Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas136n06.3.5                       95 END     1           1        1                (no blast hit)
     2   2.0    0Xt7.1-TNeu113e09.3                         90 END     1           1        1                endoplasmic reticulum nucleotide sugar transporter [Silurana tropicalis]

 This cluster: approximate FL confidence score = 95%

 1012073151 Xt7.1-CAAR3160.3.5 - 98 ESTs
                                                                       ....-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAR3160.3.5                                                                                                                                       TGGGACTGTCTGCGCCGATATGGACGGGAAAATGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTACAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGACGGAAGCAGCTAAAAGAAACTTAATAAAGCTCAGAGGAGAATATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTCAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTCGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTCCTTTTAATATTCACCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTACAGACATATTTGGTGTTCCTAAGGACATATCTGAGAAAGCATGGGGGGGAAAAAATTCCAACCAGCAATAAAAAAAACCCAGACAGTCTCATGTAACAAGCCTACAAAATGATCAAAACTATTACTACTAAAATATTATTTAACACTAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTCTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTCTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTCAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTATTTATTTTCACGATATTAACAAACACTGTTAATATCACAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATGAACTTTTGGGTTTTTA
                                                  Xt7.1-CHK-1008223292                                                                                                                                             TGTCTGCGCCGATATGGACGGGAAAATGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTACAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGACGGAAGCAGCTAAAAGAAACTTAATAAAGCTCAGAGGAGAATATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTCAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTCGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTCCTTTTAATATTCACCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTACAGACATATTTGGTGTTCCTAAGGACATATCTGAGAAAGCATGGGGxxxAAAAAATTCCAACCAGCAATAAAAAAAACCCAGACAGTCTCATGTAACAAGCCTACAAAATGATCAAAACTATTACTACTAAAATATTATTTAACACTAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTCTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTCTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTxxxxxxATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTAxxxAxxTTCACGATATTAACAAACACTGTTAATATCACAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATGAACTTTTGGGxTTTTxATGTTC
                                                      consensus depths                                                                                                                                            2     2     5     6     8     8     8     9     8     9     8     9     8     9     9    10     9    11    10    11    10    11    12    12    11    12    11    12    11    12    11    12    12    12    12    12    12    12    12    12    12    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    12    13    11    13    11    13    11    12    11    12    11    12    11    12    11    11    11    11    11    11     9    11    10    11    10    11    10    11     9    11     9    11     9    11     9    11     9    11     9    11     7     9     7    10     9    10     8     9     8     9     7     8     8     9     7     9     7     7     6     8     8    10     8    10     8     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     9     9    10     8    10    10    11    10    11    10    11    10    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12     9    11    10    12     8    11     8    11     7    11     8    10     8    10     9    11    10    11    11    11    11    12    11    12    10    13    12    13    13    14    13    14    13    14    14    15    15    16    15    16    15    16    16    16    16    16    16    16    16    16    15    16    15    15    14    15    14    15    11    12     8    11     8    10     9     9     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    10     8    10     8     9     7     9     8    10     8    10     8    10     8    10     8    10     8    10     8    10     7     9     7     9     7     9     7     8     7     8     7     8     7     9     7     9     7     9     7     9     6     8     6     8     6     8     6     8     6     8     6     7     5     7     5     7     5     7     4     6     3     5     2     5     2     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     5     7     6     8     6     8     6     8     6     8     7     9     7     9     7     9     7     9     8    10     8    10     9    11     9    11     9    10     9    10     9    10     9    11     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    11    10    12    10    12    11    13    11    14    12    14    12    14    12    14    12    14    12    14    12    14    13    14    13    15    13    15    13    14    13    15    13    15    13    15    13    16    12    17    12    16    10    16     9    14     9    14    10    15     9    15     9    15     9    15     9    15    10    15    10    15     9    14     9    14     9    14     9    14     9    15    10    16    10    16    10    15    10    16    10    17    10    17    10    18    10    20    10    20    10    20    10    20    10    20    10    20    12    22    12    22    12    22    12    22    12    22    12    22    12    22    11    21    10    20    10    19    10    19    10    19    10    19    10    18    10    18    10    17    10    18    10    20     9    19     9    19     7    16     8    18     8    18     8    18     8    17    12    22    12    23    13    22    14    23    14    23    16    24    16    24    17    26    19    28    19    29    21    31    22    32    22    32    22    32    23    32    23    32    23    32    24    33    27    34    27    34    29    35    29    35    28    36    29    36    30    36    30    36    29    37    32    38    32    38    32    36    32    36    30    36    31    36    31    34    32    34    32    33    31    32    32    32    32    32    31    32    30    32    31    32    31    32    30    32    30    31    28    31    29    31    29    31    30    31    29    30    26    29    27    29    28    29    28    29    28    29    28    29    27    29    27    29    27    28    25    28    19    27    19    27    16    26    15    26    17    25    17    25    16    24    15    23    13    20     8    18     9    13
