Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012073314 Xt7.1-TGas128n17.3 - 35 ESTs
                                                                       .-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas128n17.3                                                                        TAAGAGTGTGTTTTGCAAAGAATCTTTAAGAATTATCTAACCATCAAAAGACTCCTGCACAGAGATCCAGGAACCTACTATATGGAGGAGGTGCTTAAAAAGTTTTGGAAAGTAGAGAGTTAACATATAACTGACTCAACTCTGATCAAACAGGGATCCCTGTTAGCCCTGGCAAACATAGGGTTATTGAAGGACTGGGCTAAAAGTATTACTGTGTTGGTCTCTTAGGCATAAGCATTTCTGGGAAAGTTTTACCAGGTGTGGATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTCAAAAAATACTAGTGTATTTCTTTTTGCTTGCATAACATATTTGATTTACCAAGGAAGGCAAAGTATACTTTTTTACTGCAAAGAAAACTAAAGAGTTCTTTCAGCCATGCCATGGTCACCTTTTGCCCTATAAATAACATTGGCATTAAGCAGCATGTGAACTTTAAAGTGACACTAAAAAAAACTACTCTTCAAAATTTGAATTATTATTGAATGTGAATAATTGTGTATATAATATACCCCTTTTTTGTCTTTTCGGTGTATTGGAATAAGATACTTGGCTGCTTGTTTGTTTGGCTAAAGAAAGGAAGCAATAGATTTGTTGTAATTAAAGCAATAT
                                                  Xt7.1-CHK-1008227454                                                                              TGTGTTTTGCAAAGAATCTTTAAGAATTATCTAACCATCAAAAGACTCCTGCACAGAGATCCAGGAACCTACTATATGGAGGAGGTGCTTAAAAAGTTTTGGAAAGTAGAGAGTTAACATATAACTGACTCAACTCTGATCAAACAGGGATCCCTGTTAGCCCTGGCAAACATAGGGTTATTGAAGGACTGGGCTAAAAGTATTACTGTGTTGGTCTCTTAGGCATAAGCATTTCTGGGAAAGTTTTACCAGGTGTGGATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTCAAAAAATACTAGTGTATTTCTTTTTGCTTGCATAACATATTTGATTTACCAAGGAAGGCAAAGTATACTTTTTTACTGCAAAGAAAACTAAAGAGTTCTTTCAGCCATGCCATGGTCACCTTTTGCCCTATAAATAACATTGGCATTAAGCAGCATGTGAACTTTAAAGTGACACTAAAAAAAACTACTCTTCAAAATTTGAATTATTATTGAATGTGAATAATTGTGTATATAATATACCCCTTTTTTGTCTTTTCGGTGTATTGGAATAAGATACTTGGCTGCTTGTTTGTTTGGCTAAAGAAAGGAAGCAATAGATTTGTTGTAATTAAAGCAATATGCAAAA
                                                      consensus depths                                                                             2     2     2     2     2     2     4     4     5     5     5     5     5     5     5     5     5     5     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     8     8     9     8     9     8    10     9    11    10    13    11    13    13    15    15    15    15    15    15    15    15    15    16    16    16    16    17    17    18    18    19    22    20    22    20    22    21    23    24    25    28    29    26    29    29    29    29    29    30    32    32    32    31    31    32    32    32    32    32    32    32    32    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    30    30    30    30    31    31    31    31    31    31    30    30    30    30    30    30    30    30    28    29    28    29    28    29    28    29    27    28    26    26    24    24    23    24    23    23    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    23    24    24    24    24    24    22    22    22    22    22    22    22    22    21    22    21    21    21    21    20    20    20    20    20    20    19    19    18    19    18    19    18    19    18    19    18    18    14    16     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     326     255                                                                        
                                               BLH MIN     326      82                                                                        
                                               BLH MPR      47      82                                                                        
                                               BLH OVR     326     715                                                                        
                                               CDS MIN     326      82                                                                        
