Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas125a05.3                         95 END     1           1        1                Hypothetical LOC496701 [Xenopus tropicalis]
     2   2.0    0Xt7.1-EC2BBA21AD02.5                       12 END     1           1        9                Unknown (protein for MGC:154250) [Xenopus laevis]
     3   1.0    0Xt7.1-CBSW7897.5                            6 END     1           1       16                (no blast hit)
     4   2.0    0Xt7.1-TGas106k23.3                          5 END     1           1       20                (no blast hit)

 This cluster: approximate FL confidence score = 99%

 1012073077 Xt7.1-XZG58026.3 - 94 ESTs
                                                                       .......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG58026.3                                                                                                                                                                                                                                                                                                                                                                      ACAAGAAGGTGTGAGCTGATTTTTCCCTTCTCCTGTTTTTTTTTTCCTCCACTTTTGGATTTTCTCTTTTTTTTTTTCTGCCACTTGGATCTGGACTTAAAGACGCACTCGCCCAGCAGCCGCCGCAGCGATGAGAAGCGATCAGCGGCCGACGGGATTATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTGAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGAGAGTCCTGGGCCTGGGCTTCCAACGTTGGCCGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATGGGGAAAATAAATCGTGCCTTCTGTCGGATCCCTCCTAGAAACCAAAGGTCTCATTTTCGGAAGTCGGAACCGAGCTATCAGTACTTTGCACCCGCAGCCAGTATCAACGATAGTGAGATATCCAGTGATGCCCTGACAGAAGACAGTATGTCCATGACAGATGGCAGTGTAGATGGGATTCCACCGTATCGTTCAAAAAAGCAGAGGGAGATCCATCGGAGTGTCAGTGCCAATGGCCAAGTGCCTTTGCCTTTTGTTCCAAGGACGATGCGCCCACCGGCAGAGATGATGCCAGCCAGCCCGGCGGAGTTTGCGGCCAAGCTAACAATCGCTTTGGAGCGAGTAAAGAAACAGAGGGAGGCTGAAGAGAAACTGGAAGAAAGGTTGCAGAGGTTAAAAGAGGAAGACGAAAAAGCTGAATACGACATCCCACCGTCCAGTCACGAGGCCGTACCCGGAAGCGCTGTAGAGGACGATCCACAGTCCATCCTTGATGACCACGTATCCAGGGTCTTGAAAACGCCGGCAAATCTGTCGCCAAGATCTCAGTCCCCTTTCGTTCAAAGAAAAGGCAAATTTCAACCGGCCTTCTCGAAAGGGCAGAGTTCCATATCTTGCCACTTGCGTCCCAAAGTCCCTCAGGGTATGGAATCCAGCACTACGTCAACGTTAGAGCACCGAAGCTCTGTAAGCCAACTCCCAAGGAGCTCCAGAAAACCAGAAGGTTGCACCCAGTCCCACAGAGCGGAGGAAGGAACCTCGGCCGCCGTGCTGACCACTCCTCTTTCTCCAGAGCAGGAAGCCGAGCGCAACCACAGTGTCCTGCAATGGGTTCTAGAAAGCGCAAAGTTGATGAAAAAGCACCACCGCGAAACACCTGCCAGTGTCACTCATTGCCCTGAACTAAAGAAGGCTACACACCGTGCAGCATCCCAACCAGCACATTTGTTCCTGCAAGATACTTCCATGCCGCCCCTTACGGCTCCCAACACTCTGGATCAACTGGAAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCTAAAAAAAAAAAAAAAAAAATCAAATCCTTGCCATCATTTGGAGGATGTTCTATAATAATGTTTGATGTAGAAATCACCACTATAGAAAACTGAACGGTAATGTGCAGGCTGTCCCTGGGCACAGTCGGAGATGCAGCCTCGTCTTCAAAGTGCTGGATATTTGATAAAACATGAAAAAAAAAACCCAACTCCAATTTGTCCTGGAAGAATGCATACGGACATCTACGGTTCCCAAGGACTTTGCAATGGATGCCTGCAGCTTCAAAGGCATGGAAACAAAGTAGGGAGAAGAGAAAAAAGGCAAGACTTTATCATTCGAATGAACTCGGAACATTAATAATTTATAGGACGTTTCTGGCTGCATGAAATCATGAAATCCTCCATATTTTTTTTTTTTTTTTGTGGTCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACTGTCGCATTCGTACGGTGCGTCCCGCCAACGCTTGCCCCAATCACGGGGTAAGGAACTGCTAAACGTCGCCCAGCCCCGCCCTTTCTGGCAGTCGGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTAAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTCCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTACAAAAAACAAAAACAAAAACATGCTTGCTGTTAAAACAGTGATGACAGGGCATTTTGTGGGTTTGAATCCATTGCATATCAAAGGGCTTCTATTAAAAGAGAAAAGTGCTTAAAACCATGTATTTGTATTCAATGTATCATATTGGGATTGGGCACCCTTGGGCTTCCAGATCTTCTCGAACTAAAGTTCTCGGAATCCAACAGCCAAAGGGTTGCTGGGAGTTCATGGAGGGCTGGAAGGCCGCAAGTTGCCCAGGGCAGGTTTTGGTGGTTGCTGTGTGGTACAAGCAAGAGTTGGGGAGCTAATACATCAATACATTCTAAATAGTGACTTTGTATCATAATAGTATGGCCCAGTTTAATATTAGAATCATGCTGGTATCTGTTGGAATACAGCTCTCTGGTTGTCTGCTATTCAATCACTAGTGGTGCCAGTGCCATATGTTCCTCCCTTTATTGGGTTTGATGGGAAGATTTGACAGTGTTGATGATAATGCTATCTCGAGCCTGTCGGACTTTAACTGCCGCCTTGTCCATCATGAAGGGGGAATTAACCATATAGATACAATAAAGGCCATGATCTGGCAGCTGGAGGTGGGTATGGACTTGAAGAAGAAGAAGAAGGCAGCCTGTAGTGTTATAGAATGCCAACCCAATCCCCTTATTTGAAGTCCTATAACAAGCTTTTCAATTCAGTCTCTGTATCCAACTGTAAAGTGTGGTTACCGGTGCTGTAGAGCGAATGTAGCATTGACAGCTCTTATTGGCTTGGCCAACATCTAACAAAAATACAGATATGGGCACAAGGATGGTGCTTTTGAGTTGACACCCCCAGGCATGCCAAGGTTTAATAGGAATGGTAGAGCTACATTTGAACCAAGGGTGGAATAAATGGGCCTAATTGCAGGAATGTGTGTGTCTAGTCCCCTCAATGCTTCTCCATCAGTGGTAGCTCCACCCTTGGACCCTATTGCTATTGTAGTTTCCCATATTACCTCTGCTG
                                                  Xt7.1-CHK-1008223420                                                                                                                                                                                                                                                                                                                                                                            AGGTGTGAGCTGATTTTTCCCTTCTCCTGTTTTTTTTTTCCTCCACTTTTGGATTTTCTCTTTTTTTTTTTCTGCCACTTGGATCTGGACTTAAAGACGCACTCGCCCAGCAGCCGCCGCAGCGATGAGAAGCGATCAGCGGCCGACGGGATTATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTAAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGAGAGTCCTGGGCCTGGGCTTCCAACGTTGGCCGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATGGGGAAAATAAATCGTGCCTTCTGTCGGATCCCTCCTAGAAACCAAAGGTCTCATTTTCGGAAGTCGGAACCGAGCTATCAGTACTTTGCACCCGCAGCCAGTATCAACGATAGTGAGATATCCAGTGATGCCCTGACAGAAGACAGTATGTCCATGACAGATGGCAGTGTAGATGGGATTCCACCGTATCGTTCAAAAAAGCAGAGGGAGATCCATCGGAGTGTCAGTGCCAATGGCCAAGTGCCTTTGCCTTTTGTTCCAAGGACGATGCGCCCACCGGCAGAGATGATGCCAGCCAGCCCGGCGGAGTTTGCGGCCAAGCTAACAATCGCTTTGGAGCGAGTAAAGAAACAGAGGGAGGCTGAAGAGAAACTGGAAGAAAGGTTGCAGAGGTTAAAAGAGGAAGACGAAAAAGCTGAATACGACATCCCACCGTCCAGTCACGAGGCCGTACCCGGAAGCGCTGTAGAGGACGATCCACAGTCCATCCTTGATGACCACGTATCCAGGGTCTTGAAAACGCCGGCAAATCTGTCGCCAAGATCTCAGTCCCCTTTCGTTCAAAGAAAAGGCAAATTTCAACCGGCCTTCTCGAAAGGGCAGAGTTCCATATCTTGCCACTTGCGTCCCAAAGTCCCTCAGGGTATGGAATCCAGCACTACGTCAACGTTAGAGCACCGAAGCTCTGTAAGCCAACTCCCAAGGAGCTCCAGAAAACCAGAAGGTTGCACCCAGTCCCACAGAGCGGAGGAAGGAACCTCGGCCGCCGTGCTGACCACTCCTCTTTCTCCAGAGCAGGAAGCCGAGCGCAACCACAGTGTCCTGCAATGGGTTCTAGAAAGCGCAAAGTTGATGAAAAAGCACCACCGCGAAACACCTGCCAGTGTCACTCATTGCCCTGAACTAAAGAAGGCTACACACCGTGCAGCATCCCAACCAGCACATTTGTTCCTGCAAGATACTTCCATGCCGCCCCTTACGGCTCCCAACACTCTGGATCAACTGGAAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCTAAAAAAAAAAAAAAAAAAATCAAATCCTTGCCATCATTTGGAGGATGTTCTATAATAATGTTTGATGTAGAAATCACCACTATAGAAAACTGAACGGTAATGTGCAGGCTGTCCCTGGGCACAGTCGGAGATGCAGCCTCGTCTTCAAAGTGCTGGATATTTGATAAAACATGAAAAAAAAAACCCAAxxxCxATTTGTCCTGGAAGAATGCATACGGACATCxxxGxxTCCCAAGGACTTTGCAATxGxxxxCTGCAGxTxxAAxGxxxxGGAAACAAAGTAGGGAGAAGAGAAAAAAGGCAAGACTTTATCATTCGAATGAACTCGGAACATTAATAATTTATAGGACGTTTCTGGCTGCATGAAATCATGAAATCCTCCATATTTTTTTTTTTTTTTTGTGGTCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACTGTCGCATTCGTACGGTGCGTCCCGCCAACGCTTGCCCCAATCACGGGGTAAGGAACTGCTAAACGTCGCCCAGCCCCGCCCTTTCTGGCAGTCGGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTCCCCCCxxxTGTTCAGTTTTATAAACAGAAGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTACAAAAAACAAAAACAAAAACATGCTTGCTGTTAAAACAGTGATGACAGGGCATTTTGTGGGTTTGAATCCATTGCATATCAAAGGGCTTCTATTAAAAGAGAAAAGTGCTTAAAACCATGTATTTGTATTCAATGTATCATATTGGGATTGGGCACCCTTGGGCTTCCAGATCTTCTCGAACTAAAGTTCTCGGAATCCAACAGCCAAAGGGTTGCTGGGAGTTCATGGAGGGCTGGAAGGCCGCAAGTTGCCCAGGGCAGGTTTTGGTGGTTGCTGTGTGGTACAAGCAAGAGTTGGGGAGCTAATACATCAATACATTCTAAATAGTGACTTTGTATCATAATAGTATGGCCCAGTTTAATATTAGAATCATGCTGGTATCTGTTGGAATACAGCTCTCTGGTTGTCTGCTATTCAATCACTAGTGGTGCCAGTGCCATATGTTCCTCCCTTTATTGGGTTTGATGGGAAGATTTGACAGTGTTGATGATAATGCTATCTCGAGCCTGTCGGACTTTAACTGCCGCCTTGTCCATCATGAAGGGGGAATTAACCATATAGATACAATAAAGGCCATGATCTGGCAGCTGGAGGTGGGTATGGACTTGAAGAAGAAGAAGAAGGCAGCCTGTAGTGTTATAGAATGCCAACCCAATCCCCTTATTTGAAGTCCTATAACAAGCTTTTCAATTCAGTCTCTGTATCCAACTGTAAAGTGTGGTTACCGGTGCTGTAGAGCGAATGTAGCATTGACAGCTCTTATTGGCTTGGCCAACATCTAACAAAAATACAGATATGGGCACAAGGATGGTGCTTTTGAGTTGACACCCCCAGGCATGCCAAGGTTTAATAGGAATGGTAGAGCTACATTTGAACCAAGGGTGGAATAAATGGGCCTAATTGCAGGAATGTGTGTGTCTAGTCCCCTCAATGCTTCTCCATCAGTGGTAGCTCCACCCTTGGACCCTATTGCTATTGTAGTTTCCCATATTACCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                           