Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ12433.5                           3 END     3           4      100                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012073091 Xt7.1-CABH5126.3.5 - 75 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABH5126.3.5 GCGCACAACTCATGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224147       AACTCATGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths      2     2     5     7     6    10     7    13    10    15    11    17    13    20    13    20    13    21    14    22    14    22    14    23    14    23    14    23    14    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    24    24    25    25    25    25    25    25    25    26    25    26    25    26    25    26    25    27    25    27    25    27    25    27    25    27    25    27    25    27    25    27    25    27    24    26    24    27    25    27    25    27    25    27    25    26    25    26    25    26    25    26    25    26    25    26    25    27    26    27    26    27    26    27    25    27    24    27    24    27    24    27    24    28    23    27    23    28    22    30    20    31    25    32    27    33    26    34    26    33    26    35    31    41    32    41    32    41    29    38    25    38    27    39    27    38    29    39    30    39    30    41    28    39    27    41    28    43    29    44    29    44    30    45    29    43    30    44    30    43    31    43    29    41    29    41    29    41    28    41    29    41    29    41    29    41    29    43    29    43    29    43    29    45    29    46    29    45    33    45    33    45    32    46    31    45    31    45    33    46    32    45    36    45    36    45    35    45    36    44    36    44    37    45    37    46    38    46    37    46    37    46    38    46    37    45    34    44    31    44    35    44    36    42    36    42    37    42    36    42    35    41    35    41    35    41    35    41    34    41    32    41    33    40    32    38    30    37    32    37    30    37    12    15     5     5     2     2
  5   1   2  SIG                                      Xt7.1-CABH5126.3      CAACTCATGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                       Xt7.1-CABI437.3        CCCGGGGCCCGGGGCTCATGCTGTCAGGCTGCGCGTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTGTTGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTG
  5   1   2  SIG                                     Xt7.1-CBWN14447.5                       GGGGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCCTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCTGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGGGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTTCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTCTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTAATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGCATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTAACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATTACAATGGAAGCCACCCAAGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCTGTTGTGTATTGTGTGCCCACTACTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABK1975.3                                                                                                                                                                                                                                                                                                                                                                                                 TATTTTCTTGAACAGAGAATTCAATTAAATATTTACTTGGTTGCAAATTCTCTGGATAACCGTGCCCTGCGTGGAATCAGTAGTAGTGGGCATGTTAAATGTGCAACTGTTTGCTGTCAAGGAGCACAACTCCCAGCATTAATTTCACTCTTACAAAATGTGGTACCTCAGTGGTAGGCAGTTTTGCAACACACCATAGTGTATACTGTTGAAATGGCATCCTCTTTCTGTATATCTGCATGAGTGGGAGCTGCCACATTGTTTAATGATGCCATTTTAAAACTGGGCCCCACAGGAAAAATCATTTTAGGGCCCCCATAAGTCTTGGGAATAAAATATTTTTTATGAAACAGTTATACTTCCCAGGCTCCCCAGCAGCTGCAGTGTCTGCCTCATTTATAGTCAGGAGAAATTAAAAGTCAACATTTGTGTAGGGGAGTAGGCTTAAAAAGTGTTTGTAGCGACTGTGTGGGTTGTGTCTAATGTATGCATGGGCTCCAGTGTTTGTGTCATGGATGTGACGATAGTCTGGGGATAATGGGGGGGATGCCTTTCCCCTTAATGTGCATCAAATGATGCAGGGTGCTGTAGTACAACAGGTGCTACTGAGGCACAAGTTGATTGTTTTGACATCCCAGATTTTGATATTCCTTGCAGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGTGAGTTGGCCACCAGGGGGCGCAGTTCTGCTAAGAAGTCTCAGTACCAGACAGGCTTTTACCTTGCCATTTCCCTTTTTCCCCTTCAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGACTGTTCTCCTGGGTGTTGCACTGTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGGTTTTTATCGTTAATGCACTTTCCATCTCAGCCTGTTGGCAGTTCTTATGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACA
                                                                   VAR                                                 GCTGAAGAATGG