  5   1   2  SIG                                      Xt7.1-CAAR3160.3                                                                                                                                       TGGGACTGTCTGCGCCGATATGGACGGGAAAATGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTACAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGACGGAAGCAGCTAAAAGAAACTTAATAAAGCTCAGAGGAGAATATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTCAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTCGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTCCTTTTAATATTCACCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCCTACAGACATATTTTGGTGTTCCCTAAGGACATATGTGAGAAAGCATGGGGAAAAAATTCCAACCAGCAATAAAAAAAACCCAGACAGTCTCATGTAACAAGCCTACAAAATGATCAAAACTATTACTACTAAAATATTATTTAACACTAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTCTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTCTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTTTACTGCACCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGGATAGAAAAAAAAATCTTGTGTCTTAAAGGGGATGTATACCTTCTGATGCAGCTTTTAAACACTTATAAATGACTCATTTTTTCCCCTTTATTTTCACGATATTAACAAACACTGTTAATATCACAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATGAACTTTTGGGTTTTTA
  5   1   2                                           Xt7.1-XZG30225.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTACAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAAATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCAGCATGAGCAAGCAAGAATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATAAACTTTTGGGT
  5   1   2  SIG                                    Xt7.1-TTpA048m07.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTACAGACATATTTGGTGTTCCTAAGGACATATCTGAGAAAGCATGGGGAAAAAATTCCAACCAGCAATAAAAAAAACCCAGACAGTCTCATGTAACAAGCCTACAAAATGATCAAAACTATTACTACTAAAATATTATTTAACACTAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACAT------------------------------------------------------------------------------------------------------------------------CAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCTTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTTTTACTGCACCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGGATAGAAAAAAAAATCTTGTGTCTTAAAGGGGATGTATACCTTCTGATGCAGCTTTTAAACAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTATAAATGACTCATTTTTTCCCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGAT
                                                                   SNP                                                                                                                                                                                                                                                                                                   -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------A-----
                                               BLH ATG      19    1236                                                                                                                                       
                                               BLH MIN      19     260                                                                                                                                       
                                               BLH OVR      19      23                                                                                                                                       
                                               EST CLI       2      17                                                                                                                                       
                                               ORF LNG      19       4                                                                                                                                       
                                                                                                                                                                                                     PREDICTED - Sc ---- 4e-056     NP_009800.1 Hypothetical ORF; Ybr241cp [Saccharomyces cerevisiae] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Ce ---- 7e-101     NP_493981.1 solute carrier family 2 member (53.3 kD) (2B799) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 9e-123     NP_523878.1 Glucose transporter 1 CG1086-PB [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 4e-123     XP_794976.2 PREDICTED: similar to glucose transporter [Strongylocentrotus purpuratus] ---------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PROTEIN === Dr ==== 0          NP_001036186.1 solute carrier family 2 (facilitated glucose transporter), member 2 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN === Mm ==== 0          NP_112474.1 solute carrier family 2 (facilitated glucose transporter), member 2; liver-typeglucose transporter [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN === Hs ==== 0          NP_000331.1 solute carrier family 2 (facilitated glucose transporter), member 2 [Homosapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                PROTEIN === Gg ==== 0          NP_997061.1 solute carrier family 2 (facilitated glucose transporter), member 2 [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                PROTEIN === Xl ==== 0          AAH70704.1 MGC83262 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                PROTEIN === ?? ==== 0          NP_001084982.1 solute carrier family 2 (facilitated glucose transporter), member 2 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = Xt ==== 0          AAH88553.1 Hypothetical LOC496943 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAR3160.3.5                                                                                                                                                          ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------ATGATG------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------TGA------------------------------------------TAA---------------------------------------------------------TAG------------------------TAA---------------TGA------------------------------------------------------------------------------------TGA------------ATG------------------------------------------------ATGATG------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------ATG---ATG---ATGTAA------------ATG---------------------------------------------------TGA------------------TGA---------TAA------------------------------------------TAGTAG------------------------------------------------------TAA---------TGA------ATG------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------TAG------TGAATG------------------------------------TGA---------------------------TGA---------------TGA---------------TAA------TAA---------------TAG---------------------------------------------------------------------------ATG------------------------------------------------TAA------TGA---ATG------TGA------------------------------ATG------------------------------------------------------------------ATG---------------------ATG------------------------------TAA------------------------------TGA------ATG---TGA------------------TAA---------------------------------------------------------------------------------------------------------TAG------------TAA------------------------------------TAA---------------------------------------------TAG---------------------------------TAA------------------------------------------ATG------------ATG---------------------------------TAG---------------ATG---------------------------------------------------------------TAA---------------TGA---------------------------------------------------------------------------------------------------------TGA------------------ATG---------------------------------------TAA------------------------------TAA------------------ATG------ATG---------------------------------ATG---------------------------------------------TGA---TAA---------------------TAA------------------------------------------------------------TAG---------------------------------------------ATG------------------------------------------TAA------------------------------------------------------------------------------------------TGA---------------------------------------------TGATGA---------------------TAG---------------------TGA---------------------------------TAA------------------------------TGA------------------------------------------------ATG---------ATG---TAG---------------TGA------------------------------TAA------------ATG------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------TAA------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2  