2     4     4     5     4     5     5     5     5     6     5     7     7     7     7     7     7     7     9     9    10    10    10    10    10    10    10    10    11    12    12    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    14    14    14    14    16    16    16    16    16    16    16    16    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    14    15    15    15    13    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    15    16    15    16    14    15    14    15    14    16    16    17    13    16    14    16    13    15    13    15    13    15    13    14    12    15    13    15    13    15    11    12    11    12    10    11    10    11     8     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     6     8     5     7     5     7     5     7     5     7     4     6     4     6     4     6     4     6     4     5     3     5     3     5     3     5     3     5     3     5     3     5     5     5     5     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     3     4     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     5     7     5     8     5     8     5     8     6     9     7    11     8    12     8    11     8    11     9    11    10    13    12    15    11    15    15    18    15    18    16    18    18    20    18    20    18    21    18    21    18    21    18    22    20    25    21    25    22    26    23    27    25    30    25    29    28    32    28    32    27    33    29    33    29    33    29    33    29    34    32    34    34    36    34    37    36    38    37    38    37    38    36    38    36    38    36    38    36    38    36    38    36    39    37    39    36    39    38    40    36    39    36    39    36    38    37    39    37    39    37    39    35    39    37    39    38    40    39    41    38    41    37    41    39    41    39    41    39    41    37    41    35    40    34    40    35    40    35    39    35    40    34    39    34    39    33    38    34    40    29    34    26    29    16    21    16    16    15    16    16    16    16    16    16    16    16    16    15    16     6     7     7     7     5     7     5     7     5     7     5     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     2     6     2     5     2     5     3     6     4     8     4     8     4     8     4     9     5    11     5    11     5    11     6    11     6    11     6    12     6    12     6    12     7    13     7    13     8    14     8    14    15    15     8    13     9    13     9    13     9    13     9    13     8    13     8    13     8    15     8    16     8    16     8    16     9    17     9    17     9    17     9    16    11    16    14    17    12    18    12    18    12    18    12    18     9    18     9    18     9    18    15    18     9    18     9    18    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    16    16    16    16    16    16    16    16    16    16    16    16    15    15    15    15    14    14    14    14    14    14    14    14    15    15    11    11    11    11    11    11     9    11     9    11     9    11     8    11     8    12     8    11     4     6     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     4     4     4     4     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -C----------
                                               BLH ATG     245    1765                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH MIN     245     163                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH OVR     245    1142                                                                                                                                                                                                                                                                                                                                                                      
                                               EST CLI     105       1                                                                                                                                                                                                                                                                                                                                                                      
                                               ORF LNG     245     186                                                                                                                                                                                                                                                                                                                                                                      
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 4e-008     NP_001033551.1 Regulator of G protein Signaling family member (rgs-7) [Caenorhabditis elegans] ---------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 5e-018     NP_733336.1 CG7926-PA, isoform A [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ci ---- 9e-026     BAE06322.1 axin [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Sp ==== 2e-077     XP_781992.1 PREDICTED: similar to Axin-1 (Axis inhibition protein 1) (hAxin) [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dr ---- 6e-131     NP_571636.1 axin 2 (conductin, axil) [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 1e-135     NP_056547.3 axin2 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 2e-137     NP_004646.2 axin 2 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Gg ==== 4e-139     NP_989822.1 axin-related protein [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 0          CAL49410.1 axin 2 (conductin, axil) [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          AAH82364.1 MGC81576 protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === ?? ==== 0          NP_001087841.1 MGC81576 protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG58026.3                                                                                                                                                                                                                                                                                                                                                                                 