                                                                   VAR                                                             CATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAACATTTGTGTAGGGGAGTAGGCTTAAAAAGTGTTTGTAGCGACTGTGTGGGTTGTGTCTAATGTATGCATGGGCTCCAGTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGGGATAATGGGGGGGATGCCTTTCCCCTTAATGTGCATCAAATGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAAGTTGATTGTTTTGACATCCCAGATTTTGATATTCCTTGCAGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGTGAGTTGGCCACCAGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATGGTAGGGAGATCTGTTCTCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTACCTGTTGTGTATTGTGTGCCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGATGATGTTG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T--T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     T----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-------
                                               BLH ATG      44     743 
                                               BLH MIN      44     194 
                                               BLH MPR      38     194 
                                               BLH OVR      44      22 
                                               CDS MIN      44      11 
                                               EST CLI       0      11 
                                               ORF LNG      44       2 
                                                                                                                                                                                                    PROTEIN --- Sc ---- 8e-092     NP_014361.1 alpha-4-beta-4 subunit of mitochondrial isocitrate dehydrogenase 1; Idh1p[Saccharomyces cerevisiae] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                           PROTEIN --- Gg ---- 5e-094     NP_001026558.1 isocitrate dehydrogenase 3, beta subunit [Gallus gallus] --------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                        PROTEIN --- Dr ---- 2e-097     NP_001002157.1 zgc:86647 [Danio rerio] --------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                             PROTEIN --- Dm ---- 8e-106     NP_651416.1 CG5028-PA [Drosophila melanogaster] --------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                               PROTEIN --- Ce ---- 7e-110     NP_491989.1 isocitrate dehydrogenase (1H553) [Caenorhabditis elegans] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                         PREDICTED - Sp ---- 6e-126     XP_001175786.1 PREDICTED: similar to NAD (H)-specific isocitrate dehydrogenase gamma subunit precursor isoform 1 [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                      PROTEIN --- Hs ---- 3e-172     NP_004126.1 isocitrate dehydrogenase 3 (NAD+) gamma isoform a precursor; isocitricdehydrogenase; isocitrate dehydrogenase, NAD(+)-specific, mitochondrial, gammasubunit; IDH-gamma; NAD+-specific ICDH; NAD (H)-specific isocitratedehydrogenase gamma subunit precursor [Ho ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                      PROTEIN --- Mm ---- 2e-172     NP_032349.1 isocitrate dehydrogenase 3 (NAD+), gamma [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                   PROTEIN === Xl ==== 0          AAH74219.1 MGC83400 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                   PROTEIN === ?? ==== 0          NP_001086122.1 MGC83400 protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                   PROTEIN === Xt ==== 0          NP_001025597.1 MGC107965 protein [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABH5126.3.5            ATG------------------------TGA---ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------ATG---------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATGATG------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------TGA------ATG------ATG---------------------------------------------TGA---------------------------------------------------------------------------TAGTGA------------------------TAA---------------------------------------------------------------------------------ATG------------------------------ATG---------TGA---------------TAG---ATG------------------------TAA---------------TGA------ATG---TGATGA------------------------------------------TAA