SIG                                      Xt7.1-CAAR3160.3                                                                                                                                       TGGGACTGTCTGCGCCGATATGGACGGGAAAATGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTACAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGACGGAAGCAGCTAAAAGAAACTTAATAAAGCTCAGAGGAGAATATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTCAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTCGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTCCTTTTAATATTCACCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCCTACAGACATATTTTGGTGTTCCCTAAGGACATATGTGAGAAAGCATGGGGAAAAAATTCCAACCAGCAATAAAAAAAACCCAGACAGTCTCATGTAACAAGCCTACAAAATGATCAAAACTATTACTACTAAAATATTATTTAACACTAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTCTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTCTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTTTACTGCACCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGGATAGAAAAAAAAATCTTGTGTCTTAAAGGGGATGTATACCTTCTGATGCAGCTTTTAAACACTTATAAATGACTCATTTTTTCCCCTTTATTTTCACGATATTAACAAACACTGTTAATATCACAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATGAACTTTTGGGTTTTTA
                                                  Xt7.1-CHK-1008279488                                                                                                                                             TGTCTGCGCCGATATGGACGGGAAAATGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTACAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGACGGAAGCAGCTAAAAGAAACTTAATAAAGCTCAGAGGAGAATATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTCAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTCGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTCCTTTTAATATTCACCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAxxxxxxCCTACAGACATATTTTGGxxxTxCCTAAGGACATATGTGAGAAAGCATGGGGAAAAAATTCCAACCAGCAATAAAAAAAACCCAGACAGTCTCATGTAACAAGCCTACAAAATGATCAAAACTATTACTACTAAAATATTATTTAACACTAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTCTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTCTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTTTACTGCACCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGGATAGAAAAAAAAATCTTGTGTCTTAAAGGGGATGTATACCTTCTGATGCAGCTTTTAAACACTTATAAATGACTCATTTTTTCCCCTTTATTTTCACGATATTAACAAACACTGTTAATATCACAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATGAACTTTTGGGTTTTTATGTTCC
  0   1   1           Neu  FL                     TNeu129o02.FL-Sanger                                                                                                                                      CTGGGACTGTCTGCGCCGATATGGACGGGAAAATGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTGCAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGGTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTTGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGACGGAAGCAGCTAAAAGAAACTTAATAAAGCTCAGAGGAGAATATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTTAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTCGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTCCTTTTAATATTCACCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTACAGACATATTTGGTGTTCCTAAGGACATATCTGAGAAAGCACGGGGAAAAAATTCCAACCAGCAATAAAAAAAACCCAGACAGTCTCATGTAACAAGCCTACAAAATGATCAAAACTATTACTACTAAAATATTATTTAACACTAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTCTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTCTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACCAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACGTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTTTACTGCACCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGGATAGAAAAAAAAATCTTGTGTCTTAAAGGGGATGTATACCTTCTGATGCAGCTTTTAAACACTTATAAATGACTCATTTTTTCCCCTTTATTTTCACGATATTAACAAACACTGTTAGTATCACAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAAAAAAAAAAAAAAA
  5   1   1           Gas1 FL                     IMAGE:6986700.FL-MGC                                                                                                                                                            GGACGGGAAAATGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTACAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGACGGAAGCAGCTAAAAGAAACTTAATAAAGCTCAGAGGAGAATATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTCAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTCGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTCCTTTTAATATTCACCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Neu  5x3  ?                     TNeu116e12.q1kT7                                                    AGTTCCAACAAAGACATTAAACTGCCTCTGGGCAATAATAAAAAAAAAAAAAAAAAAGCGGCCGCCCCGGGGAATCCCCGGGCTGGGACTGTCTGCGCCGATATGGACGGGAAAATGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTGCAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGGTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTTGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGACGGAAGCAGCTAAAAGAAACTTAATAAAGCTCAGAGGAGAATATGATCCAACAAAAGACATGAAGAGATGAAAAAAAAAAAAAAAAAA
  5   1   2       ext Neu  FL                        TNeu129o02.p1cSP6                                                                                                                                       TGGGACTGTCTGCGCCGATATGGACGGGAAAATGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTGCAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGGTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGAACTTTGCATC
  5   1   2   14  ext Brn3 5g3  in                          CAAK711.5p ........................................................................................................................................GGACTGTCTGCGCCGATATGGACGGGAAAATGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTACAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGCAGTGAGCATCTTGTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCCTCTTTTCTTTTGCCCTGAAAGCC
  5   1   2       add TbA  5x3  in                   TTbA077l16.p1kSP6                                                                                                                                           CTGTCTGCGCCGATATGGACGGGAAAATTGAAACAGCAGAAGAACTTGACCGGGACCCAGGTGTTTGCAGTCTTTACAGCTGTGTTGGCCTCACCGCAGTTCGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGGTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCATGACTGGTTCCCATGTATGTTGG