TGA---------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------TAA---------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------ATG---------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---TGA------------------------------------TAA------------------ATG------ATG------------------TGA---TAG---------------------------------------------------------------------ATG------------TGA---------------------------------------------------------------------------------------------------TGA------------------------------------TGA---------------------------------------------TAA---------------------------ATG---------------------------TGA------------------------------------------------------------------------------------ATG------------------------------TGA------ATG---------------------------------------------------------------------TGA---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------TGA---------------------------------------------------------------------------------------------TAA---------------------------------------------------------TGA---------------------------TAA---TAA---------TAA------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------ATG------TAA------------------------------------------------------------------TAA------------------TGA------------------------------------TAA---------------------------------------------------------------------TGATGA------------------TGA---------------------------TAA---------------------ATG------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------TAA---------------TAA------------------------ATG---------------------ATG------------------------------------------------TAG---------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------ATG------------------------------------------------TAAATG---------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  0   1   1           Gas  FLt3                   TGas017f07.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCACTCGCCCAGCAGCCGCCGCAGCGATGAGAAGCGATCAGCGGCCGACGGGATTATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTGAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGAGAGTCCTGGGCCTGGGCTTCCAACGTTGGCCGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATGGGGAAAATAAATCGTGCCTTCTGTCGGATCCCTCCTAGAAACCAAAGGTCTCATTTTCGGAAGTCGGAACCGAGCTATCAGTACTTTGCACCCGCAGCCAGTATCAACGATAGTGAGATATCCAGTGATGCCCTGACAGAAGACAGTATGTCCATGACAGATGGCAGTGTAGATGGGATTCCACCGTATCGTTCAAAAAAGCAGAGGGAGATCCATCGGAGTGTCAGTGCCAATGGCCAAGTGCCTTTGCCTTTTGTTCCAAGGACGATGCGCCCACCGGCAGAGATGATGCCAGCCAGCCCGGCGGAGTTTGCGGCCAAGCTAACAATCGCTTTGGAGCGAGTAAAGAAACAGAGGGAGGCTGAAGAGAAACTGGAAGAAAGGTTGCAGAGGTTAAAAAAAAAAAAAAAAAA
  5   1   2       bld HdA  5g3  in                   THdA004o18.p1kSP6 AACAGGCACGGAGATCCNCATCGCTGGGGAAAAAATCAAACCGAGGCATTTTCGTCGTCGGACCGAATACATTCGCCCGTCTGGGTCGGTGGAAAGCTATAAAAAAGAAGGCTGGCATTTTTCGCAGCGGTTTCATGTCCCATTCGGACGGCGGCGGCGTTTACGGCGCTGCCAGGACGCAGCTTTCAGTGATCTCCACTGATGTTTCATTAAAGCCATAACACCCCTTTGTTCTTTTGGCTTTGTCCCCAGGGGGAGTGAAAAAGGGCTTTTTGGTTTTGATTAAAAAAAAAAAGTTCAGAGAGAGAGAAGAGGGGAGGGAGAGAGAGGGAGAGATCCTTGCAGTTCGAACTTACTCAACAAGAAGGTGTGAGCTGATTTTTCCCTTCTGTTTTTTTTTTCCTCCACTTTTGGATTTTCTCTTTTTTTTTTTTCTGCCACTTGGATCTGGACTTAAAGACGCACTCGCCCAGCAGCCGCCGCAGCGATGAGAAGCGATCAGCGGCCGACGGGATTATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAAACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATT
  3   1   0       add Egg       in                    TEgg070m07.q1kT7                                                                                                                                              GGGATCTCCGTGCCTGTTTCCGTGCAGCTGCCAGGACGCAGCTTTCAGTGATCTCCACTGATGTTTCAGGGAAGCCATAACACCCCCTTTGTTNTTTTGGCTTCTCCCAAGGGGGGAGTGAAAANNGGGNTTTTTGGTTTTGATAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g                        TGas013f05.p1kSP6                                                                                                                                                                                                                                                                                                                                                               ACTTACTCAACAGAAGTGTGAGCTGATTTTTCCCTTCTCCTGTTTTTTTTTTCCTCCACTTTTGGATTTTCTCTTTTTTTTTTTCTGCCACTTGGATCTGGACTTAAAGACGCACTCGCCCAGCAGCCGCCGCAGCGATGAGAAGCGATCAGCGGCCGACGGGATTATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTGAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTT
  5   1   2       bld TbA  5g3  in                   TTbA030k15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                TTACTCACAAGAAGGTGTGAGCTGATTTTTCCCTTCTCCTGTTTTTTTTTTCCTCCACTTTTGGATTTTCTCTTTTTTTTTTTCTGCCACTTGGATCTGGACTTAAAGACGCACTCGCCCAGCAGCCGCCGCAGCGATGAGAAGCGATCAGCGGCCGACGGGATTATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTAAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTC
  5   1   2   22  bld Tad5 5g                              XZT63965.5p .................................................................................................................................................................................................................................................................................................................................................................CTCAACAAGAAGGTGTGAGCTGATTTTTCCCTTCTCCTGTTTTTTTTTTCCTCCACTTTTGGATTTTCTCTTTTTTTTTTTCTGCCACTTGGATCTGGACTTAAAGACGCACTCGCCCAGCAGCCGCCGCAGCGATGAGAAGCGATCAGCGGCCGACGGGATTATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTAAGTTTTTGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGC
  5   1   2       bld TpA  5g3  in                   TTpA068a07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                           AAGGTGTGAGCTGATTTTTCCCTTCTCCTGTTTTTTTTTTCCTCCACTTTTGGATTTTCTCTTTTTTTTTTTCTGCCACTTGGATCTGGACTTAAAGACGCACTCGCCCAGCAGCCGCCGCAGCGATGAGAAGCGATCAGCGGCCGACGGGATTATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTAAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCG
  3  -1   2       bld Spl1      in                         CABK2408.3p                                                                                                                                                                                                                                                                                                                                                                                                                TTTCCTCCACTTTTGGATTTTCTCTTTTTTTTTTTCTGCCACTTGGATCTGGACTTAAAGACGCACTCGCCCAGCAGCCGCCGCAGCGATGAGAAGCGATCAGCGGCCGACGGGATTATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATACCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTAAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGAGAGTCCTGGGCCTGGGCTTCCACGTTGGCCGAGGAT
  3  -1   2       bld Gas7      in                         XZG43782.3p                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTTTTTTTTTTTTTTTCTGCCACTTGGATCTGGACTTAAAGACGCACTCGCCCAGCAGCCGCCGCAGCGATGAGAAGCGATCAGCGGCCGACGGGATTATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTAAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGAGAGTCCTGGGGCTGGGCTTCCAACGT
  5   1   2       bld Gas8 5g3  in                          st47h10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCACTCGCCCAGCAGCCGCCGCAGCGATGAGAAGCGATCAGCGGCCGACGGGATTATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTAAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTTTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGT
  5   1   2       bld Gas  FLt3                      TGas017f07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACTCGCCCAGCAGCCGCCGCAGCGATGAGAAGCGATCAGCGGCCGACGGGATTATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAAGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTGCGCATGTACTTGGAATGGGAAGGTCTTGAGGATCTTACGAGTCTTAGGTTTGCTTGCAATGGATTTACGGCTATGGACCCGTTGGAACCCAAGACATCAAAGACTGCTAAAGCCATATATCGCTGGTATGTGCAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTGCCCAAGTGAATGAGTGTGTGAAGAACCAGC
  5   1   2   12  bld Gas7 5g3  in                         XZG22121.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCCCAGCAGCCGCCGCAGCGATGAGAAGCGATCAGCGGCCGACGGGATTATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTGAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCCAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGAGAGTCCTGGGCCTGGGC
  5   1   2       bld TpA  5x3  out                  TTpA032l08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGNCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTGAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGAGAGTCCTGGGCCTGGGCTTCCAACGTTGGCCGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATGGGGAAAATAAATCGTGCCTTCTGTCGGATCCCTCCTAGAAACCAAAGGTCTCATTTTCGGAAGTCGGAACCGAGCTATCAGTACTTTGCACCCGCAGCCAGTATCAACGATAGTGAGATATCCAGTGATGCCCTGA
  5   1   2       bld Gas7      in                         XZG34753.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATTTGTGGACTTTTAGCGCAAGGGGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTGAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGAGAGTCCTGGGCCTGGGCTTCCAACGTTGGCCGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATGGGGAAAATAAATCGTGCCTTCTGTCGGATCCCTCCTAGAAACAAAGGTCTCATTTTCGGAAGTCGGAAACGAGCTATCAGTACTTTG
  5   1   2       bld Egg0 5g3  in                         dad65a09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGAGGACCCGGGGCAAGGAGCCGCTGTTGCACAAACAAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTGAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCC
  5   1   2       bld Gas8 5g                               st48h10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGGCAAGGAGCCGNTGTTGCACAAACAAGGATATTTGTANAGACTCCTGGCAGCCATGACTTCTGCTGGAGTATTGACCTGCATCCCAGACTCTGGACGNATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGANGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTAAGTTTTTGGTTNGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTACAGCCATCTACCCGTACCCAA
  5   1   2       bld Neu       in                   TNeu129j09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTACCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGGTCGCCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAGGGGGAAGGTCTTGTGGATCTTTTGAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCACAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTG
  5   1   2       bld Gas7      in                         XZG58026.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAGGCCAGGAGACTAAAAACTACAAGTCTGAAAAGTTCACCATGGATTCTCAGCACTTAAGACACAAGGAAGATTATATCCGTGAAGCTGAAGGCTGCGTTGCCAACGATTCCCGCTTCTCCAGATGGGGCAGGTCTCTAAATCTTCTACTCGATGACCAGGATGGAGCTACGCTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGTGGATCTTTTGAGTTTTTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCGTTGGAACCCAAGACATCAAAAACTGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGAGAGTCCTGGGCCTGGGCTTCCAACGTTGGCCGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATGGGGAAAATAAATCGTGCCTTCTGTCGGATCCCTCCTAGAAACCAAAGGTCTCATTTTCGGAAGTCGGAACCGAGCTATCAGTACTTTGCACCCGCAGCCAGTATCAACGATAGTGAGATATCCAGTGATGCCCTGACAGAAGACAGTATGTCCATGACAGATGGCAGTGTAGATGGGATTCCACCGTATCGTTCAAAAAGCAGAGGGAGATCCATCGGAGTGTCAGTGCCAATGGCCAAGTGCCTTT
  3   1   2       bld Gas7      in                         XZG34753.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTATGTACAAAATAGTTCAGCAGTTTCATGCCGCTTAAAGCCATCTACCCGTACCCAAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGAGAGTCCTGGGCCTGGGCTTCCAACGTTGGCCGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATGGGGAAAATAAATCGTGCCTTCTGTCGGATCCCTCCTAGAAACCAAAGGTCTCATTTTCGGAAGTCGGAACCGAGCTATCAGTACTTTGCACCCGCAGCCAGTATCAACGATAGTGAGATATCCAGTGATGCCCTGACAGAAGACAGTATGTCCATGACAGATGGCAGTGTAGATGGGATTCCACCGTATCGTTCAAAAAAGCAGAGGGAGATCCATCGGAGTGTCAGTGCCAATGGCCAAGTGCCTTTGCCTTTTGTTCCAAGGACGATGCGCCCACCGGCAGAGATGATGCCAGCCAGCCCGGCGGAGTTTGCGGCCAAGCTAACAATCGCTTTGGAGCGAGTAAAGAAACAGAGGGAGGCTGAAGAGAAACTGGAAGAAAGGTTGCAGAGGTTAAAAGAGGAAGACGAAAAAGCTGAATACGACATCCCACTATACCACTCTCT
  5   1   2       bld Gas0      in                         dad16d02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGGGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGAGAGTCCTGGGCCTGGGCTTCCAACGTTGGCCGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATGGGGAAAATAAATCGTGCCTTCTGTCGGATCCCTCCTAGAAACCAAAGGTCTCATTTTCGGAAGTCGGAACCGAGCTATCAGTACTTTTGAACCCGGCACCAGTATCAACGATAGTGAGATATCCAGTGATGCCCTGACAGAAGACAGTATGTCCATGACAGATGGCAGTGTAGATGGGATTCCACCGTATC
  5   1   2       bld TpA       in                   TTpA041i24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGTGAAGGAGTGTGTGAAGAACCAGCAACTGAATAAGACTGTGTTTGACCAGGCCCAACAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGAGAGTCCTGGGCCTGGGCTTCCAACGTTGGCCGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATGGGGAAAATAAATCGTGCCTTCTGTCGGATCCCTCCTAGAAACCAAAGGTCTCATTTTCGGAAGTCGGAACCGAGCTATCAGTACTTTGCACCCGCAGCCAGTATCAACGATAGTGAGATATCCAGTGATGCCCTGACAGAAGACAGTATGTCCATGACAGATGGCAGTGTAGATGGGATTCCACCGTATCGTTCAAAAAAGCAGAGGGAGATCCATCGGAGTGTCAGTGCCAATGGCCAAGTGCCTTTGCCTTTTGTTCCAAGGACGATGCGCCCACCGGCAGAGATGATGCCAGCCAGCCCGGCGGAGTTTGCGGCCAAGCTAACAATCGCTTTGGAGCGAGTAAAGAAACAGAGGGAGGCTGAAGAGAAACTGGAAGAAAGGTTGCAGAGGTTAAAAGAGGAAGACGAAAAAGCTGAATACGACATCCCACCGTCCAGTCACGAGGCCGTACCCGGAAGCGCTGTAGAGGACGATCCACAGTCCATCCTTGATGACCACGTATCCAGGGTCTTGAAAACGCCGGCAAATCTGTCGCCAAGATCTCAGTCCCCTTTCGTTCAAAGAAAAGGCAAATTTCAACCGGCCTTCTCGAAAGGGCAGAGTTCCATATCTTGCCACTTGCGTC
  3   1   2       bld Gas0      in                         dad16d02.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGAGTGTTGTGAAGAACAGCAAACTGATAAAGACTGTGTTTGACCAGGCCCACCAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGAGAGTCCTGGGCCTGGGCTTCCAACGTTGGCCGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATGGGGAAAATAAATCGTGCCTTCTGTCGGATCCCTCCTAGAAACCAAAGGTCTCATTTTCGGAAGTCGGAACCGAAGGTATCAGTACTTGGCACCCGCAGCCAGTATCAACGATAGTGAGATATCCAGTGATGCCCTGACAGAAGACAGTATGTCCATGACAGATGGCAGTGTAGATGGGATTCCACCGTATCGTTCAAAAAAGCAGAGGGAGATCCATCGGAGTGTCAGTGCCAATGGCCAAGTGCCTTTGCCTTTTGTTCCAAGACGATGCGCCCACCGGCAGAGATGATGCCAGCCAGCCCGGCGGAGTTTGCGGCCAAGCTAACAATCGCTTTGGAGCGAGTAAAGAAACAGAGGGAGGCTGAAGAGAAACTGGAAGAAAGGTTGCAGAGGTTAAAAAAAAAA
  5   1   2       bld Tad5      in                         XZT54464.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCTTTTTTTGCAGTCCGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGAGAGTCCTGGGCCTGGGCTTCCAACGTTGGCCGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATGGGGAAAATAAATCGTGCCTTCTGTCGGATCCCTCCTAGAAACCAAAGGTCTCATTTTCGGAAGTCGGAACCGAGCTATCAGTACTTTGCACCCGCAGCCAGTATCAACGATAGTGAGATATCCAGTGATGCCCTGACAGAAGACAGTATGTCCATGACAGATGGCAGTGTAGATGGGATTCCACCGTATCGTTCAAAAAAGCAGAGGGAGATCCATCGGAGTGTCAGTGCCAATGGCCAAGTGCCTTTGCCTTTTGTTCCAAGGACGATGCGCCCACCGGCAGAGATGATGCCAGCCAGCCCGGCGGAGTTTGCGGCCAAGCTAACAATCGCTTTGGAGCGAGTAAAGAAACAGAGGGAGGCTGAAGAGAAACTGGAAGAAAGGTTGCAGAGGTTAAAAGAGGAAGACGAAAAAGCTGAATACGACATCCCACCGTCCAGTCACGAGGCCGTACCCGGAAGCGCTGTAGAGGACGATCCACAGTCCATCCTTGATGACCACGTATCCAGGGTCTTGAAAACGCCGGCAAATCTGTCGCCAAGATCTCAGTCCCCTTTCGTTCAAAGAAAAGGCAAATTTCAACCGGCCTTCTCGAAAGGGCAGAGTTCCATATCTTGCCACTTGCGTCCCAAAGTCCCTCAGGGTATGGAATCCAGCACCTACGTCAACGTTAGAGCA
  5   1   2      shim Gas7      in                           XZG504.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATGGCCAGTGCCTTTGCCTTTTGTTCCAGGACGATGCGCCCACCGGCAGAGATGATGCCAGCCAGCCCGGCGGAGTTTGCGGCCAAGCTAACAATCGCTTTGGAGCGAGTAAAGAAACAGAGGGAGGCTGAAGAGAAACTGGAAGAAAGGTTGCAGAGGTTAAAAGAGGAAGACGAAAAAGCTGAATACGACATCCCACCGTCCAGTCACGAGGCCGTACCCGGAAGCGCTGTAGAGGACGATCCACAGTCCATCCTTGATGACCACGTATCCAGGGTCTTGAAAACGCCGGCAAATCTGTCGCCAAGATCTCAGTCCCCTTTCGTTCAAAGAAAAGGCAAATTTCAACCGGCCTTCTCGAAAGGGCAGAGTTCCATATCTTGCCACTTGCGTCCCAAAGTCCCTCAGGGTATGGAATCCAGCACTACGTCAACGTTAGAGCACCGAAGCTCTGTAAGCCAACTCCCAAGGAGCTCCAGAAAACCAGAAGGTTGCACCCAGTCCCACAGAGCGGAGGAAGGAACCTCGGCCGCCGTGCTGACCACTCCTCTTTCTCCAGAGCAGGAAGCCGAGCGCAACCACAGTGTCCTGCAATGNGTTCTAGAAAGCGCAAAGTTGATGAAAAAGCACCACCGCGAAACACCTGCCAGTGTCACTCATTGCCCTGAACTAAAGAAGGCTACACACCGTGCAGCATCCCAACCAGCACATTTGTTCCTG
