    Xt7.1-TGas121i13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAATAA---TGA---------ATG---TAGTAA---------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------ATG---------------TAA------------------------------------TAG------------------------------------------------------TAA---------------------------------------TGA------------------------ATG---------------------------------------------------------------------------------TAA------------------------------------------------------------------------------TGAATG---------------------TAG---TGA------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------TAGTAA------------------------------------TAA------ATG---------------------------------------------------------------------------------TAG------------------------------------------TGA------------------------------------------TAA---------------------------ATG---------------------------------------TAATAG------------------------------------------------------------------------------------------------------------------------------TGA------------------------------TAA---------TAA---------------------------------TGA---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------TAAATG------TAA------------------------------------------------ATG---------------------------------------------TGA---------------------------------------------------TAATAA---------------------------------------------------TAATAATAA
  5   1   0       add Egg                            TEgg081g16.p1kSP6 TTTATGGCGTTTGCCATATTGCCGGTCTATGCCTGCCCCTATAGTTACACAACAGCTTTGTTTAGAGGAAATTTCCAAATGTTCAGTGTGTTACTCTTTGAAATGAGAGAAAACTATAAAAGTCAATGAGTCCAGAATAGTCAGAAAAATCCCATCATACAAATCTACTTTTAAACTTTAGTTTATCAGAGTTCAACTTGCAATGCTTCATTCTTACATTGTATTGAGTGCCATTCAATATTTATTATATAACTGGTGAAAACCAATTATCTTGTTTGCAGATTTTACATTTTTGGTATATAGTTTGATCAAATTATTACATACACAGAATGTTTTTATTTGATTTGAGTTTGTAATTCAAACTGGTTGTGAGACTGAAACCCTACCAATCAGGCATTTGTTTGAACAAAACATTGGAAAAGCAAGCAGTTTTAAGGGCGGGGGTATAAAGTTTATTTTAAAGTAAACAGGCTCCCCAATTAGTCATCTTTTTGGTTGGTGAGATTACTACCACTAGTGACTGGACAAAAGTCTGAATCTGAAAAACCCCTGTCAGAAAAAATAAATCTTTATTATTTAAAATGCTTAGTTTTAAAGCTACAGACAAGGATCAGTGCTGCTGACAGGCTCTCTCCTCTGCTCTCT
  5   1   2       bld Tad5      in                          XZT8986.5p          ACCTCTTATACTATCCTCACCCAACAGTATTTTCAACCTGCATGATAGATATTTGGCTGATTTACTAGCGATCTCAAGATTTTGACTGTAGGGATGAATCATCAGCTTTTATTGGCCCATCTGTGGCTGGCTGGCTTTGGTTTATAGTATGGCATTAAAGTGTTTACGATTGCGGTTATCATTAGATCAGCTGCACACTGATATCATTAGGGCAATGGCACATGCAATTTTAAAGGAAGAAGAGTAACACCAAAAAATGTATTAataaataagctgctgtgtaggccacgggggcagccatgcaatcttgaataaagtagaaaaggaacaggttttatagcagataacagatTGTTTTACAGAGTTTATCTACCCCTTATTCAGGTCTGGACTGGAATTCGGAATATTATTTTAAATTACACAGAGGCCCAAACCGCCCCCTTACCAGTCCAATACATAGGGACTGTTTATGGCATTTGCCATATTGCCGGTCTATGCCTGCCCCTATAGTTACACAACAGCTTTGTTTAGAGGAAATTTCCAAATGTTCAGTGTGTTACTCTTTGAAATGAGAGAAAACTATAAAAGTCAATGAGTCCAGAATAGTCAGAAAAATCCCATCATACAAATCTACTTTTAAACTTTAGTTTATCAGAGTTCAACTTTTTTTTATTTGCCTTCCAAGTCCTGATCTGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCCAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGT
  5   1   0       add Neu                            TNeu081a23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                     TTAAATTACACAGAGGCCCAAACCGCCCCCTTACCAGTCCAATACATAGGGACTGTTTATGGCGTTTGCCATATTGCCGGTCTATGCCTGCCCCTATAGTTACACAACAGCTTTGTTTATAGGAAATTTCCAAATGTTCAGTGTGTTACTCTTTGAAATGAGAGAAAACTATAAAAGTCAATGAGTCCAGAATAGTCAGAAAAATCCCATCATACAAATCTACTTTTAAACTTTAGTTTATCAGAGTTCAACTTGCAATGCTTCATTCTTACATTGTATTGAGTGCCATTCAATATTTATTATATAACTGGTGAAAACCAATTATCTTGTTTGCAGATTTTACATTTTTGGTGTATAGTTTGATCAAATTATTACATACACAGAATGTGTTTATTTGATTTGAGTTTGTAATTCAAACTGGTTGTGAGACTGAAACCCTACCAATCAAGCGTTTGTTTGAACAAAACATTGGAAAAGCAAGCAGTTTTAAAGGCGGGGGTGTAAAGTTTATTTTAAAGTAAACAGGCTCCCCAATTAGTCATCTTTTTGGTTGGTGAGATTACTACCACTAGTGACTGGACAAAAGTCTGAATCTGAAAAACCC
  5   1   2       bld Tad5      in                         XZT31184.5p                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGTTTTAAGGGCGGGGGTATAAAGTTTATTTTAAAGTAAACAGGCTCCCCAATTAGTCATCTTTTTGGTTGGTGAGATTACTACCACTAGTGACTGGACAAAAGTCTGAATCTGAAAAACCCCTGTCAGAAAAAATAAATCTTTATTATTTAAAATGCTTAGTTTTAAAGCTACAGACAAGGATCAGTGCTGCTGACAGGCTCTGTCCTCTGCTCTCTCAGTTGTCTTATGAAGGGATCAGCAACTTTTTTTTATTTGCCTTCCAAGTCCTGATCTGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGNCAGTAATATGTTTTACTTCTGGCTGTCTAAATGTCTGCAATAG
  5   1   2       bld Gas7      in                         XZG37924.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCACCAGCTGATTGTATCACAATATGCAAGTGAAGCAGCAGAGGGAAGGCTTGTGCACAAACCAGTTCAGTGTCAACTTTTTTTTATTTGCCTTCCAAGTCCTGATCTGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATANCAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCA
  5   1   2       bld Egg0      in                         dad69e10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGGGCTTTTTTTTTATTTGCCTTCCAGTCCTGATCTGGGNAAACCCCTTACTGAGAGCAGGTGGCANGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTGGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCGAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCT
  3  -1   2       bld Egg       in                    TEgg004f08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTTTTTTTTCATTTGCCTTCCAGTCCTGATCTGGTAACTCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGATGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTCTGTAAGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCTGAGCATGCACGATTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAGAGCCTTTCTATTGCCGATCATTTGGGTTGCTGCAAGTAAAGCATGTTACTCGCTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCGAGTGGTGTGTTTTGCTTCTGGCTGTCTAGATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAA
  5   1   2       bld Gas7      in                         XZG57882.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCATCGATTCAAATTCGTCGACCCACGCGTCCGGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTGAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGATGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTCTGTAAGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCTGAGCATGCACGATTTTGTTATGCGCTACTGTAGGTGGCAAATCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTG
  3  -1   2       bld Egg       in                    TEgg011b23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTTTTTTTGCCTTCCAGTCCTGATCTGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGATGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTCTGTAAGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCTGAGCATGCACGATTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAGAAGCCTTTCTATTGCCGATCATTTGGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCGGGTAATATGTTTTACTTCTGGCTGTCTAGGTGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAAT
  5   1   2       bld Egg                            TEgg081n09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATTTGCCTTCCAAGTCCTGATCTGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTACCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTGGGTTGCTGCAAGTGAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAG
  5   1   2       bld Tad5      in                         XZT60609.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGACGCGTGGGCGGACGCGTGGGGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAAATCATGTT
  5   1   2       bld Egg                            TEgg103i24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGGGCTGATCTGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCGGTGCTGTCCTGGTCTGTAGCTTCGAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGATGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTCTGTAAGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCTGAGCATGCACGATTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTGGGTTGCTGCAAGTAAAACATGTTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATGTGTTTTACTTCTGGCTGTCTAGATGTTCTGCAATACGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAAGGCCCTTAAAGTAACACACGGCCTGCTTTCACCT
  3  -1   2       bld Egg       in                    TEgg022i16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCCAGTCCTGATCTGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCGGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGGTCATTTGGGTTGCTGCAAGTAAAACATATTACTCGCTGCTACTGCCCTTTGCATTTTCCT
  5   1   2       bld Gas       in                   TGas121i13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGGGGATCTGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTG
  5   1   2       bld Egg       in                   TEgg022d03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGATCTGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAGTAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGATGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTCTGTAAGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCTGAGCATGCACGATTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAGGGCCTTTCTATTGCCGATCATTTGGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATGTGTTTTACTTCTGGCTGCCTAAATGTT
  5   1   2       bld Neu       in                   TNeu073f11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTGATCTGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCAT
  5   1   2       bld Egg                            TEgg103g13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGATCTGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTGGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCGAGTAATATGTTTTGCTTCTGGCTGTCTAGATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGT
  5   1   2       bld Gas       in                   TGas126p01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGATGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCTGAGCATGCACGATTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCAGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCATCTTCCAGAGCCCTTAAAGTAACACACAGCTGCTTTCACCTTTGTGGCATAAAA
  5   1   2       bld Egg       in                   TEgg050b23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGATGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTCTGTAAGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCTGAGCATGCACGATTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAGAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTGCTTCTGGCTGTCTAAATGTTCTGCAATAGGAGGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATT
  5   1   2       bld Egg       in                   TEgg073k18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGATGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTCTGTAAGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCTGAGCATGCACGATTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTGGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCGAGTAATGTGTTTTACTTCTGGCTGTCTAGATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCA
  5   1   2       bld Gas                            TGas045e10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCGGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGATGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTCTGTAAGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCTGAGCATGCACGATTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTGGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCGGGTAATATGTTTTACTTCTGGCTGTCTAGATGTTCTGCAATAGGAAGGTTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACT
  5   1   2       bld Egg       in                   TEgg020i16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCGGTGCTGTCCTGGTCTGTAGCTTCGAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAGGAGCCTTTCTATTGCCGATCATTTGGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCGAGTAATGTGTTTTGCTTCTGGCTGTCTAGATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATC
  5   1   2       bld Egg                            TEgg081n06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAATCCCTTACTGAGAGCAGGTGGCAGATGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGATGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTCTGTAAGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCTGAGCATGCACGATTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTGGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTGATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAA
  5   1   2       bld Gas7      in                         XZG53942.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGAAATCCCTTACTGAGAGCAGGTGGCAGATGGGAAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATANCAGACTACTAGTTTTATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCA
  5   1   2       chi Egg0      in                         dad64f07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCGGCAGATGGGAAAAGCCTGTGTTCGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNTTTTTTTTTTTTTTTTNNNTTTCTCNCCCCCCCCNNNNNCCNCCCCCCCCCCCCCCCCCCCCCCNNCNNCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCNCCCCCCCCCCCCCCCCC
  5   1   2       bld Te5       in                         CAAO6166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGATGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTCTGTAAGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCTGAGCATGCACGATTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTT
  5   1   2       bld Spl1      in                         CABK6527.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAAGCCTGTGTTAGCAGTGCTGTCCTGGTCTGTAGCTTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAGGGGCCTTTCTATTGCCGATCATTTGGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCA
  5   1   2       bld Egg       in                   TEgg014e20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGCCCCGGGTCAAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGATGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTCTGTAAGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCTGAGCATGCACGATTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTGAAACATATTGCTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTGCTTCTGGCTGTCTAGGTGTTCTGCAATAGGAAGGTTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGT
  5   1   2       bld HdA                            THdA023m13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGCACCTACCCAACCGAACTACTAAAAATGACTTACAGAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTACGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTG
  5   1   2       bld TpA                            TTpA005p18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAAACACATTGATCACTTGTTTCACGTGCATTACTTTTCAGCAACTGGAATCTTTG
  5   1   2       bld TpA                            TTpA005p20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAAACTGAACTAATAAAAATGATTTTCAAAAATGTTTTAGTAAAAAGAAAATCCAAGTAATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATA
  5   1   2       bld Gas8      in                          st87l02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAAAAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGANGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGA
  5   1   2       bld Gas8      in                          st88l02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATAGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGA
  5   1   2       bld Gas7      in                         XZG42274.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATCAGTGATTGCAAAGATTACTTACCTTTATGAAATATCAAAAGAATCAATTTTTCTTCCTGGTTATTATTGGCTGAACGCTAGTTTCCTATCTAATTCTTTTAATGTTAAAGCACTTTTGTAGGTGGCTGCTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTGGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTGCTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGGACAGTTAT
  5   1   2       bld TpA                            TTpA008g01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAATGCATTTGCATTGTGGTTAACCATCAGAGCATGCACGTTTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCAAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCT
  5   1   2       bld Gas                            TGas034j05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAAGTGTGGTATTAAAAAACCTTTAAGAGTAAGCAGTGTAAAGAGGAAAAGCATTTGCATTGTGGTTAACCATCTGAGCATGCACGATTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAA
  5   1   2       bld TbA       in                   TTbA075f21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATCTGAGCATGCACGAATTTTGTTATGCGCTACTGTAGGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCAAGTAAAACATATTACTCACTGCTACTGCCCTTTGCTTTTCCTGTGACTAAGCCGGAATGCTGCAAGTAATATGTCTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTCCCAGGGCCCTTATAGTAACACACGGCTGCTTTCACCTTTGTGGCAT
  5   1   2       bld Gas7      in                         XZG48427.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACCATGCACGTTTTTGTTATGCGCTACTGTAAGTGGCAAATCCCATAAAAAGCCTTTCTATTGCCGATCATTTAGGTTGCTGCCAGTAAAACATATTACTCACTGCTACAGCCCTTTGCATTTTCCTGGGACTAATCCGGATTGCTGCCAGTGATATGTTTTACTTCTGGCTGACTAAATGTTCTGAAATAGGAAGGTTTTTTCGGGAAATTCACAATCTCCTCATCTTCCACGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCACAAATTC
  5   1   2       bld Egg       in                   TEgg025k23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCATAAGAAGCCTTTCTATTGCCGATCATTTGGGTTGCTGCAAGTAAAGCATATTACTCGCTGCTACTGCCCTTTGCATTTTCCTGTGACTAAGCCGGATTGCTGCGAGTAATGTGTTTTACTTCTGGCTGTCTAGATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTA
  5   1   2       bld TpA       in                  TTpA022a12.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTCCTGTGACTAGCCGGATTGCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCAAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGGAATGTANGCACTCCCACTATCCTTTGTGGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAAT
  5   1   2       bld Tad5      in                         XZT35261.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTGCAAGTAATATGTTTTACTTCTGGCTGTCTAAATGTTCTGCAATAGGAAGGTTTTTTCGGGAAATTCAAAATCTCCTCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCANGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCT
  5   1   2       bld Gas                            TGas112o03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTATTGGCCCATCTGTGGCTGGCTGGCTTTGGTTTATAGTATGGCATTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCCAAGATAGGCCCAATCTATAGTAAGCTTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGACAGATGCACCATAAT
  5   1   2       bld Tad5                                 XZT23992.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATCTTCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCAAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTT
  5   1   2       bld Egg                            TEgg028l07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTATATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATAT
  5   1   2       bld Tad5                                 XZT40359.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGGGCCCTTAAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCAAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCNTGTGCTGNAAATATTGCTTTAATTCACTNGTATTTCCNAGCTGNTGAAAAAAAGTTGA
  5   1   2       bld Gas                            TGas010l07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTAAGTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTATATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAG
  5   1   2       bld Spl2      in                        CBSS1922.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTAACACACGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCAAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTANATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAA
  5   1   2       bld Egg       in                   TEgg030b10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGCTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTATATGTGATTCCCAAAGGCACTATGGCTGCCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATACAGCTCCCCATA
  5   1   2       bld Gas       in                   TGas137c10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGCTTTCACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTATATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAG
  5   1   2       bld HdA       in                  THdA016c11.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACCTTTGTGGCATAAAAATCAGAAATTCAAATCTGTGACCCCTCCTACACTATTTACATGAATGTTCTCCGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCAAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGATAT
  5   1   2       bld Gas7      in                         XZG56635.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGACCCTATTGAAAATTAGATCTGATACAAGACTACTAGTTTAATACTGTTGCCTGTATTTCTTTTGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTATATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAATGGCCAAAGGCATCAGTTTGGTGTAAAGCCTT
  5   1   2       bld Limb      in                        CBSU9514.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCAGTTTGTCCATATTAACAATCTGAAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCAAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTG
  3   1   2       bld Gas7      in                         XZG57882.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCTAATTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTATATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAATGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATCAACTTTTATTACCCTTCATCCGCC
  3   1   2       bld Neu       in                    TNeu073f11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTGCAGAGCGCGCCAGTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCAAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTTTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAACGCAGATCTGTAAATGAGAAAATAAAGCTTTGTCAAAGGC