  5   1   2       add Gas7      in                         XZG20464.5p                                                                                                                                              GTCGGCGCCGATATGGACGGGAAAATGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTACAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAAGATTTCTGTTAATCAAACCTTGGGAAGACGGAAGCAGCT
  5   1   3   12   nb Gas7 5g3  in                         XZG28564.5p ..............................................................................................................................................TCTGCGCCGATATGGACGGGAAAATGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTACAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTG
  5   1   2       add Tbd0 5g                            IMAGE:6978961                                                                                                                                                     CCGGGATGGACGGGAAAATGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTACAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTTAGTCAGGTGGTTGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCATACCATCCTTCTTTTCCTTTGCCTGAAAAGCCCCAATTTCTGTTAATCAAACTTGGGAGACGGAACCGCTAAAGAAACTTAATAAACTCCGAGGAAATATGATCCAACAATTAATTGAAAGATGGAAAGGAAAGGA
  5   1   3        nb Gas1 FL                            IMAGE:6986700                                                                                                                                                            GGACGGGAAAATGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTACAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGACGGAAGCAGCTAAAAGAAACTTAATAAAGCTCAGAGGAGAATATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAGGAAGAGCTGAAGTGAAAGAAAGTTCCATCTACAGTTT
  5   1   2       ext Gas7      in                         XZG54815.5p                                                                                                                                                                        TGAAACAGCAGAAGAACTTGACTGGGACCCTGGTGTTTGCTGTCTTTACAGCTGTGTTGGCCTCACTACAGTTTGGATATGGTATCGGCGTCTCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTTGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGACGGAAGCAGCTAANAGAAACTTAATAAAGCTCAGAGGAGAATATGATCCAACANAAGACATTGAAGAGATGAANAAGGAAAAGGAGAAGCTGANAGTGAAAAGAAAGTTTCCATCATACAGTTATTCAAATCTTCTAATTACCGACAGCCTCTTGTAG
  5   1   4      seed Int1      in                         CAAP1416.5p                                                                                                                                                                                                                  CTTTACAGCTGTGTTGGCCTCACTACAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGACGGAAGCAGCTAAAAGAAACTTAATAAAGCTCAGAGGAGAATATGATCCAACANAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTCAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTCGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTTACCAGGGCAGGTATT
  5   1   3        nb Int1      in                         CAAP3256.5p                                                                                                                                                                                                                                    CTCACTACAGTTTGGATATGGTATCGGCGTCATCAATGCTCCTCAAAAGATTATTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATCAGACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTCGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGACGGAAGCAGCTAANAGAAACTTAATAAAGCTCAGAGGAGAATATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAG
  5   1   3        nb Neu       in                   TNeu072k13.p1cSP6                                                                                                                                                                                                                                                                          CTCCTCAAAAGATTACTTGAGAATCACTATACGCGGGTTTTACTGGAAGGCAGTGAAAATATACAGATACAACGCCTGTACAATCGTCTGTCAAGATGTATTGGTCCCTCTCTGTATCTGTGTTCTCCTTGGGTGGGATGGTGTCATCATTCTTCGTTGGATGGATTGCAGATAAACTCGGAAGGATTAAAGCCATGATGGTCGTAAACATTCTGGCAGTTATTGGGGCCCTTCTGATGGGGCTGGCTCCACTGGGTCAAGCGCACGCTCTTGTCATTGCTGGTAGATTAATCACAGGTCTTTACTGCGGTCTGGCATCAAGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTATGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAAGTGGTTGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTATGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGACGGAAGCAGCTAAAAGAAACTTAATAAAGCTC
  5   1   2       ext Gas7      in                         XZG51554.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCACAGGTCTTCCCTGCGGTCTGGCATCAGGACTGGTTCCCATGTATGTTGGAGAGATCTCCCCAACAGCACTTCGAGGAGCTTTAGGAACTTTGCATCAGTTGGCTATTGTCACAGGGATCCTGATTAGTCAGGTGGTTGGACTTGAATTTATTTTGGGCAGTGAGCATCTTTGGCCTGTTCTGCTAGGCCTGTCGGGAGTCCCTGCGGTTGTGCAGACCATCCTTCTTTTCTTTTGCCCTGAAAGCCCCAGATTTCTGTTAATCAAACTTGGGAAGACGGAAGCAGCTAAAAGAAACTTAATAAAGCTCAGAGGAGAATATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTCAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTCGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAAGTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGC
  5   1   3        nb Neu                            TNeu027i19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGGAACTTGGGAAGACGGAAGCAGCTAAAAGAAACTTAATAAAGCTCAGAGGAGAATATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTCAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTCGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTG
  5   1   3        nb Neu       in                   TNeu080e14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGAATATGATCCAACAAAAGACATTGAAGAGATGAAAAAGGAAAAGGAAGAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTTAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTCGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTG
  3   1   2       add Gas7      in                         XZG20464.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGAAAAAGGAAAAGGAAGAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTCAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTAGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGTAAGTGTGAATTTATTACTGAATATGTAATTAGAGAGGGAAATACTACAGATTTACAAGTAAATTATCTAATAAAGGATATTATATATGT
  3   1   3        nb Neu       in                    TNeu072k13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAAAAGGAAAAGGAAGAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTCAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTCGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATATTTGCTGTACTCCTTTTAATATTCACCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGGCTGAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7      in                         XZG44148.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGAAGAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTCAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTCGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTCCTTTTAATATTCACCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTG
  5   1   2       add Neu       in                   TNeu054h22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGCTGAAAGTGAAAAGAAAGTTTCCATCATACAGTTATTCAAATCTTCTAATTACCGACAGCCTCTTGTAGTTTCTCTCGTGCTTCATATCTCTCAGCAGTTTTCTGGAATCAATGGGATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTATCATTGGGATGTGTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTC
  5   1   2       add TpA       in                   TTpA051a09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCTTTTACTACTCTACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTCCTTTTAATATTCACCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAA
  3   1   3        nb Gas7      in                         XZG44148.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAAGCATTTTTACCAGGGCAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTCCTTTTAATATTCACCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAAGGTGTGCTTG
  3   1   3        nb Kid1      in                         CABA3485.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTCCTTTTAATATTCACCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCT
  5   1   3        nb Kid1      in                         CABA3485.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGTATTAGCCAACCAGTATATGCAACTATTGGCGTTGGTGCTGTCAACACAGTTTTCACAGTGGTTTCGGTGTTCCTTGTAGAGAAGGCGGGTAGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTCCTTTTAATATTCACCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCT
  5   1   2       ext Int1      in                         CAAP2096.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAAGATCCCTCTATCTGGTTGGCTTAGGAGGCATGTGTATCTGCGCTATAGTTATGACTATTGCATTGGCACTTTTGACTCAGCATGCTTGGATGAGTTACCTGAGTTTGGTCGCCATTTTCCTTTTTGTGGTTTTCTTTGAAGTTGGTCCAGGTCCTATTCCTTGGTTCATTGTTGCAGAATTGTTCAGTCAAGGCCCACGACCTGCAGCTATGGCGGTATCTGGGTGCTGTAACTGGACGTGCAACTTTATCATTGGGATGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTCCTTTTAATATTCACCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATAC
  3   1   2       add TbA  5x3  in                    TTbA077l16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCATTGGCACTTTTGAATCCAGCATGTTTGGGAGAGTTACCTGAGTTTGGTTGCCCTTTTCCTTTTTGAGGTTTTTTTTGAAGTTGGTCCAGGTCCTATTCCCTGGTTCATTGTTGCAGAATTGTTCAGTTAAGGCCCACGACCTGCAGGTATGGGGGTATTTTGGTGGTGTAACTGGACGTGCAACTTTATCATTGGGGAGGGTTTTGAGTACATAGCAGAAGCACGTGGGCCATAAATATTCATCATTTTGGCTGTAGTCCTTTTAATATTCACCGTTTTTCCCTATTTTAAAGTTCCTGAGACCTAGGGCAAGTCATTTCATGGGATAGGTTGTGAGTTTTGAAAGAAGAAAATTTCAACCCGCAAAGGATTTAAATTTATTGAAATGGAGTATTTGGGAACCAGTTCATAAGCATGGATATTTCCCGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACCTGATATCCCGGGTATTTCCCGACAAATGCAATGTTTTTTTTAGACATTTATTTTTATTTTGCTAAACTAAAGAAGGAAGGTGTGTTTGATAAAAAAAAAACAAAGAAAAAAAAAAAAAAAAAAGC
  5   1   3        nb Brn2                                CAAJ15290.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTGTTTCGAGTACATAGCAGATGCATGTGGGCCATATATATTCATCATTTTTGCTGTACTCCTTTTAATATTCACCCGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCCTAATC
  5   1   2       ext Neu       in                   TNeu087h22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTGCGAAGGGAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAGAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACGGGTGCGATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTGTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGAATGTTTGTGTTG
  5   1   3        nb Neu                            TNeu039i17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCAAGTCATTTGATGAGAAAGCTGCTGAGTTCCGAAAGAAAAATTTCAACCCGCAAAGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTT
  5   1   3        nb Liv1      in                         CAAR3160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCGATTCAATCGGCACGAGGCTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTACAGACATATTTGGTGTTCTAAGGACATATCTGAGAAAGCATGGGGAAAAAAT
  5   1   3        nb Neu       out                  TNeu113c09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAA
  5   1   2       ext HdA       in                   THdA043e08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGNTAGGGGGTTCTGGCATATCAACTGGTACAGATATCCTACAGACATATTTTGGTGTTCCTAANGACATATCTGAGAAAGCATGGGGGAAAAAATTCCAACCAGCAATAAAAAAAACCCAGACAGTCTCATGTAACAAGCCTACAAAATGATCAAAACTATTACTACTAAAATATTATTTTACACTAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCT
  5   1   3        nb Neu                            TNeu046c17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTANGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTAC
  5   1   2       ext Neu       in                   TNeu090a11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTACAGACATATTTGGTGTTCCTAAGGACATATGTGAGAAAGCATGGGGAAAAAATTCCAACCAGCAATAAAAAAAACCCAGACAGTCTCATGTAACAAGCCTACAAAATGATCAAAACTATTACTACTAAAATATTATTTAACACTAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTGCTAAAAAACTGGG
  5   1   3        nb Tbd0                               IMAGE:6981106                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACNGGGGAAAAAATTCCAACCAGCAATAAAAAAAACCCAGACAGTCTCATGTAACAAGCCTACAAAATGATCAAAACTATTACTACTAAAATATTATTTAACACTAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTCTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTCTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTTGACCAGTATGCACTGAAATCATCGTTTTTGGNAGTTAANCAGATACTGAATCCTCCCACAATGATTTAGCNACTCAACTTTGTTTTCTTCCTTCANGATATGCAAAAGAACCNACATGTTGTGTCCAACATGGGAAACCTTGC
  3   1   2       add TpA       in                    TTpA051a09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTTTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTTTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATTTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTTTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTTTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTTTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACCGTCATTCCAGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       add Gas7      in                         XZG38877.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTCTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTCTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGNGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATT
  3   1   2       ext Gas7      in                         XZG54815.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTCTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTCTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGGTACCTTGGTC
  3   1   3        nb Gas7 5g3  in                         XZG28564.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACATTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTCTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTCTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTC
  5   1   3        nb Neu                            TNeu095c23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTCTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTCTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGGAAC
  5   1   3        nb HdA       in                   THdA034p11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTGATCTCTTCTGTGAGATGAAGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAAGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTG
  5   1   2       ext Gas7      in                         XZG35763.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCATTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTCTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTCTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCCTT
  5   1   3        nb Gas7      in                         XZG37037.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTCTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTCTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACCAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGC
  5   1   3        nb TbA                            TTbA040h13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTTAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTTAGGGGACAGCATGTTTTCAGGCATTGCATTTCTTTTAGCACATATTTAATGTTATTAACAACCTTGCCAACAATGTATTGTCTACATGCATGGCAGGGAAAGAGTTAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACCAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACGTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTT
  5   1   3        nb Eye       in                         CCAX1307.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAATATGCAGCAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCTTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTTTACTGCACCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGGATAGAAAAAAAATCTTGTGTCTTA
  3  -1   3        nb Int1      in                        CAAP12774.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCTATAGGGCGAGAGGCTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTTTACTGCACCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGGATAGAAAAAAAAATCTTGTGTCTTAAAGGGGATGTATACCTTCTGATGCAGCTTTTAAACACTTATAAATGACTCA
  5   1   3        nb Tad5      in                          XZT8580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATAGGTATGCACTGAATAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCTTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTT
  3  -1   2       ext Tbd1      in                         CBXT3885.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGATCTAGAACATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTTTACTGCACCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGGATAGAAAAAAAAATCTTGTGTCTTAAAGGGGATGTATACCTTCTGATGCAGCTTTTAAACACTTAT
  3   1   3        nb Gas7      in                         XZG37037.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACGTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTTACTGCACCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGGAT
  5   1   2       add Tbd1      in                          CBXT698.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATACTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTTTACTGCAGCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGGATAGAAAAAAAATCTTGTGTCTTAAAGGGGATGTATACCTTCTGATGCAGCTTTTAAACACTTATAAATGACTCATTTTTTCCCCTTTATTTTCACGATATTAACAAACACTGTTAATATCACAAGGT
  5   1   3        nb Gas                            TGas037g02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTTAACCTCACGTCATTCCAAAAGACATTAGACTTTTGNTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTTTACTGCACCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGGATAGAAAAAAAAATCTTGTGTCTTAAAGGGGATGTATACCTTCTGATGCAGCTTTTAAACACTTATAAATGACTCATTTTTTCCCCTTTATTTTCACGATATTAACAAACACTGTTAATATCACAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGT
  5   1   2       add Gas1                               IMAGE:6987461                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAGGGCATGGGTACCGGGGTCCGGAATTCCNCGGGGGATCTGTTACACAAATTGGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTTTACTGCACCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGGATAGAAAAAAAAATCTTGTGTCTTAAAGGGGATGTATACCTTCTGATGCAGCTTTTAAACACTTATAAATGACTCATTTTTTCCCCTTTATTTTCACGATATTAACAAACACTGTTAATATCACAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAATTACTCNATAGTTATAGCTGATGCAGACAGGGGTGAACAGGCAGACAGAAATCTGCCATAAACTATC
  5   1   3        nb Gas                            TGas136a04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGGGGACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATT
  3  -1   2       ext Liv1      in                         CAAR3046.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTTTACTGCACCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGGATAGAAAAAAAAATCTTGTGTCTTAAAGGGGATGTATACCTTCTGATGCAGCTTTTAAACACTTATAAATGACTCATTTTTTCCCCTTTATTTTCACGATATTAACAAACACTGTTAATATCACAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAG
  5   1   2       ext Tad5      in                         XZT71573.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTTTACTGCACCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGGATAGAAAAAAAAATCTTGTGTCTTAAAGGGGATGTATACCTTCTGATGCAGCTTTTAAACACTTATAAATGACTCATTTTTTCCCCTTTATTTTCACGATATTAACAAACACTGTTAATATCACAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTC
  5  -1   3        nb Int1      in                        CAAP12774.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAGGGGATGTATACCTTCTGATGCAGCTTTTAAACACTTATAAATGACTCATTTTTTCCCCTTTATTTTCACGATATTAACAAACACTGTTAATATCACAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTG
  5   1   3        nb TpA                            TTpA077h09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCCTTCTGATGCAGCATTTTAAACACTTTATAAATGACTCATATTTTTCCCCGTTTATTTTCACGATATTAACAAACACATGTTAATATCACAAGTGGTGTAAAACGAGTGTCCAGTGTGCGTTCTGTCCAGGCATAAACCAGACAAAGGTTCAGAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAAGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAGACAGACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGT
  5   1   2       ext TpA       in                   TTpA077i09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCCTTCTGATGCAGCTTTTAAACACTTCTTATGACTCATTTTTTCCCCTTTATTTTCACGATATTAACAAACACTGTTAATATCACAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAGAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTGTTTATGTATTGTACTAAAGCATTANGGTGCATTCTGATGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAA
  5   1   3        nb Neu                            TNeu100i19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTTAAACACTTATAAATGACTCATTTTTTCCCCTTTATTTTCACGATATTAACAAACACTGTTAGTATCACAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATA
  3   1   2       add Neu       ?                     TNeu113e11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAAAAAAAAAAAAAA
  3   1   2       ext Int1      in                         CAAP2096.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTTTATTTTCACGATATTAACAAACACTGTTAATATCACAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGG
  3   1   3        nb HdA       in                    THdA034p11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAAAAAAAAAAAAAAAAAAAAGC
  3   1   4      seed Int1      in                         CAAP1416.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATGAACTTTTGGGTTAAA
  3   1   2       ext Neu       in                    TNeu090a11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATGAATCTTTTGGGTTTTTATTTCCACAAAAAAAAAAAAAAAAAA
  5  -1   2       ext Liv1      in                         CAAR3046.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTGTAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATGNCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTGCCACTCTTGCAGTGTCAGAGGGTATACATCCNCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATGAACTTTTGGGTTTTTATGTT
  3   1   3        nb Liv1      in                         CAAR3160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAAAACGAGTGTCCAGTGTGGTTCTGTCCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATGAACTTTTGGGTTAAAAAAAAC