  5   1   2       bld Neu                            TNeu046g05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAGATGATGCCAGCCAGCCCGGCGGAGTTTGCGGCCAAGCTAACAATCGCTTTGGAGCGAGTAAAGAAACAGAGGGAGGCTGAAGAGAAACTGGAAGAAAGGTTGCAGAGGTTAAAAGAGGAAGACGAAAAAGCTGAATACGACATCCCACCGTCCAGTCACGAGGCCGTACCCGGAAGCGCTGTAGAGGACGATCCACAGTCCATCCTTGATGACCACGTATCCAGGGTCTTGAAAACGCCGGCAAATCTGTCGCCAAGATCTCAGTCCCCTTTCGTTCAAAGAAAAGGCAAATTTCAACCGGCCTTCTCGAAAGGGCAGAGTTCCATATCTTGCCACTTGCGTCCCAAAGTCCCTCAGGGTATGGAATCCAGCACTACGTCAACGTTAGAGCACCGAAGCTCTGTAAGCAGCCAACTCCCAAGGAGCTCCAGAAAACCAGAAGGTTGCACCCAGTCCCACAGAGCGGAGGAAGGAACCTCGGCCGCCGTGCTGACCACTCCTCTTTCTCCAGAGCAGGAAGCCGAGCGCAACCACAGTGTCCTGCAATGGGTTCTAGAAAGCGCAAAGTTGATGAAAAAGCACCACCGCGAAACACTGCCAGTGTCACTCATTGCCCTGAACTAAAGAAAGCTACACACCGTGCAGCATCCCAACCAGCACATTTTGTTCCTGCAAG
  5   1   2       bld Neu0                               IMAGE:6991483                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCAGCCAGCCCGGCGGAGTTTGCGGCCAAGCTAACAATCGCTTTGGAGCGAGTAAAGAAACAGAGGGAGGCTGAAGAGAAACTGGAAGAAAGGTTGCAGAGGTTAAAAGAGGAAGACGAAAAAGCTGAATACGACATCCCACCGTCCAGTCACGAGGCCGTACCCGGAAGCGCTGTAGAGGACGATCCACAGTCCATCCTTGATGACCACGTATCCAGGGTCTTGAAAACGCCGGCAAATCTGTCGCCAAGATCTCAGTCCCCTTTCGTTCAAAGAAAAGGCAAATTTCAACCGGCCTTCTCGAAAGGGCAGAGTTCCATATCTTGCCACTTGCGTCCCAAAGTCCCTCAGGGTATGGAATCCAGCACTACGTCAACGTTAGAGCACCGAAGCTCTGTAAGCCAACTCCCAAGGAGCTCCAGAAAACCAGAAGGTTGCACCCAGTCCCACAGAGCGGAGGAAGGAACCTCGGCCGCCGTGCTGACCACTCCTCTTTCTCCAGAGCAGGAAGCCGAGCGCAACCACAGTGTCCTGCAATGGGTTCTAGAAAGCGCAAAGTTGATGAAAAAGCACCACCGCGAAACACCTGCCAGTGTCACTCATTGCCCTGAACTAAAGAAGGCTACACACCGTGCAGCATCCCAACCAGCACATTTGTTCCTGCAAGATACTTCCATGCCGCCCCTTACGGCTCCCAACACTCTGGATCAACTGGAAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAAGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCCTAAGACCGCCCAAGAAGCAAGTTCAGATTGTCAGGGTCAAGAACTTNGCCTCG
  5   1   2       bld Egg                            TEgg114n11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGAAACACCTGCCAGTGTCACTCATTGCCCTGAACTAAAGAAGGCTACACACCGTGCAGCATCCCAACCAGCACATTTGTTCCTGCAAGATACTTCCATGCCGCCCCTTACGGCTCCCAACACTCTGGATCAACTGGAAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTG
  5   1   2       bld Egg       in                   TEgg033l10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGAAATCCTGCCAGTGTCACTCATTGCCCGGAGCTAAAGAAGGCTACACACCGAGCAGCATCCCAACCATCACATTTGTTCCTGCAAGATACTTCCATGCCGCCCCTTACAGCTCCCAAAACTCTGGATCAACTGGAAGAGGCCAGAAGACCTCTTGTAGAATATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTA
  5   1   2       bld Egg                            TEgg114o13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGAAAACCTGCCAGTGTGCCTCATTGCCCTGAACTAAAGAAGGCTACACACCGTGCAGCATCCCAACCAGCACATTTGTTCCTGCAAGATACTTCCATGCCGCCCCTTACGGCTCCCAACACTCTGGATCAACTGGAAGAGGCCAGAAGACGTCTTGTACAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAAGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCGAGAAAGGAAGTTACAAGTATTATTTCAAAGAGGAGAGCCATGAGTTTGAATGCAATGCTGCTTTCCAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAGAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACTGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGC
  5  -1   2       bld Gas7      in                         XZG43782.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACACCTGCCAGTGTCACTCATTGCCNTGAACTAAAGAAGGCTACACACCGTGCAGCATCCCAACCAGCACATTTGTTCCTGCAAGATACTTCCATGCCGCCCCTTACGGCTCCCAACACTCTGGATCAACTGGAAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAGATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAAGGATGGTCATGGATCCAGAGATCTCC
  5   1   2       chi TpA       in                  TTpA049c23.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCGGCCGCCGTGCTGACCACTCCTCTTTCTCCGAGCAGGAAGCCGAGCGCAACCACAGTGTCCTGCAATGGGTTCTAGAAAGCGCAAAGTTGATGAAAAAGCACCACCGCGAAACACCTGCCAGTGTCACTCATTGCCCTGAACTAAAGAAGGCTACACACCGTGCAGCATCCCAACCAGCACATTTGTTCCTGCAAGATACTTCCATGCCGCCCCTTACGGCTCCCAACACTCTGGATCAACTGGAAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGGGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAGAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTT
  5   1   2       bld Gas7      in                         XZG53767.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGTGCAGCATCCCAACCAGCACATTTGTTCCTGCAAGATACTTCCATGCCGCCCCTTACGGCTCCCAACACTCTGGATCAACTGGAAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTA
  3   1   2       bld Neu       in                    TNeu129j09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAACCAGCACATTTGTCNTGCAAGATACTTCCATGCCGCCCCTACGGCTCCCAACACTCTGGATCAACTGGAAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAAAAAAGCGGCCGAA
  3   1   2       bld TpA       in                    TTpA041i24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGCACATTTGTTCNTGCAAGATACTTCCATGCCGCCCCTTACGGCTCCCAACACTCTGGATCAACTGGAAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA                             TTbA026f03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCACATTTGTTCNTGCAAGATACTTCCATGCCGCCCCTTACGGCTCCCAACACTCTGGATCAACTGGAAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATAAAAAAAAAAAAAAAAAAGCGGCC
  5  -1   2       bld Spl1      in                         CABK2408.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACATTTGTTCCTGCAAGATACTTCCATGCCGCCCCTTACGGCTCCCAACACTCTGGATCAACTGGAAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTG
  3   1   2       bld TpA  5x3  out                   TTpA032l06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCCAACACTCTGGATCAACTGGAAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTGACTCTTTGTATCTAAATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                         XZG22121.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCAACTGGAAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCT
  5   1   2       bld TpA       in                   TTpA017a07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGANATTGATATTGCTCANAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCATATCATGTGACTTTTGACTCTTTGTATCT
  3   1   2      seed TpA       in                    TTpA017a07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG53767.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTNTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCT
  3   1   2       bld Gas7      in                         XZG58026.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCTTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAGATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCT
  3   1   2       bld HdA  5g3  in                    THdA004o18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATAAGAGAGTTCCCAAACTTCATAAGTCCAGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATTTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTTTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas7      in                         XZG45353.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCGGGGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAGATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCT
  5   1   2       bld Gas7      in                         XZG45353.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAGATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAAAAGGGCGGCCCGC
  3   1   2       bld Gas8 5g3  in                          st47h10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCCATAGCCCCCCCACATCTCTAAATCATAACAATCTAATCACCTGTATATTTATTTTTTTATAGGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTCCCCCA
  3   1   2       chi TpA       in                   TTpA049c23.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCAACTGGAAGAGGCCAGAAGACGTCTTGTAGAAGATAAGAGAGTTCCCAAACTTCATAAGTCCAGGGGTGTACAGTCTGCCACAATGAAAGAAAAAGGCAAAACAGTGGAAAGCGTCCCGTCATCTGCCTTCTCTACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGGGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTAAATATGAAACGGAAGCGATGTTTTTGTTCTTTGTCTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT54464.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTCTAAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAATAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCT
  3   1   2       bld Egg                             TEgg015h13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGCTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTCCCATCGTATGCTACTTGTGTGGTGAAAGGATTCCGTCCATGATCCGTACCAAGGAGCCAAGCCTGACGTTACAAGAGTTCAAAGACTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCAGGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTTTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAGATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCGGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGTCTTTAGAGTGCTAGTGATTTTGGCCCGTTTTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATGTAAAGGAAAGGACAGGCGTAAATTGATATTGCTCAAAACGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCACCATATCGATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG18552.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAACTTTCAGATGAGCATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCTAAAAAAAAAAAAAAAAAGG
  3   1   2       bld TbA  5g3  in                    TTbA030k15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATAAGACAGCCAAGAAAGCAAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGGGGAAATTGATATTGTTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGAGGTGGATCTTTCCCCCAATATCATGGGACTTTTGACTTCTTTGTATCTAAATTAAAAAAAAAAAAAAAAAAGGC
  5   1   2       bld Gas                            TGas035f05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGTTCAGATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAGATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATT
  5   1   2       bld Gas                            TGas009k15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCAGATTGTCAGGGTCAAGNACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAGATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTNTGTATCTAAATT
  5  -1   2       bld Egg                            TEgg083e04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTGTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAGATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCCATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAA
  5  -1   2       bld Egg       in                   TEgg070m07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCAGGGTCAAGGACTTGCCATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Egg                            TEgg070m11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCGTCTACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas0                                 dad20b07.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAGATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAA
  3   1   2       bld Egg0 5g3  in                         dad65a09.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACTACTTCTGTGGTGAAAGGATTCCGTACATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAGATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTGTGTTTTGATGGGAGTGGTCTTTGCCCCCCATANCAGTGACTTTGAAAATTGTACTAATT
  3   1   2       bld Gas7      in                         XZG18552.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAAGGATTCCGTACCATGATCCGTACCAAGGAGCCAAGCTTGACGCTACAAGAGTTCAAAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCT
  3   1   2       bld TpA  5g3  in                   TTpA068a07.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGAGTTGTTGAGCAAGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg130l04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAAGGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCT
  5  -1   2       bld Egg       out                  TEgg070m15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAGTTACAAGTATTATTTCAAAAAGGAGAGCCATGAGTCTGAATGCAATGCTGTTTTCCAAGAAGTGTTTGAAGAAGACCCCGTGCTACCTTTATCAGAGGAAAAAATCATTCGCAAGGTGGAAAGGGCATGTCGCCCGTGATCCGGAGCTGCAAGTGGAGAGTTATTTGCTGCTGTGTAAATAAGTCGATGCGTGGTCATGGAAAACACGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTATGATTTTGGCCCGTTCTGGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCAGTACAGGAATGGTCCCAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATATAAAGGAAAGGACAGGCGAAATTGATATTGCTCTAAAATGCCTAAGGTAATTATTGCCCTGTGTTTTGATGGGAGTGGTCTTTCCCCCAATATCATGTGCCTTTATGACTACGCTTGTATCTCAAATTGAAAAAAAAAGAACCAAAGAA
  3   1   2       bld Gas7      in                           XZG504.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTTTTCAAAAAGGAAACCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAAATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGGGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGGGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGAGGTTTTTGTTCTT
  5   1   2       bld Neu                            TNeu041j01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAAAAGAGAGCCATGAGTTTGAATGCAATGCTGTTTTCCAAGAAGTGTCTGAAGAAGACGCCGTGCTACCTTTATTTGAGGAAAAGATCATCTGCAAGGTGGAAAGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCCATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCTAAAAAAAAAAAAAAAAAAAAATCAAATCCTTGCCATCATTTGGAGGATGTTCTATAATAATGTTTGATG
  5   1   2       bld Neu                            TNeu137n21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCCCCGGGGGCATGTTGACCGTGATACGGAACTGCAAGTGGAGAGTTATTTGCTGCTGTCTAAATAAGTCGATACGTGGTCATGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTGGTTCCTTTTTCATTAAAGGAGTGGTGACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCCATATCATGTGACTTTTGACTCTTTGTATCTAAATT
  3   1   2       bld Egg       in                    TEgg033l10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAAGTGGAGAGTTATTTGCTGCTGTCTAAAAAAGTCGATAGGTGGTCGGGGAAAACAGGGCCAAGAAGGGCACCCATTGACTTTAGAGTGCTATGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCTTTTTTCATTAAAGGAAGGGTAACAGCAATATGAAGTCCCAATGGAGTTCCCTTAAAAGAAGCAACCATTCTAAAGGAAAGGCCTGGCGAAATTGATATTGCTCAAAATGCCAGGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTGTTTGTATGTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGCACATTTATTTTTATTCGGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCTAAAAAAAAAAAAAAAAAAATCAAATCCTTGCCATCATTTGGAGGATGTTCTATAATAATGTTTGATGTAGAAATCACCACTATAGAAAACTGACCGGTAATGTGCAGGCTGTCCCTGGGCACAGTCGGAGATGCAGCCTCGTCTTCAACAAGTGCTGGATATTTGATAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg015p16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGAAAACATGGCCAAGAACGGCACCCATTGACTTTAGAGTGCTCTGATTTTGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCT
  3   1   2       bld Egg       in                    TEgg015p16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGAAAACATGGCCAAGAACGGCACCCATGGACCTTAGAGTGCTCTGATTTCGGCCCGTTCTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATTAAAGGAAAGGACAGGGGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCACAATATCATGTGACTTTTGACTCTTTGTATGTAAATTAAAAAAAAAAAAAATTCTTCTTTCCGGATAAGCCACTATTTATCCCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTTATAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG47319.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGGAAGAGGGCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCTAAAAAAAAAAAAAAAAAAATCAAATCCTTGCCATCATTTGGAGGATGTTCTATAATAATGTTTGATGTAGAAATCACCACTATAGAAAACTGAACGGTAATGTGCAGGCTGTCCCTGGGCACAGTCGGAGATGCAGCCTCGTCTTCAAAGTGCTGGATATTTGATAAAACATGAAAAAAAAAACCCAACTCCATTTGTCCTGGAAGAATGCATACGGACATCTACGGTATCCCAAGGACTTTGCAATGGATGCTGCGGCTTCAAAGGCATGGAAACAAAGTAGGGAGAAGAGAAAAAAGGCAAGACTTTATCATTCGAATGAACTCGGAACATAAATAATTTATAGGACGTTTCTGGCTGCATGAAATCACGAAATCCTCCATATTTTTTTTTTTTTTT