  3   1   2       bld Egg       in                    TEgg050b23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTAGTGCATGAGGGCTACAAATTCATGTTTGGTGAGAAGCTTGTAACTGTGTGGGCTGCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTATATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTTTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAATGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGGATTCTGTAAATGAGAAAATAAAGCTTTTTCAAAAAAAAAAAAAAAAAA
  5   1   2       bld TbA       in                   TTbA033b05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTTGCCAGATTACCCTGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAACAACTGGAATCTTTGTTGTAGGTTATATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTACAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTACTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAAGTGCAATGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGATAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGATATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGTTTTTTTTTTTTTTATAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAAAAGATTTCAGCAGCAAATCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGACAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTT
  3   1   2       bld Egg       in                    TEgg020i16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTTTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATTCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAAATAAAGCTTTTGTTCAAAGGCTGCATTTTTTTGGGATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATGAGTCACATA
  3   1   2       bld Egg       in                    TEgg073k18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGCATGGCAAAGATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTATATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAATGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAAGGCTGCATTTTTTTTTGCATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATNGCAGCTTTTGTACATGTATATTGATATAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG48427.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAGGCCCAATCTATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAC
  3   1   2       bld Limb      in                        CBSU9514.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATAGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGGGAAAATAAAGCTTTGTAAAGGC
  5   1   2       bld Tad5                                 XZT66601.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGACGCGTGGGCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTAAAAAAANAAAAAAA
  3   1   2       bld Te5       in                         CAAO6166.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTAAGATTGTCACTTACCATACTGGAGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTATATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAATGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTT
  5   1   2       bld Egg       out                  TEgg028d18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGGCAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTG
  3   1   2       bld Gas       in                    TGas137c10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTATATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAATGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTTTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAAGTTGAATATACTGTTGTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTTTGCATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGNAGTCACATAGAGGTAAATAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ova1      in                         CABE7074.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGGATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAAATGTACCAATCC
  3   1   2      seed Gas       in                   TGas121i13.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGATATGTGCCATAATATAACATGACGAGTTATCATGTGTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTAATAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA075f21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATATGTGCCATAATATAACATGACGAGTTATCATGTGTTTTCCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTATATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAATTAGAGGCTTGCAATTTAAGAGTACTAACTTTGCATTGAGTTAATTTGTGTGCCATTGCTTTTTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGAGGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAATGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAAAGTAGGCACTCCCCCTATCCTTTGTGGAGGGAGTTGCCCAGCTGAATTTTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTGGAATATACTGTTGTTTTTTTTTTTTTTGTAAGGGCTTTCACCATTTTTTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCCGTAAGGACCGGAGGATTTCAGCAGCAAAGCTATCAAGGATTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAGGCGGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGAATGCATTTTTTTAAGCATTTTCATTTTATTTTTAAGAATAGAAGACTTCATAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas7      in                         XZG53942.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTTATCATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTC
  3   1   2       bld Tad5      in                         XZT31184.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATGTGTTTACCAAAACACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTTTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCCCCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCCCTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTTTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTTTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAAG
  3   1   2       bld Tad5      in                         XZT35261.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACAATTGATCACTTGTTCAACGTGCATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTC
  5  -1   2       bld Egg       in                   TEgg004f08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTATATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAATGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGCCCGGG
  3   1   2       bld TpA       in                    TTpA022a12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTACTTTTCAGCAACTGGAATCTTTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTAAAATAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl1      in                         CABK6527.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCAGCAACTGGAATTCTTTGTGGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAAAAAAAAAAA
  5  -1   2       bld Egg       in                   TEgg022i16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGTTGTAGGTTAAATGTGATTCCCAAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCAAAAAA
  3   1   2       bld Spl2      in                        CBSS1922.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGGCACTATGGCTGGCGGACCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAATG
  3   1   2       bld Gas7      in                         XZG37924.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAATG
  3   1   2       bld Ova1      in                         CABE7074.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGTGTGAACTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAATG
  5   1   2       bld Gas                            TGas024l14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCGGGCTAGAGGCTTGCAATCTAAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAA
  3   1   2       bld Brn3 FL   out                       CAAK11384.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGAGTACTAACTCTGCATTGAGTTAATTTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAATGCATCTCTTTTTTTGATGTCTAAAGGTTGGGGTGAAGTCACCAAATATC
  3   1   2       bld Tad5      in                         XZT60609.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAGTACTAACTCTGCATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAATGCAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7      in                         XZG42274.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATTGAGTTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCCCTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTTTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAAT
  3   1   2       bld Gas       in                    TGas126p01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATTGAGTAATTTGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGACAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCAGCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTTGTAGGGAATGTAGGCACTCCCGCTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGGTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTATAAAAAAAA
  3   1   2       bld HdA       in                   THdA016c11.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGAGTTAATTTGTGTGCCATTGCTCTTTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTTTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTTTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg025k23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTGTGCCATTGCTCTCTGCACTGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAATGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTTTGCATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAATGAAAAAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Egg       in                   TEgg011b23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAATGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGTTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTTTGCATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACAAAA
  3   1   2       bld Egg       in                    TEgg014e20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATGGCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAATGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTTTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTTTGCATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld HdA                            THdA003l01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGGCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAATGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTTTGCATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAAT
  3   1   2       bld Tad0                             NISC_no12e02.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Gas8      in                          st87l02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCNGTATGCTTTCCNGTTAGNGGGGCNGNTGCNCCNTAATAGNATAAAGCTCCCCNTATCNGGNGCNGNGGCCNAAGGCNTCNGTTTGGGGTAAAGCCNTGGNTAACNATAAGNCCNGGTAGGGAAAGTAGGCNCTCCCCCTNTCCNTTGNGGNGNGAGTTGCCCNGNTGAATTTTACNCTTTCCCCCCTTCCNTGNGCNGNAAATATTGNTTTAATTCNCTGNTATTTCCNAGNTGGNGAAAAAAAGNTGAANATACNGTTGGNTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTGTTTAAAGCAGATC
  3   1   2       bld Egg       in                    TEgg030b10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTATGCTTTCCTGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAATGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTTTTGCATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                          XZT8986.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTTAGTGGGGCAGATGCACCATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTT
  3   1   2       bld Neu       in                    TNeu063d14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTATCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu072o21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTATCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu063d14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATAATAGAATAAAGCTCCCCATATCAGGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTGAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAG
  5   1   2       bld Neu       in                   TNeu072o21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATAATAGAATAAAGCTCCCCATATCATGTGCAGTGGCCAAAGGCATCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTGGTAGGGAATGTAAGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCATCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATG
  5   1   2       bld BrSp                             EC2BBA15CE08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGGCCAAAGGCAGCAGTTTGGTGTAAAGCCTTGGTTAACAATAAGACCTTGTAGGGAATGTAGGCACTCCCGCTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGGTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTA
  3   1   2       bld Egg0      in                         dad64f07.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAATAAGACCTGGTAGGGAATGTAGGCACTCCCACTATCCTTTGTGGAGTGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAATGAAAAAAA
  5   1   2       bld Egg                            TEgg009d03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGTTGCCCAGCTGAATTCTACACTTTCCCCCCTTCCTTGTGCTGTAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGTTTTTGTCAAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAAT
  3   1   2       add Gas8      in                          st88l02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTGAATTTTNCNCTTTNCCCCCNTCCNTGNGNCGNAAANATTGNTTTAANTCCCTGNTATTTNCNANGTGGGGNAAAAAANNTGNANANACNGTTGGNTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCNTGTGTTGTGCGTGTNATAAACNTTTATTACCCNTCATCCGCCATGTTGTTTAAAGCNGA
  3   1   2       bld Gas7      in                         XZG56635.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAATATTGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTTTGCATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAAT
  3   1   2       bld Egg0      in                         dad69e10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCTTTAATTCACTGTTATTTCCAAGCTGGTGAAAAAAAGTTGAATATACTGTTGGTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCANAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCCAAGGCTGCATTTTTTTGGTATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTTTTTAATAAAAAAA
  5   1   2       bld Neu                            TNeu138d07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGAAAAAAGTTGAATATACTGTTGTTTTTTTTTTTTTTTGTAATGGCTCTCACCATTTTCTGCTATCTCTATCCAATATTTGTATTTTTCATTTTTTTTCCTGTAAGGACCAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTATAAACTTTTATTACCCTTCATCCGCCATTTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTGTCAAAGGCTGCATTTTTTTTTGCATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTGCTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAATGCG
  3   1   2       bld Egg       in                    TEgg022d03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTAGGGCCCAGAGGTTTTCAGCGGCAAAGTTATCAGGGCCTGATTGGTAAATCCCTGGTGTTGGGGGTGTTATAAACTTTTATTCCCCTTCATCCCCCATTTTGTTTTAAAGCAGTTCTGTAAAGGAGAAAATAAAGCTTTTGTCAAGGGCGGCATTTTTTTTGGCATTTTCATTTTTATTTTTAGGAATGGAGACTTCATTAAAAAAAAGGCAGCTTTGGTACAGGTATATGGATATAATGGTCCCAATCCTGGGGTTTTTTCCCCCTCCAAAATCCGGTCTTTAATAAAATATAT
  3  -1   2       add TbA                             TTbA060g23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTTTTTTTTTTTTTTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAAAGCTGCATTTGTTTTTTGCATTTTCATTTTTATTTTTATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCNC
  3  -1   2       bld TpA       in                    TTpA057p06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTTTTTTTTTTTGAATAGAGACTTCATTAAAAAAAATGCACGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAATG
  5  -1   2       bld TpA       in                   TTpA057p06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGAATAGAGACTTCATTAAAAAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCTTTAATAATGAAAAAAAAAAAAAAACCCCGGG
  3   1   2       bld TbA       in                    TTbA033b05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAATGCAGCTTTTGTACATGTATATTGATATAATTGTACCAATCCTTGTGTTTTTTCCCCCTCCAAATATCCTGTACTTTAATAAAATATATTGAGTCACATAGAGGTTAAATATATTAGGAATAAAGAGAGTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)