                                                                   ORF                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2  SIG                                      Xt7.1-CABH5126.3      CAACTCATGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008283176            ATGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1           AbdN FL                     IMAGE:7025456.FL-MGC      CAACTCATGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       add AbdN 5g                            IMAGE:7003407 GCGCACAACTCATGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCCAAGGAAGTAACCTTCAGGGTACCCCAGATATCACCCTTTTGAGAAGCATGGATTCGTTGACCAACACCCACAAATGGCAGCTTCGGTGTTCCCAAACCCCACAAGCCAATTTTTT
  5   1   2       add Tail      in                        CBSW10154.b1 GCGCACAACTCATGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCTGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGGGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAAC
  5   1   3        nb AbdN FL                            IMAGE:7025456      CAACTCATGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCCACCCCAAGCAGTTTTGACGTCATGGTGAATGCCTATCTGTAT
  5   1   2   10  ext Tbd1 5g3  in                        CBXT16746.b1 .....CAACTCATGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCT
  5   1   2   12  ext Tad5 5g3  in                         XZT68143.5p ......AACTCATGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCCACATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTA
  5   1   2       add In63 5g                         IMAGE:8957279.5p        TTATTGGTTTCTTTTTACGTATTTCTTTTTAAAAAAATCGTCCTCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGTCTCAGGGTACCCAGATATCACCTTTGAGAAGCATGATCGTTGAACAACATCAC
  5   1   2   10  ext Mus1 5g3  in                         CABH5067.5p ...................AGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTG
  5   1   3   20   nb Hrt1 5g   ?                         CAAQ11022.5p ..............................CATCGATTCGGAAGATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAAC
  5   1   2   12  ext Tad5 5g3  in                         XZT21057.5p ................................CCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCTCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGGAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGGCAGTTGACGTCATGGTGATGCCTAATCTGTA
  5   1   2       add In62                            IMAGE:8955537.5p                                        ATTAATTAATAAAAATTCATATATTTTAAAAACACCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGACGGAAGAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGTACTCAGATATCACCTTTGAGAGCATGATCGTTGACACACCACATGCAGCTCGTGTCCACCACAGCAGTTTGACGTCATGTGATGCCTATCTGTATGGTAATATTGTAACACGTTGCGCTGTTGTGGGGTCAGACTCGTTCAGGGTCATTATGCACGTCTATGCGTCTTGACTGCACAGACCAGCCAGCATGCACAGACTAGCTATCCATGCAGTCCTGCCAGTATGAGCAGACTCAGTGCAGCTAGTCGCTCATGAGCATCGGCAATAGAGCACCGAGCCACTGA
  5   1   3        nb Brn4      in                        CAAL19395.5p                                                GCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTTGGT
  5   1   2       ext Fat1      in                         CABC5779.5p                                                         TCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCANGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTTGTAACAACGTTTGCGCTGGTTTGGT
  5   1   2       add In66                            IMAGE:8966354.5p                                                                    ATCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGTACCCAGATATCACCTTTGAGAGCATGATCGTGACAACACACATGCAGCTCGTGTCGACCACAGCAGTTTGACGTCATGTGATGCTAATCTGTATGGTATATGTAACACGCTGGCGCTGTTGTTGGGTCAGACTCGTCCAGGCAATTAATGCACTGTCTATGGCGGTCTTTGGAACTGTGCACACCA
  5   1   3        nb Ski1      in                         CABJ9959.5p                                                                      CTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATGACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCC
  5   1   2       add In62                            IMAGE:8954076.5p                                                                                          GTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCGGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGTGATGCCTAATCTTGTATGGTATATTGTAAACACGTTTGCGCTGCTTGATGGGTTCAGGACTCGTCAGGCAAATTATGGCAACGTCTATGCGTCTTGGACTGCACAGACCAGCAAAGCATTGGCCAACAGAACATAGCTAATCAAC
  5   1   4      seed Lun1      in                         CABD2535.5p                                                                                                     CCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACAAACTTTCATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGG
  5   1   2       add HdA       in                  THdA039f20.p1kaSP6                                                                                                                                 ACAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACTTTGCGCTGGTTTGGGNTTGGGGGTCCAGAACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCCAACAGAACATAGCTAATCCCACTGCCATGC