  5   1   2       add Liv1      in                         CAAR7757.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTGTCCAGGCATAGACCAGACAAAGGTTCAGAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGAGTAATTTCTCAAGGGGGGGGTGAAACAAGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAAATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCAGCATGAGCAAGCAAGAATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATAAACTTTTTGGGTTTTTATGTTCCCACAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu       in                    TNeu080e14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAANATGAACTTTTGGGTTTTTATTTCCACAAAAAAAAAAAAAAAAAA
  3   1   2       ext Neu       in                    TNeu087h22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGCATAGACCAGACAAAGGTTCAAAAGTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGTTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAGATGAACTTTTGGGTTTTTATGTTCCACAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Tad5                                 XZT35490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTATTGCTGTAGGAAGCATCTCCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAAGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAAATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCAGCATGAGCAAGCAAGAATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAA
  3   1   0       chi Gas7      in                         XZG38877.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAATTTGAGTTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATGAACTTGAGAGAATTTGGTTTTATAAATATCCAGTTTCATTAATATTCCTTCTTGGTTTTTTTTACTGCACCATAGTATAAATCGTAGAAATTAAAGCTTTTGAGTAAGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAAATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCAGCATGAGCAAGCAAGAATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATAAACTTTTGGGTTTTTATGTTCCCC
  3   1   2       add Tbd1      in                          CBXT698.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTGATGCTTCTCTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGCAGACATACATAAAAATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGTAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATAAACTTTTGGGTTTTTATGTTCCACAAAAAAAAAAAAAAA
  3   1   2       add Liv1      in                         CAAR7757.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGAGTAATTTCTCAAGGGGGGGGTGAAACAAGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAAATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCAGCATGAGCAAGCAAGAATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATAAACTTTTGGGTTTTTATGTTCCAC
  3   1   2       ext Tad5      in                         XZT71573.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAAT
  3   1   2       ext Gas7      in                         XZG51554.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTACAGGAGAGTCCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATAAACTTTTGGGTTTTTATGTTCC
  3   1   3        nb Eye       in                         CCAX1307.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGTGGACACTTTCAGCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAAGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAAATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCAGCATGAGCAAGCAAGAATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATA
  3   1   2       add Neu       in                    TNeu054h22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCATCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAAGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAAATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCAGCATGAGCAAGCAAGAATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGGGGTAACATTTGTATATTTTTATGTAATTAAAATGACCGGTGGGGGTAAAAAATAAACTTTTGGGTTTTTAGTTCCAAAAAAAAAAAAAAAAAA
  5  -1   2       ext Tbd1      in                         CBXT3885.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAGTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATGAACTTTTGGGTTTTTATGTTCCACA
  3   1   2       ext TpA       in                   TTpA077i09.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTAATGTAATTTGCATTTGCACTCTTGCAGTGTCAGAGGGTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCCGCCAATAAAAATTATCAATTATTGTGATGATTTGTATGTTTTGAAACTGGGTAGCTGGGTGCGACAGTGTTATGGTGACATTCACCCTACTTCTTGGGAACCCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTATTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCCGGTGCCCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGATGCATGAGCAAGCAAGCATTCACTTCACAACAAAGCCTTACATTACACATATCCCAAATGTTCCACACTGGTTCAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACCTGTTTTTTTTATGTATGGTACTAAAGCATTAGAGGTGCATTCTGGTGAACTGTGTGGATACAGCGCTCAGTATTAATCATTTGTATATATTTTATGTAATTAAACATGAATTTTAAAAAAGATAAAAACTAAACTGTTTGGGTTTTTGTGTTCAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas7      in                         XZG35763.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGGGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGTTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGTTCATAAAATTACCCAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAAGGTAATGTATTATGTTATGAATTAGGGCAATTTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATTTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGGGCATATTTTTTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTTTGGTGAACTGTGGGGATACAGTGTCAGTATTAACATTTGTATATTTTTAGGTAATTAAAAGGAATTTAAATTAATAAAAAATGAACTTTTGGGTTTTTATGTTCCCCAAAAAAAAAAATT
  3   1   3        nb HeRe                             EC2CAA29BA11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAAATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTTTAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGAGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTA
  3   1   3        nb Int1      in                         CAAP3256.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAATTCTGCCAATAAAACTTTTCAATTATTGGGAGGATTTTTATCTTTTGTGACCGGGTAGCTGGGTGCGACAATGTTATGNTGACATTCCCCCTACTTTTTGGGAAACCAAGGGAATTAACGGGCTGTTCATAAAATTCCCCAGGGCAAAAGAGGTCCTTGGACTTTCTTGGGAGAAAGTTACAACTATACGGATAAAGTAATGTATTATGTTATGAATTAGGGCAATTTTTCCTGGGGACCCAAGGAGGGGGCGGACATACATAAAGATTAACTTTGCCCCCGTATGAGCACCCCCCGGTGTGTGCTGCATGAGCAAACAAACATTCCCTGCCCAACAAAGCCTTACATTACACATATCCCAAATTTTCCCCCCTGGTCCAATTTAAGAAACAAACAGGCGGGGATTTTTCAAAGAAGTTTTAGACATTTGGATTTTCCATTTCAGGGCATATTTTTTGGGAAAAATTATAAGGACCGTTTTTTTTATGTATTGTACTAAAGCATTAGGGGGCCTTTTGGTGAACTGGGGGGATACAGGGTCAGTATTAACATTTGTATATTTTTAGGGAATTAAAAGGAATTTAAATT
  3   1   2       ext Brn3 5g3  in                          CAAK711.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATGAACTTTTGGGTT
  3   1   2       ext HdA       in                    THdA043e08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAATTAAAAAAAAAAAAAAAAAAGCG
  3   1   3        nb Tad5      in                          XZT8580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAAGGAGGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAAATTAACTTAGCCCCTGTTTGAGCAGCCCCCGGTGTGTGCAGCATGAGCAAGCAAGAATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTAT
  5   1   2                                           Xt7.1-XZG30225.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTACAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAAATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCAGCATGAGCAAGCAAGAATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATAAACTTTTGGGT
                                                  Xt7.1-CHK-1008279496                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTACAGACATAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAAATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCAGCATGAGCAAGCAAGAATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATAAACTTTTGGGTTTTTAT
  5   1   4      seed Gas7      in                         XZG30225.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGTTTTCACATACTTTAAAGTTCCTGAGACCAAGGGCAAGTCATTTGATGAGATAGCTGCTGAGTTCCGAAAGAAGAAACTTTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCCTAC
  3  -1   2       ext Int1      in                        CAAP14976.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCAACCCGCAAAGGACTTAAATCTACTGAAATGGAGTATCTGGGAACCAGTTCAGAAGCATGAATATTTCCAGCAAGTGCAAAGAAGGAAAACAAAGTCATTTTATAAATATATATACATATACATGATATACAGGGTATTACCAGACAACTGCAATGTTTTTTATAGACATTTATTTTTATATTGCTAAACTAAAGAAGAAGGTGTGCTTGAGTTTGCAGAGTTTTTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTACAGACATATTTG
  5  -1   2       ext Int1      in                        CAAP14976.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACA
  3   1   4      seed Gas7      in                         XZG30225.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCTTTTCATCTTTCTTTTACTAATCTTTAATATCTCCAGATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAAGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAAATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCAGCATGAGCAAGCAAGAATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAATAAACTTTTGGGTTTTTATGTTCC
  5   1   2  SIG                                    Xt7.1-TTpA048m07.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTACAGACATATTTGGTGTTCCTAAGGACATATCTGAGAAAGCATGGGGAAAAAATTCCAACCAGCAATAAAAAAAACCCAGACAGTCTCATGTAACAAGCCTACAAAATGATCAAAACTATTACTACTAAAATATTATTTAACACTAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACAT------------------------------------------------------------------------------------------------------------------------CAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCTTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008279492                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTACAGACATATTTGGTGTTCCTAAGGACATATCTGAGAAAGCATGGGGAAAAAATTCCAACCAGCAATAAAAAAAACCCAGACAGTCTCATGTAACAAGCCTACAAAATGATCAAAACTATTACTACTAAAATATTATTTAACACTAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCT------------------------------------------------------------------------------------------------------------------------ATGCAGCAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCTTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAAAAAA
  3  -1   2       ext Int1      in                         CAAP6057.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTTTAAGGAAAAGTGTAAGAGACAGACGGGTGTCTAACCACAGTCCTTCAGCTGCTGTACAACTCCCATGATCCTTAGACAGGATGCTGACTAAAAATAATGAGAATGGCAGTTGTACAACAGCTTTAAAGCCAATGATGCAGTCTCTGTATTCAACATAACATAGCTTTGTTACTGGCCTATACAAGGAATGTTTGTGTTGCCGCAGGAGGCAGAGATATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTACAGACATATTTGGTGTTCCTAAGGACATATCTGAGAAAGCATGGGGAAAAAATTCCAACCAGCAATAAAAAAAACCCAGACAGTCTCATGTAACAAGCCTACAAAATGATCAAAACTATTACTACTAAAATATTATTTAACACTAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCT
  5   1   4      seed Liv1      in                        CAAR10323.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATCTTTCTACATCTGAAGATCTACAGTGTTGGAACCTGGGGATTATCCTGTGTCTGATAGAGAGCCTTCATCCCTATGTTTCTGCATTTGCCATGGTTTCTACCATGGTTCTACATATGCATATGAACATGTAAACAAGAGGGATTATGGTAAAAACACGGAATGGTAGGGTACTGAATCCATGGAAGGAAGCGGCAGTGTGACATTTCTGCCTTACAAAATGAGCACTAGGGTAAGGGTACTTTCAGAGCGTTTCTCTGAATCTCCTAATTCAATATTAGTAGGGTGTTCTGGCATATCAACTGGTACAGATATCCTACAGACATATTTGGTGTTCCTAAGGACATATCTGAGAAAGCATGGGGAAAAAATTCCAACCAGCAATAAAAAAAACCCAGACAGTCTCATGTAACAAGCCTACAAAATGATCAAAACTATTACTACTAAAATATTATTTAACACTAAAATGCAGGCTTCAGCGTCACACCTACTCAATTACAACACTGTACCTCTCCACAAGCTATTTTAATATTTTATAGTCAATATGAATGTGTGCTAGTGTTAACATATTGATCTCTTCTGTGAGATGAGGCTCAAAGCAGTTGAAAACATTCTGCTGAAATGACACATTCCCCTGACAGGAAAGTGTTTATTAACTTTGCTAAAAAACTGGGAATCTTTAGGATCCCTCAATTAGAACTTTAGTAAATCTGCCTTCCTGTAAACTGATATCTGCTGTATTATCGTTTTATAATATTATGGTGCACTATCATAGAAGAACAACTTGTGATTTAGCTAGACGTTCAGTTTAAAAGTGCTGATTGATGAAGAACTGATTGACCAGTGACCAAGATGTAAGTAGCTGTATGCTCATCTTTACATTGCTT
  5   1   2       ext Tad5                                  XZT7167.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATGCAGCAGCAAAGGACTCAACTAGAACTTGACTAGGTATGCACTGAATCAATCGTTTTTGGAGTTAACCAGATACTGAATCCTCCACAAATGATTTAGCACTCAAACTTTGTTTTCTTCCTTCAAGATATTGCAAAAGAAACCCACATGTTGTGTCCCACATTGGGAAACACTAGGCCATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCTTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAAGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGA
  5   1   2       ext Gas                            TGas005b04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATAAACCACTAATGCTTTATTATATGTTTATGCAATGCCATAAAGGAATAAAAAATACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCTTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAAGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCAT
  5   1   2       ext TpA       in                  TTpA048m07.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGCCATAAAGGAATAAAAAAGTACCTTGGTCATTTTAACCTCACGTCATTCCAAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACGTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCANATGATGTCATTGGACTTACTTGGTAGAAAGNNTACACTATACTGATAATGTAATNNGTATATGTATGAA
  5   1   3        nb Gas                            TGas134a07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAAAAAAGACCTTGGTCTTTTACCTCCGTCTTCCAGAGACATTAGACTTTTGTCATTAATTGTGAAAAGACTGTTTTCTAAACATCTCATCTGGTATCTGTTACACAAATTGGCCTTACCCCGATGGGCCTTGTATTGATGCCTCTAGTGATACAAAAAACTTATTTATATAAATAGTCAAAAACACTAATAATGGGTATCAGCACATTATATTTAAATATACATGTAGCCTTTTTCATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGAT
  5  -1   2       ext Int1      in                         CAAP6057.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCTTTCTTTTACTAATTCTTTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAG
  3   1   4      seed Liv1      in                        CAAR10323.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAATTCTNTAATATTCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATT
  3   1   3        nb Tad5                                 XZT19702.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTCCAGAATTTTGAGTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTT
  3   1   2       ext TpA       in                   TTpA048m07.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTCAGACAGTGCTAGAACTCATAGCATTCTGTAAAAGACAGTGGTTAAGGAGAAACCTTTATAATTTTTCAGTGACATACCCCACCTACAGCACTGACACATCATGAAGTTTTAACTTGTTATACATCCCCCTTGAGAAATTACTCATTAGTTATAGCTGATGCAAGACAGGGGTGAAACAGGCAGACAGGAAATTCTGCCAATAAAACTTATCAATTATTGTGATGATTTCTATGTTTTGTGACTGGGTAGCTGGGTGCGACAGTGTTATGCTGACATTCACCCTACTTCTTGGGAAACCAAGGGAATTAACGGACTGATCATAAAATTACACAGGGCAAATGATGTCATTGGACTTACTTGGTAGAAAGTTACAACTATACTGATAATGTAATGTATTATGTTATGAATTAGGGCAATCTTTCCTGGTGACCCAATGAGTGTGCAGACATACATAAAGATTAACTTAGCCCCTGTATGAGCAGCCCCCGGTGTGTGCTGCATGAGCAAGCAAGCATTCACTGCACAACAAAGCCTTACATTACACATATCCCAAATCTTCCACACTGGTACAATATAAGAAACAAACAGGCTGTGATTTTTCAATGAAGTTTTAGACATTTGGATTTTACATTTCAGTGCATATTTTCTGTGAAAAATTATAAGGACTGTTTTTTTTATGTATTGTACTAAAGCATTAGGGTGCATTCTGGTGAACTGTGTGGATACAGTGTCAGTATTAACATTTGTATATTTTTATGTAATTAAAATGAATTTAAATTAATAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)