  5   1   2       bld Egg                            TEgg096p05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAAATCCAAAAGGTCGTTCCTTTTTCATTAAAGGAATGGTAACAGCAATATGAAGTCCCAATGGAGTAGCCTTAAAAGAAGCAACCAATCTAAAGGAAAGGACAGGCGAAATTGATATTGCTCAAAATGCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCCATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCT
  5   1   2       bld Tbd1                                 CBXT6626.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCAAGGAATTATTGCTTGTGTTTTGATGGGAGTGGATCTTTCCCCCAATATCATGTGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCCATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCTAAAAAAAAAAAAAAAAAAAGCAAATCCTTGCCATCATTTGGAGGATGTTCTATAATAATGTTTGATGTAGAAATCACCACTATAGAAAACTGAACGGTAATGTGCAGGCTGTCCCTGGGCACAGTCGGAGATGCAGCCTCGTCTTCAAAGTGCTGGATATTTGATAAAACATGAAAAAAAAAACCCAACTCCATTTGTCCTGGAAGAATGCATACGGACATCTACGGTATCCCAAGGACTTTGCAATGGATGCTGCGGCTTCAAAGGCATGGAAACAAAGTAGGGAGAAGAGAAAAAAGGCAAGACTTTATCATTCGAATGAACTCGGAACATAAATAATTTATAGGACGTTTCTGGCTGCATGAAATCATGAAATCCTCCATATTTTTTTTTTTTTTGTGGTCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACTGTCGCATTCGTACGGTGCGTCCCGCCAACGCTTGCCCCAATCACGGGGTAAGGAACTGCTAAACGTCGCCCAGCCCCGCCCTTTCTGGCAGTCAGAGATCTACTTA
  5   1   2       bld Gas       in                   TGas121l09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCTAAAAAAAAAAAAAAAAAAATCAAATCCTTGCCATCATTTGGAGGATGTTCTATAATAATGTTTGATGTAGAAATCACCACTATAGAAAACTGAACGGTAATGTGCAGGCTGTCCCTGGGCACAGTCGGAGATGCAGCCTCGTCTTCAAAAGTGCTGGATATTTGATAAAACATGAAAAAAAAAACCCAACTCCATTTGTCCTGGAAGAATGCATACGGACATCTACGGTATCCCAAGGACTTTGCAATGGATGCTGCAGCTTCAAAGGCATGGAAACAAAGTAGGGAGAAGAGAAAAAAGGCAAGACTTTATCATTCGAATGAACTCGGAACATTAATAATTTATAGGACGTTTCTGGCTGCATGAAATCATGAAATCCTCCATATTTTTTTTTTTTTTTT
  5   1   2       bld Gas       in                  TGas089d04.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGACTTTTGACTCTTTGTATCTAAATTAAAAAAAAAAAAAATACTTCTTTCCGGATAAGCCACTATCTATACCTTGGTACATAAAATGTACATTTATTTTTATTCTGCGTATTTATGAAACGGAAGATGTTTTTGTTCTTTGTCTAAAAAAAAAAAAAAAAAAATCAAATCCTTGCCATCATTTGGAGGATGTTCTATAATAATGTTTGATGTAGAAATCACCACTATAGAAAACTGAACGGTAATGTGCAGGCTGTCCCTGGGCACAGTCGGAGATGCAGCCTCGTCTTCAAAAGTGCTGGATATTTGATAAAACATGAAAAAAAAAACCCAACTCCATTTGTCCTGGAAGAATGCATACGGACATCTACGGTATCCCAAGGACTTTGCAATGGATGCTGCAGCTTCAAAGGCATGGAAACAAAGTAGGGAGAAGAGAAAAAAGGCAAGACTTTATCATTCGAATGAACTCGGAACATTAATAATTTATAGGACGTTTCTGGCTGCATGAAATCATGAAATCCTCCATATTTTTTTTTTTTTTTTGTGGGCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACT
  5   1   2       bld Gas7      in                         XZG31987.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAAAAAAAAAAAAAAAAAATCAAATCCTTGCCATCATTTGGAGGATGTTCTATAATAATGTTTGATGTAGAAATCACCACTATAGAAAACTGAACGGTAATGTGCAGGCTGTCCCTGGGCACAGTCGGAGATGCAGCCTCGTCTTCAAAGTGCTGGATATTTGATAAAACATGAAAAAAAAAAACCCAACTCCATTTGTCCTGGAAGAATGCATACGGACATCTACGGTATCCCAAGGACTTTGCAATGGATGCTGCAGCTTCAAAGGCATGGAAACAAAGTAGGGAGAAGAGAAAAAAGGCAAGACTTTATCATTCGAATGAACTCGGAACATAAATAATTTATAGGACGTTTCTGGCTGCATGAAATCATGAAATCCTCCATATTTTTTTTTTTTTTTTTGTGGTCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACTGTCGCATTCGTACGGTGCGTCCCGCCAACGCTTGCCCCAATCACGGGGTAAGGAACTGCTAAACGTCGCCCAGCCCCGCCCTTTCTGGCAGTCGGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACC
  5   1   2       bld Gas7      in                         XZG32210.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAAAAAAAACCCAACTCCATTTGTCCTGGAAGAATGCATACGGACATCTACGGTATCCCAAGGACTTTGCAATGGATGCTGCAGCTTCAAAGGCATGGAAACAAAGTAGGGAGAAGAGAAAAAAGGCAAGACTTTATCATTCGAATGAACTCGGAACATAAATAATTTATAGGACGTTTCTGGCTGCATGAAATCATGAAATCCTCCATATTTTTTTTTTTTTTTTGTGGTCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACTGTCGCATTCGTACGGTGCGTCCCGCCAACGCTTGCCCCAATCACGGGGTAAGGAACTGCTAAACGTCGCCCAGCCCCGCCCTTTCTGGCAGTCGGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAA
  5   1   2       bld Gas7                                 XZG65422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACTCCATTTGTCCTGGAAGAATGCATACGGACATCTACGGTATCCCAAGGACTTTGCAATGGATGCTGCGGCTTCAAAGGCATGGAAACAAAGTAGGGAGAAGAGAAAAAAGGCAAGACTTTATCATTCGAATGAACTCGGAACATAAATAATTTATAGGACGTTTCTGGCTGCATGAAATCATGAAATCCTCCATATTTTTTTTTTTTTTTTTTGGGGNCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACTGTCGCATTCGTACGGTGCGTCCCGCCAACACTTGCCCCAATCACGGGGTAAGGAACTGCTAAACGTCGCCCAGCCCCGCCCTTTCTGGCAGTCGGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTAT
  5   1   2       bld Tad5      in                          XZT5114.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCACTCCATTTGTCCTGGAAGAATGCATACGGACATCTACGGTATCCCAAGGACTTTGCAATGGATGCTGCGGCTTCAAAGGCATGGAAACAAAGTAGGGAGAAGAGAAAAAAGGCAAGACTTTATCATTCGAATGAACTCGGAACATAAATAATTTATAGGACGTTTCTGGCTGCATGAAATCACGAAATCCTCCATATTTTTTTTTTTTTTTGTGGTCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACTGTCGCATTCGTACGGTGCGTCCCGCCAACGCTTGCCCCAATCACGGGGTAAGGAACTGCTAAACGTCGCCCAGCCCCGCCCTTTCTGGCAGTCCGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTTCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTNCAAAA
  5   1   2       bld Gas                            TGas033i07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACGGTATCCCAAGGACTTTGCAATGGATGCTGCAGCTTCAAAGGCATGGNAAACAAAGTAGGGAGAAGAGAAAAAAGGCAAGACTTTATCATTCGAATGAACTCGGAACATTAATAATTTATAGGACGTTTCTGGCTGCATGAAATCATGAAATCCTCCATATTTTTTTTTTTTTTTTGTGGTCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACTGTCGCATTCGTACGGTGCGTCCCGCCAACGCTTGCCCCAATCACGGGGTAAGGAACTGCTAAACGTCGCCCAGCCCCGCCCTTTCTGGCAGTCGGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTT
  3   1   2       bld Gas       in                    TGas089d04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAGGACTTTGCAATGGATGCTGCAGCTTCAAAGGCATGGAAACAAAGTAGGGAGAAGAGAAAAAAGGCAAGACTTTATCATTCGAATGAACTCGGAACATTAATAATTTATAGGACGTTTCTGGCTGCATGAAATCATGAAATCCTCCATATNTTTTTTTTTTTTTTTGTGGTCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACTGTCGCATTCGTACGGTGCGTCCCGCCAACGCTTGCCCCAATCACGGGGTAAGGAACTGCTAAACGTCGCCCAGCCCCGCCCTTTTTGGCAGTCGGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTACAAAAAACAAAAACAAAAACATGCTTGCTGTTAAAAACAGTGATGACAGGGCATTTTGTGGGTTTGAATCCATTGCATATCAAAGGGCTTCTTTAAAAGAGAAAAGTGCTAAAACCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                   TGas121l09.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGGACTTTGCAATGGATGCTGCAGCTTCAAAGGCATGGAAACAAAGTAGGGAGAAGAGAAAAAAGGCAAGACTTTATCATTCGAATGAACTCGGAACATTAATAATTTATAGGACGTTTCTGGCTGCATGAAATCATGAAATCCTCCATATTTTTTTTTTTTTTTTGTGGTCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACTGTCGCATTCGTACGGTGCGTCCCGCCAACGCTTGCCCCAATCACGGGGTAAGGAACTGCTAAACGTCGCCCAGCCCCGCCCTTTTTGGCAGTCGGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTACAAAAAACAAAAACAAAAACATGCTTGCTGTTAAAACCAGTGATGACAGGGCATTTTGTGGGTTTGAATCCATTGCATATCAAAGGGCTTCTATAAAAGAGAAAAGTGCTAAAACCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG31987.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGGCAAGACTTTATCATTCGAATGAACTCGGAACATAAATAATTTATAGGACGTTTCTGGCTGCATGAAATCATGAAATCCTCCATATTTTTTTTTTTTTTTTTGTGGTCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACTGTCGCATTCGTACGGTGCGTCCCGCCAACGCTTGCCCCAATCACGGGGTAAGGAACTGCTAAACGTCGCCCAGCCCCGCCCTTTCTGGCAGTCGGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTACAAAAAACAAAAACAAAAACATGCTTGCTGTTAAAACAGTGATGACAGGGCATTTTGTGGGTTTGAATCCATTGCATATCAAAGGGCTTCTATTAAAAGAGAAAAGTGCTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7      in                         XZG32210.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACATAAATAATTTATAGGACGTTTCTGGCTGCATGAAATCATGAAATCCTCCATATTTTTTTTTTTTTTTTGTGGTCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACTGTCGCATTCGTACGGTGCGTCCCGCCAACGCTTGCCCCAATCACGGGGTAAGGAACTGCTAAACGTCGCCCAGCCCCGCCCTTTCTGGCAGTCGGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTACAAAAAACAAAAACAAAAACATGCTTGCTGTTAAAACAGTGATGACAGGGCATTTTGTGGGTTTGAATCCATGTGCATATCAAAGGGGCTTCTATTAAAAGA