  5   1   0       chi Lun1      in                         CABD6964.5p                                                                                                                                                                       TCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATAGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGNCACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTTGCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGC
  5   1   3        nb Te5       in                         CAAO2619.5p                                                                                                                                                                                                                                                                                                      CCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGC
  5   1   3        nb Gas7      in                          XZG5419.5p                                                                                                                                                                                                                                                                                                                                             CTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTG
  5   1   3        nb Mus1      in                         CABH1869.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGGT
  5   1   3        nb Ski1      in                         CABJ3149.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATCGATTCGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATT
  5   1   3        nb TpA                            TTpA022o04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAATATTATGAAACTCGAGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTCTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAAGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCACAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAACAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAAGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTCGTCGCACTGTTAT
  5   1   3        nb Gas7      in                         XZG16375.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTAGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAAGGCACTTTCCATCTCAGCCTGTGGCAGTTCCTATTGTGTGCTTATGCCT
  3   1   4      seed Lun1      in                         CABD2535.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCATGCTGCAAGGAAGTAGCTCAGGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCACCCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAA
  3   1   2       ext Fat1      in                         CABC5779.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCATGCTGCAAGAAGTAGCTCAGAGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTAGCCTCTCGCC
  3   1   3        nb Mus1      out                        CABH5126.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAA
  5   1   3        nb Sto1      in                         CABG1358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAAATGTAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTAT
  5   1   2       ext Mus1      in                         CABH5740.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGAGGCCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTTATAGAATAAGCTTATTTTTCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAAAACTC
  3   1   2       ext Mus1 5g3  in                         CABH5067.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTNTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAA
  3   1   3        nb Ski1      in                         CABJ3149.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC
  3   1   3        nb Ski1      out                        CABJ4750.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGCTGGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC
  3   1   3        nb Mus1      in                         CABH1869.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC
  3   1   3        nb Sto1      in                         CABG1358.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCCACAGCAGTTGGACGTCATGGTGATGCCTATTCTGTATGGTAATATGNTAAACAACGTTNGCGCTGGTTGGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC
  3   1   3        nb Brn4      in                        CAAL19395.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGT
  3   1   2       ext Tad5 5g3  in                         XZT68143.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTGCGCTGGTTTTGGTAGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTGTTGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAC
  3   1   2       add Lun1      in                         CABD6964.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCACAGCAGTTTGACGTCATGGTGATGCNTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC
  3   1   2       ext TbA       out                   TTbA054b09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAAGATGCAATGAATGAATGTTGTTATAAGAATAAGATTATTTTCCAAAATATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAAAAAAG
  5   1   3        nb Tad5                                 XZT54065.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATA
  5   1   2       ext TpA       in                  TTpA018k20.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAAGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACNATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC
  3   1   2       ext TpA       in                    TTpA018k20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTGTTACACAGTCAAAAAAAAAAAAAAAAAA
  3   1   3        nb Ski1      in                         CABJ9959.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC
  3   1   2       ext Tad5 5g3  in                         XZT21057.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAAAGG
  3   1   2       ext Tbd1 5g3  in                        CBXT16746.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATGGCAACGTATATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAA
  3   1   2       add Tail      in                        CBSW10154.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGCATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTAACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATTACAATGGAAGCCACCCAAGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCTGTTGTGTATTGTGTGCCCACTACTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                          XZG5419.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTGTTGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC
  3   1   2       ext Mus1      in                         CABH5740.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGGAACACAGGCAAAAGCATGGTCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTAGGATGCTGGACCATTCTCAAGTTGCATAGGTATGCTGCCTCCATTCGCAAAGCTATTTTGGGCAGTAGGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATCGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATACGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATCCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGAGTACCCGTTGTGTATTATGTACCCACTGCTGGATCTGTA
  3   1   2       add HdA       in                    THdA039f20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTTTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATTTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Brn4      in                        CAAL18681.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTGTTGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC
  5   1   3        nb Brn4      in                        CAAL18681.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTGTTGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAA
  5   1   3        nb Te1       in                         CBWN3375.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTGTTGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTATCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAA
  3   1   3        nb Te1       in                         CBWN3375.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTGTTGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTATCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAA
  5   1   2       ext Tad5                                 XZT38881.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGG
  5   1   3        nb Gas                            TGas047e04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGGCGGNAACAATACAATGGNAAGCCACCCATGCGGGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCANCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCANATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC
  3   1   3        nb Gas7      in                         XZG16375.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGAAACTGAGCATGCATACTCTGGGGTTGCGATGGAGGGAGATCTGTTCTCCCGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACCGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCCCTGCTGGATCTGTACCTGGAGAACACGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAACCTACTCATGAATAAATATCTTGTTACACAGTC
  3   1   3        nb Te5       in                         CAAO2619.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGTGACACACTGATTTAGTTTTTGTCATTNAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC
  5   1   3        nb Tad5                                 XZT47025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                       Xt7.1-CABI437.3        CCCGGGGCCCGGGGCTCATGCTGTCAGGCTGCGCGTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTGTTGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTG
                                                  Xt7.1-CHK-1008283178              GCCCGGGGCTCATGCTGTCAGGCTGCGCGTxxCCxGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGxAAAxxATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTGTTGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACAC
  5   1   2       ext Gas  5g                        TGas047g14.p1kSP6        CCCGGGGCCCGGGGCTCATGCTGTCAGGCTGCGCGTGTCCCGGCTGAAGAAGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGGGTGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTGCCCGGGGTCCANACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACA
  5   1   2   10  ext Thy1 5g3  in                        CBST5179.fwd ...................ACTCATGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCG
  5   1   4   10 seed Ovi1 5g3  in                          CABI437.5p ..................................CATCGATTCGCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTG
  5   1   3        nb Brn4      in                        CAAL18145.5p                                                                    TTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCCGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGCGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTGCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGT
  3   1   4      seed Ovi1 5g3  in                          CABI437.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTTTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC
  3   1   3        nb Brn4      in                        CAAL18145.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTGTTGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACCCGGTC
  3   1   2       ext Thy1 5g3  in                        CBST5179.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGTATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTGTTGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAGGGTATTCATGAATAAATATCTTGTTACACAGCC
  5   1   2  SIG                                     Xt7.1-CBWN14447.5                       GGGGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCCTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCTGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGGGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTTCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTCTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTAATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGCATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTAACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATTACAATGGAAGCCACCCAAGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCTGTTGTGTATTGTGTGCCCACTACTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008283182                             GTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCCTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCTGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGGGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTTCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTCTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTAxxGxxAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGCATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTAACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATTACAATGGAAGCCACCCAAGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCTGTTGTGTATTGTGTGCCCACTACTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAA
  5   1   2       ext BrSp 5g3  in                     EC2BBA28CA09.g1                       GGGGCTGTCAGGCTGCGCATTTCCCGGCTGAAGAATGGCATCTCGTTCTATATCTGCAGCTTATCGCTTGCCTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAG
  5   1   4      seed Te1       in                        CBWN14447.b1                                                            GCATCTCGTTCTATATCTGCAGCTTATCGCTTGCTTCTCTCACCCGTACCGCTCCGGTCAGGATTCAGACAAACGCAGCAGGCCCTGTCTGCTGTGTGGATGCAGAATAGAGACTACTCAATACCCCCACCAGCCAAGTATGGAGGAAGGCATACAGTAACCATGATCCCAGGGGACGGCATTGGGCCTGAGCTTATGCTACACGTGAAAGAAGTATTTAGGCATTCCTGTGTGCCAATTGATTTTGAGGTGGTCAATGTGAATTCGACATCTAATGATGAAGATGACATTCAGAATGCCATAACAGCCATCCGTCGCAACAGGGTCGCGCTAAAAGGTAACATTGAGACAAACCATAACATGCCGCCTTCTCATCGCTCACGAAATAATCTGCTCCGCACAAGTCTGGACCTTTATGCCAATGTCATACACTGCCGCAGTGTCCCCGGGGTCCAGACCCGCCATAAGGACATCGATATTATGATAGTGAGAGAAAACACAGAAGGGGAATACAGCAGCCTGGAACATGAGAGTGTGTCTGGGGTAGTCGAGAGCCTCAAGATCATTACACGGGCAAATTCACTTCGCATCGCAGAATATGCATTTAAGTTGGCTCGGGAGGAAGGACGGAAGAAGATCACAGCAGTTCACAAGGCAAATATTATGAAACTCGGGGATGGACTGTTCCTTTCATGCTGCAAGGAAGTAGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAA
  5   1   2       ext HeRe      in                     EC2CAA41DE09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCCTCAGGGTACCCAGATATCACCTTTGAGAGCATGATCGTTGACAACACCACAATGCAGCTCGTGTCCAACCCACAGCAGTTTGACGTCATGGTGATGCCTAATCTGTATGGTAATATTGTAAACAACGTCTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGCATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACAGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTAACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATTACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCATTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCCACTGCTGGATCTGTACCTGG
  3   1   4      seed Te1       in                        CBWN14447.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAACAACGTCTGCGCTGGTTTGGTTGGGGGTCCAGGACTCGTTCCAGGGGCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGCATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTAACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATTACAATGGAAGCCACCCAAGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCTGTTGTGTATTGTGTGCCCACTACTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTCAAAAAAAAAAAAAAA
  3   1   2       ext HeRe      in                     EC2CAA41DE09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGTTCCAGGATTCGTTTCCCAGGGGCAAATTATGGCAACGTCTTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGCATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACAGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTAACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATTACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTT
  3   1   2       ext BrSp 5g3  in                     EC2BBA28CA09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAAATTATGGCAACGTCTATGCGGTCTTTGAAACTGCAACAAGGAACACAGGCAAAAGCATTGCCAACAAGAACATAGCTAATCCCACTGCCATGCTCCTTGCCAGCTGCATGATGCTGGACCATCTCAAGTTGCATAGCTATGCTGCCTCCATTCGCAAAGCTATTCTGGGCAGTATGAATGAACACCGGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTAACTGTCTGAGAGGATATGGGTGCCATGGGCTGGGCAGAACAATTACAATGGAAGCCACCCAAGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCTGTTGTGTATTGTGTGCCCACTACTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATA
  5   1   2  SIG                                      Xt7.1-CABK1975.3                                                                                                                                                                                                                                                                                                                                                                                                 TATTTTCTTGAACAGAGAATTCAATTAAATATTTACTTGGTTGCAAATTCTCTGGATAACCGTGCCCTGCGTGGAATCAGTAGTAGTGGGCATGTTAAATGTGCAACTGTTTGCTGTCAAGGAGCACAACTCCCAGCATTAATTTCACTCTTACAAAATGTGGTACCTCAGTGGTAGGCAGTTTTGCAACACACCATAGTGTATACTGTTGAAATGGCATCCTCTTTCTGTATATCTGCATGAGTGGGAGCTGCCACATTGTTTAATGATGCCATTTTAAAACTGGGCCCCACAGGAAAAATCATTTTAGGGCCCCCATAAGTCTTGGGAATAAAATATTTTTTATGAAACAGTTATACTTCCCAGGCTCCCCAGCAGCTGCAGTGTCTGCCTCATTTATAGTCAGGAGAAATTAAAAGTCAACATTTGTGTAGGGGAGTAGGCTTAAAAAGTGTTTGTAGCGACTGTGTGGGTTGTGTCTAATGTATGCATGGGCTCCAGTGTTTGTGTCATGGATGTGACGATAGTCTGGGGATAATGGGGGGGATGCCTTTCCCCTTAATGTGCATCAAATGATGCAGGGTGCTGTAGTACAACAGGTGCTACTGAGGCACAAGTTGATTGTTTTGACATCCCAGATTTTGATATTCCTTGCAGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGTGAGTTGGCCACCAGGGGGCGCAGTTCTGCTAAGAAGTCTCAGTACCAGACAGGCTTTTACCTTGCCATTTCCCTTTTTCCCCTTCAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGACTGTTCTCCTGGGTGTTGCACTGTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGGTTTTTATCGTTAATGCACTTTCCATCTCAGCCTGTTGGCAGTTCTTATGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACA
                                                  Xt7.1-CHK-1008283180                                                                                                                                                                                                                                                                                                                                                                                                       CTTGAACAGAGAATTCAATTAAATATTTACTTGGTTGCAAATTCTCTGGATAACCGTGCCCTGCGTGGAATCAGTAGTAGTGGGCATGTTAAATGTGCAACTGTTTGCTGTCAAGGAGCACAACTCCCAGCATTAATTTCACTCTTACAAAATGTGGTACCTCAGTGGTAGGCAGTTTTGCAACACACCATAGTGTATACTGTTGAAATGGCATCCTCTTTCTGTATATCTGCATGAGTGGGAGCTGCCACATTGTTTAATGATGCCATTTTAAAACTGGGCCCCACAGGAAAAATCATTTTAGGGCCCCCATAAGTCTTGGGAATAAAATATTTTTTATGAAACAGTTATACTTCCCAGGCTCCCCAGCAGCTGCAGTGTCTGCCTCATTTATAGTCAGGAGAAATTAAAAGTCAACATTTGTGTAGGGGAGTAGGCTTAAAAAGTGTTTGTAGCGACTGTGTGGGTTGTGTCTAATGTATGCATGGGCTCCAGTGTTTGTGTCATGGATGTGACGATAGTCTGGGGATAATGGGGGGGATGCCTTTCCCCTTAATGTGCATCAAATGATGCAGGGTGCTGTAGTACAACAGGTGCTACTGAGGCACAAGTTGATTGTTTTGACATCCCAGATTTTGATATTCCTTGCAGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGTGAGTTGGCCACCAGGGGGCGCAGTTCTGCTAAGAAGTCTCAGTACCAGACAGGCTTTTACCTTGCCATTTCCCTTTTTCCCCTTCAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGxxxxCTGTTCxxCxxGGTGTTGxxxxxTATCTTTCAGCTTGTGTGTAGTGACACACTGxxTTxxGTTTTTATCGTTAAxxxxCTTTCCATCTCAGCCTGTxGxxxxTTCTTATxxxxxCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTxxTxxxACAGTC
  5   1   4   10 seed Spl1 5g3  in                         CABK1975.5p ................................................................................................................................................................................................................................................................................................................................................................................................TATTTTCTTGAACAGAGAATTCAATTAAATATTTACTTGGTTGCAAATTCTCTGGATAACCGTGCCCTGCGTGGAATCAGTAGTAGTGGGCATGTTAAATGTGCAACTGTTTGCTGTCAAGGAGCACAACTCCCAGCATTAATTTCACTCTTACAAAATGTGGTACCTCAGTGGTAGGCAGTTTTGCAACACACCATAGTGTATACTGTTGAAATGGCATCCTCTTTCTGTATATCTGCATGAGTGGGAGCTGCCACATTGTTTAATGATGCCATTTTAAAACTGGGCCCCACAGGAAAAATCATTTTAGGGCCCCCATAAGTCTTGGGAATAAAATATTTTTTATGAAACAGTTATACTTCCCAGGCTCCCCAGCAGCTGCAGTGTCTGCCTCATTTATAGTCAGGAGAAATTAAAAGTCAACATTTGTGTAGGGGAGTAGGCTTAAAAAGTGTTTGTAGCGACTGTGTGGGTTGTGTCTAATGTATGCATGGGCTCCAGTGTTTGTGTCATGGATGTGACGATAGTCTGGGGATAATGGGGGGGATGCCTTTCCCCTTAATGTGCATCAAATGATGCAGGGTGCTGTAGTACAACAGGTGCTACTGAGGCACAAGTTGATTGTTTTGACATCCCAGATTTTGATATTCCTTGCAGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGTGAGTTGGCCACCAGGGGGCGCAGTTCTGCTAAGAAGTCTCAGTACCAGACAGGCTTTTACCTTGCCATTTCCCTTTTTCCCCTTCAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGA
  5   1   2   14  ext Te3  5g3  in                         CAAM9088.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TATACTTCCCAGGCTCCCCAGCAGCTGCAGTGTCTGCTTCCTTTATAGTCAGGAGAAATTAAAAGTCAACATTTGTGTAGGGGAGTAGGCTTAAAAAGTGTTTGTAGCGACTGTGTGGGTTGTGTCTAATGTATGCATGGGCTCCAGTGTTTGTGTCATGGATGTGATGATAGTCTGGGGATAATGGGGGGGATGCCTTTCCCCTTAATGTGCATCAAATGATGCAGGGTGCTGTAGTACAACAGGTGCTACTGAGGCACAAGTTGATTGTTTTGACATCCCAGATTTTGATATTCCTTGCAGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGTGAGTTGGCCACCAGGGGGCGCAGTTCTGCTAAGAAGTCTCAGTACCAGACAGGCTTTTACCTTGCCATTTCCCTTTTTCCCCTTCAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTGTTGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACAC
  3   1   4      seed Spl1 5g3  in                         CABK1975.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAGTCAACATTTGTGTAGGGGAGTAGGCTTAAAAAGTGTTTGTAGCGACTGTGTGGGTTGTGTCTAATGTATGCATGGGCTCCAGTGTNTGTGTCATGGATGTGACGATAGTCTGGGGATAATGGGGGGGATGCCTTTCCCCTTAATGTGCATCAAATGATGCAGGGTGCTGTAGTACAACAGGTGCTACTGAGGCACAAGTTGATTGTTTTGACATCCCAGATTTTGATATTCCTTGCAGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGTGAGTTGGCCACCAGGGGGCGCAGTTCTGCTAAGAAGTCTCAGTACCAGACAGGCTTTTACCTTGCCATTTCCCTTTTTCCCCTTCAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGAGGGAGATCTGTTCTCCTGGTGTCGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTGTCATTTAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCTGTGTGTACCCGTTGTGTATTATGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATGCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC
  3   1   2       ext Brn2      out                       CAAJ12433.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGTCTAATGTATGCATGGGCTCCAGTGTNTGTGTCATGGATGTGATGATAGTCTGGGGATAATGGGGGGGATGCCTTTCCCCTTAATGTGCATCAAATGATGCAGGGTGCTGTAGTACAACAGGTGCTACTGAGGCACAAGTTGATTGTTTTGACATCCCAGATTTTGATATTCCTTGCAGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGTGAGTTGGCCACCAGGGGGCGCAGTTCTGCTAAGAAGTCTCAGTACCAGACAGGCTTTTACCTTGCCATTTCCCTTTTTCCCCTTCAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTGTTGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTTATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC
  3   1   2       ext Te3  5g3  in                         CAAM9088.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTGAGGCACAAGTTGATTGTTTTGACATCCCAGATTTTGATATTCCTTGCAGATGCACACAGCAGACATTGGAGGCCAGGGTACCACCTCAGAAGTGGTGCAGTCCATCTGCAGGCAGATTATTGTAAAGAATGGCAGGGCTGTCACTGTCTGAGAGGTGAGTTGGCCACCAGGGGGCGCAGTTCTGCTAAGAAGTCTCAGTACCAGACAGGCTTTTACCTTGCCATTTCCCTTTTTCCCCTTCAGGATATGGGTGCCATGGGCTGGGCAGAACAATACAATGGAAGCCACCCATGCAGAAGAAACTGAGCATGCATACTCTGGGGTTGGAATGGTAGGGAGATCTGTTCTCCTGGTGTTGCACTGTTATCTTTCAGCTTGTGTGTAGTGACACACTGATTTAGTTTTTATCGTTAAATGCACTTTCCATCTCAGCCTGTGGCAGTTCTCATTGTGTGCTTATGCCTCACCAACACTCCGTGTGTACCTGTTGTGTATTGTGTGCCCACTGCTGGATCTGTACCTGGAGAACATGCAGTGCTGGTGAAGACCAAAGACACATTAGAAAATGGATGGTATAAGAGAGTATATACTATAATGTAAGAAAGGATGTTGAGCCCAGATTCACTGATGATGTTGTTATAAGAATAAGCTTATTTTCCAAACTATTCATGAATAAATATCTTGTTACACAGTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)