  3   1   2       bld Tad5      in                          XZT5114.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGCTGCATGAAATCACGAAATCCTCCATATTTTTTTTTTTTTTTGTGGTCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACTGTCGCATTCGTACGGTGCGTCCCGCCAACGCTTGCCCCAATCACGGGGTAAGGAACTGCTAAACGTCGCCCAGCCCCGCCCTTTCTGGCAGTCCGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTTCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTACAAAAAACAAAAACAAAAACATGCTTGCTGTTAAAACAGTGATGACAGGGCATTTTGTGGGTTTGAATCCATTGCATATCAAAGNGGCTTCTATTAAAAGAGAAAAGTGCT
  3  -1   2       bld TpA       out                   TTpA020g20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTTTTTTTTTTTTGTGGTCATCAAACTATGCAAAGAATTGATATGCTGCTCTGAAGTTCCACTGGCTGCATTACTGTCGCATTCGTACGGTGCGTCCCGCCAACGCTTGCCCCAATCACGGGGTAAGGAACTGCTAAACGTCGCCCAGCCCCGCCCTTTCTGGCAGTCGGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTTCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTACAAAAAACAAAAACAAAAACATGCTTGCTGTTAAAACAGTGATGACAGGGCATTTTGTGGGTTTGAATCCATTGCATATCAAAGGGCTTCTATTAAAAGAGAAAAGTGCTTAAAACCATGTATTTGTATTCAATGTATCATATTGGGATTGGGCACCCTTGGGCTTCCAGATCTTCTCGAACTAAAGTTCTCGGAATCCAACAGCCAAAGGGTTGCTGGGAGTTCATGGAGGGCTGGAAGGCCGCAAGTTGCCCAGGGCAGGTTTTGGTGGTTGCTGTGTGGTACAAGCAAGAGTTGGGGAGCTAATACATCAATACATTCTAAATAGTGACTTTGTATC
  3   1   2       chi Neu                             TNeu099e12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACGTTTAGCAGTTCCTTACCCCGTGATTGGGGCAAGCGTTGGCGGGACGCACCGTACGAATGCGACAGTAATGCAGCCAGTGGAACTTCAGAGCAGCATATCAATTCTTTGCATAGTTTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu                             TNeu101e19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACCCCGTGATTGGGGCAAGCGTTGGCGGGACGCACCGTACGAATGCGACAGTAATGCAGCCAGTGGAACTTCAGAGCAGCATATCAATTCTTTGCATAGTTTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG47319.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCCGCCAACGCTTGCCCCAATCACGGGGTAAGGAACTGTTAAACGTCGCCCAGCCCCGCCCTTTTTGGCAGTCCGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTTCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGGGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTCCAAAAAACAAAAACAAAAACATGCTTGCTGTTAAAACAGTGATGACAGGGCATTTTGTGGGTTTGAATCCATTGCATATCAAAGGGCTTCTATTAAAAGAGAAAAGTGCTT
  5  -1   2       bld Gas                            TGas129d23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAACGCTTGCCCCAATCACGGGGTAAGGAACTGTAAACGTCGCCCAGCCCCGCCCTTTCTGGCAGTCGGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGCCCTTGGCAATTTTTTTTTTCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTACAAAAAAAAAAAAAAAAAAGCGGC
  5   1   2       bld Gas7                                 XZG14007.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTAAACGTCGCCCAGCCCCGCCCCTTCTGGCAGTCGGAGATCTACTTATATATTGAGGTCTTGATATTTTTATTTTTTTGGTTTTTATATATAAATCTAAATTATTTTATAAATAGATTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTACAAAAAACAAAAACAAAAACATGCTTGCTGTTAAAACAGTGATGACAGGGCATTTTGTGGGTTTGAATCCATTGCATATCAAAGGGCTTCTATTAAAAGAGAAAAGTGCTTAAA
  5   1   2       bld Neu                            TNeu144e21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTATATATTGAGGTCTTGGTTTTTAAAATATAAAAATCCCTATCTAAATAGATTTTTCTTTTTAAAAGTATCTGGTACTTGGAATTAAGACCTTGGCAATTTTTTTTTTCCCCCCTCTGTTCATTTTTATAAACAGAAAGGGGGGGTCCCTTTATTGAGTTTGGGGCCCAAACATGATTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAAGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTACAAAAAACAAAAACAAAAACATGCTTGCTGTTAAAACATTGATGACAGGGCATTTTGTGGGTTTGAATCCATTGCATATCAAAGGGCTTCTATTAAAAGAGAAAAGTGCT
  5   1   2       bld Neu                            TNeu042k19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCGGGGGTTTTTATATATAAAATCTAAATTATTTTATAAATAGATTTTTTTTTTAAAAGTATCTGGTACTTGGAATTAGGACCTTGGCAATTTTTTTTTTCCCCCCTCTGTTCAGTTTTATAAACAGAAGGGGGGGGTCCCTTTAGTGAGTTTGGGGCCCAAACATGAGTGGGACTTTGCTGGGACCTCGCTAGCACAATCTGCACAGGATGGATGGAGTCTTAACCCATTTTCACGGTGGTACTGCTAACTGAACGGATTGTACTTTTTCCTTTACGGACATGCGTTATTTAAGATTATAATATATTTATCTGATACTCTGTTTTAAGGGTGGTTATTGTCCCTTATTTTTAAAGGGTTAGTTTGCCTTTTGTAGATGCTGTACAAAAAACAAAAACAAAAACATGCTTGCTGTTAAAACAGTGATGACAGGGCATTTTGTGGGTTTGAATCCATTGCATATCAAAGGGCTTCTATTAAAAGAGAAAAGTGCTT
  5   1   2       bld Gas       in                   TGas102l17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTAGTTTGCCTTTTGTAGATGCTGTACAAAAAACAAAAACAAAAACATGCTTGCTGTTAAAACAGTGATGACAGGGCATTTTGTGGGTTTGAATCCATTGCATATCAAAGGGCTTCTATTAAAAGAGAAAAGTGCTTAAAACCATGTATTTGTATTCAATGTATCATATTGGGATTGGGCACCCTTGGGCTTCCAGATCTTCTCGAACTAAAGTTCTCGGAATCCAACAGCCAAAGGGTTGCTGGGAGTTCATGGAGGGCTGGAAGGCCGCAAGTTGCCCAGGGCAGGTTTTGGTGGTTGCTGTGTGGTACAAGCAAGAGTTGGGGAGCTAATACATCAATACATTCTAAATAGTGACTTTGTATCATAATAGTATGGCCCAGTTTAATATTAGAATCATGCTGGTATCTGTTGGAATACAGCTCTCTGGTTGTCTGCTATTCAATCACTAGTGGTGCCAGTGCCATATGTTCCTCCCTTTATTGGGTTTGATGGGAAGATTTGACAGTGTTGATGATAATGCTATCTCGAGCCTGTCGGACTTTAACTGCCGCCTTGTCCATCAT
  5   1   2       bld HdA       out                  THdA022l14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATCAAAGGGCTTCTATTAAAAGAGATGAGTGCTTAAAACCATGTATTTGTATTCAATGTATCATATTGGGATTGGGCACCCTTGGGCTTCCAGATCTTCTCGAACTAAAGTTCTCGGAATCCAACAGCCAAAGGGTTGCTGGGAGTTCATGGAGGGCTGGAAGGCCGCAAGTTGCCCAGGGCAGGTTTTGGTGGTTGCTGTGTGGTACAAGCAAGAGTTGGGGAGCTAATACATCAATACATTCTAAATAGTGACTTTGTATCATAATAGTATGGCCCAGTTTAATATTAGAATCATGCTGGTATCTGTTGGAATACAGCTCTCTGGTTGTCTGCTATTCAATCACTATTGGTGCCAGTGCCATATGTTCCTCCCTTTATTGGGTTTGATGGGAAGATTTGACAGTGTTGATGATAATGCTATCGCGAGCCTGTCGGACTTTAACTGCCACCCTGTC
  3   1   2       bld Gas       in                    TGas102l17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCTGTGTGTACAGCAAAGAGTGNGGGAGCTAATACATCAATACATTCTAAATAGTGACTTTGTATCATAATAGTATGGCCCAGTTTAATATTAGAATCATGCTGGTATCTGTTGGAATACAGCTCTCTGGTTGTCTGCTATTCAATCACTAGTGGTGCCAGTGCCATATGTTCCTCCCTTTATTGGGTTTGATGGGAAGATTTGACAGTGTTGATGATAATGCTATCTCGAGCCTGTCGGACTTTAACTGCCGCCTTGTCCATCATGAAGGGGGAATTAACCATATAGATACAATAAAGGCCATGATCTGGCAGCTGGAGGTGGGTATGGACTTGAAGAAGAAGAAGAAGGCAGCCTGTAGTGTTATAGAATGCCAACCCAATCCCCTTATTTGAAGTCCTATAACAAGCTTTTCAATTCAGTCTCTGTATCCAACTGTAAAGTGTGGTTACCGGTGCTGTAGAGCGAATGTAGCATTGACAGCTCTTATTGGCTTGGCCAACATCTAACAAAAATACAGATATGGGCACAAGGATGGTGCTTTTGAGTTGACACCCCCAGGCATGCCAAGGTTTAATAGGAATGGTAGAGCTACATTTGAACCAAGGGTGGAATAAATGGGCCTAATTGCAGGAATGTGTGTGTCTAGTCCCCTCAATGCTTCTCCATCAGTGGTAGCTCCACCCTTGGACCCTATTGCTATTGTAGTTTCCCATATTACCTCTGCTGGGGCTGCTGCTGAGATAAATGTCTAAGTGAAGCGTGTCTGTACAAA
  5   1   1       add Neu                            TNeu001i09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGATGGGGAAGATTGACAGTGTTGATGATAAGGCTGATCTCGAGCCTGTCGGACTTTAACTGCCGCCTTGTCCATCATGAAGGGGGAATTAACCATATAGATACAATAAAGGCCATGATCTGGCAGCTGGAGGTGGGTATGGACTTGAAAAAAAAGAAGAAGGCAGCCTGTAGTGTTATAGAATGCGGACCCAATCCCCTTATTTGAAGTCCTATAACAAGCTTTTCAATTCAGTCTCTGTATCCAACTGTAAAGTGTGGTTACCGGTGCTGTAGAGCGAATGTAGCATTGACAGCTCTTATTGGCTTGGCCAACATCTAACAAAAATACAGATATGGGCACAAGGGTGGTGCTTTTGAGTTGACACCCCCGGGCATGCCAAGGGGTAATAGGAATGGTAGAGCTACATTTGAACCAAGGGTGGAATAAATGGGCCTAATTGCAGGAATGTGTGTGTCTAGTCCCCTCAATGCTTCTCCATCAGTGGTAGCTCCACCCTTGGACCCTATTGCTATTGGAGTTTCCCATATTACCTCTGCTGGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)