                                               ORF LNG     326      27                                                                        
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ci ==== 9e-012     CAB56042.1 glycine rich RNA binding protein [Ciona intestinalis] ====================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Sc ---- 1e-016     NP_012266.1 contains one RNA recognition (RRM) domain; Sgn1p [Saccharomyces cerevisiae] =============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 2e-043     NP_492504.1 poly binding protein II like (22.6 kD) (1J998) [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 6e-047     NP_476902.1 CG2163-PA [Drosophila melanogaster] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 8e-048     XP_799120.1 PREDICTED: similar to polyadenylate-binding protein nuclear 1 [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dr ---- 1e-053     NP_998424.1 polyadenylate-binding protein nuclear 1 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Gg ---- 2e-054     XP_001232211.1 PREDICTED: similar to Pabpn1-prov protein [Gallus gallus] ----------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                         PROTEIN --- Mm ---- 3e-057     NP_062275.1 poly(A) binding protein, nuclear 1; poly(A) binding protein II [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                             PROTEIN --- Hs ---- 2e-057     NP_004634.1 poly(A)-binding protein, nuclear 1; poly(A) binding protein II; oculopharyngealmuscular dystrophy; poly(A) binding protein 2 [Homo sapiens] ---------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Xl ==== 2e-120     AAO33927.1 putative polyA-binding protein PABPN2/ePABP2 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = ?? ==== 2e-120     NP_001082505.1 putative polyA-binding protein PABPN2/ePABP2 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 9e-126     AAI21547.1 Poly(A) binding protein, nuclear 1 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas128n17.3                                                                                                  TAA------------------------------------------------------------------TAA---------------------------------TGA------------------------------------------------------------------TAA---------------------------------------------------------------TAA---------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------TGAATG------------TAG---------------------------------------ATG------------------------TGA---------ATG------TAG---------ATGTAA------------------------------ATG---------------------------------------------------------------TAA---------------------------------TAA------------------------------------TAG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------TGAATGTGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  0   1   1           Ovi1 FL                          CABI8970.FL-MGC                                                                                                                             CCTGCACAGAGATCCAGGAACCTACTATATGGAGGAGGTGCTTAAAAAGTTTTGGAAAGTAGAGAGTTAACATATAACTGACTCAACTCTGATCAAACAGGGATCCCTGTTAGCCCTGGCAAACATAGGGTTATTGAAGGACTGGGCTAAAAGTATTACTGTGTTGGTCTCTTAGGCATAAGCATTTCTGGGAAAGTTTTACCAGGTGTGGATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTCAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg040j12.FL-Sanger                                                                                                                                                                                                                                                                                                                                                ATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTCAAAAAATACTAGTGTATTTCTTTTTGCTTGCATAACATATTTGATTTACCAAGGAAGGCAAAGTATACTCTTTTACTGCAAAGAAAACTAAAGAGTTCTTTCAGCCATGCCATGGTCACCTTTTGCCCTATAAATAACATTGGCATTAAGCAGCATGTGAACTTAAAAGTGACACTAAAAAAAACTACTCTTCAAAATTTGAATTATTATTGAATGTGAATAATTGTGTATATAATATACCCCTTTTTTGTCTCTTCGGTGTATTGGAATAAGATACTTGGCTGCTTGTTTGTTTGGCTAAAGAAAGGAAGCAATAGATTTGTTGTAATTAAAGCAATATGCAAAAAGTATGTTTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g                        TGas044h13.p1kSP6 CCCCGGNGCCCGGGNGCCCGGGGGGCTTTTCATTAAGGCAGTTTCTATCCAGATTGCTCTTTAGGTTAAATTAAGAGTGTGTTTTGCAAAGAATCTTTAAGAATTATCTAACCATCAAAAGACTCCTGCACAGAGATCCAGGAACCTACTATATGGAGGAGGTGCTTAAAAAGTTTTGGAAAGTAGAGAGTTAACATATAACTGACTCAACTCTGATCAAACAGGGATCCCTGTTAGCCCTGGCAAACATAGGGTTATTGAAGGACTGGGCTAAAAGTATTACTGTGTTGGTCTCTTAGGCATAAGCATTTCTGGGAAAGTTTTACCAGGTGTGGATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCNCCTCGGCCTCTGAGTGC
  5   1   2   10  bld Ova1 5g3  in                         CABE6574.5p .......................................................................TAAGAGTGTGTTTTGCAAAGAATCTTTAAGAATTATCTAACCATCAAAAGACTCCTGCACAGAGATCCAGGAACCTACTATATGGAGGAGGTGCTTAAAAAGTTTTGGAAAGTAGAGAGTTAACATATAACTGACTCAACTCTGATCAAACAGGGATCCCTGTTAGCCCTGGCAAACATAGGGTTATTGAAGGACTGGGCTAAAAGTATTACTGTGTTGGTCTCTTAGGCATAAGCATTTCTGGGAAAGTTTTACCAGGTGTGGATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTAC
  5   1   2   10  bld Ova1 5g3  in                         CABE8459.5p ........................................................................................................TATCTAACCATCAAAAGACTCCTGCACAGAGATCCAGGAACCTACTATATGGAGGAGGTGCTTAAAAAGTTTTGGAAAGTAGAGAGTTAACATATAACTGACTCAACTCTGATCAAACAGGGATCCCTGTTAGCCCTGGCAAACATAGGGTTATTGAAGGACTGGGCTAAAAGTATTACTGTGTTGGTCTCTTAGGCATAAGCATTTCTGGGAAAGTTTTACCAGGTGTGGATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAAACATTAGGTCCTACCCCAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGAC
  5   1   2   10  bld Lun1 5g3  in                         CABD2495.5p ...........................................................................................................CTAACCATCAAAAGACTCCTGCACAGAGATCCAGGAACCTACTATATGGAGGAGGTGCTTAAAAAGTTTTGGAAAGTAGAGAGTTAACATATAACTGACTCAACTCTGATCAAACAGGGATCCCTGTTAGCCCTGGCAAACATAGGGTTATTGAAGGACTGGGCTAAAAGTATTACTGTGTTGGTCTCTTAGGCATAAGCATTTCTGGGAAAGTTTTACCAGGTGTGGATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCTCAGAGAACGAACATGCCANGAATTAGTACCACAGACA
  5   1   2       bld Ovi1 FL   in                         CABI8970.5p                                                                                                                   CATCGATTCGCCTGCACAGAGATCCAGGAACCTACTATATGGAGGAGGTGCTTAAAAAGTTTTGGAAAGTAGAGAGTTAACATATAACTGACTCAACTCTGATCAAACAGGGATCCCTGTTAGCCCTGGCAAACATAGGGTTATTGAAGGACTGGGCTAAAAGTATTACTGTGTTGGTCTCTTAGGCATAAGCATTTCTGGGAAAGTTTTACCAGGTGTGGATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGNGTGGGTTCCGTGGCAGACCTCGAGGAAACAG
  5   1   2   10  bld Ova1 5g3  in                         CABE6946.5p ...................................................................................................................................................................................AAAGTAGAGAGTTAACATATAACTGACTCAACTCTGATCAAACAGGGATCCCTGTTAGCCCTGGCAAACATAGGGTTATTGAAGGACTGGGCTAAAAGTATTACTGTGTTGGTCTCTTAGGCATAAGCATTTCTGGGAAAGTTTTACCAGGTGTGGATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTTAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAA
  5   1   2       bld Te5       in                         CAAO8792.5p                                                                                                                                                                                                        AACTGACTCAACTCTGATCAAACAGGGATCCCTGTTAGCCCTGGCAAACATAGGGTTATTGAAGGACTGGGCTAAAAGTATTACTGTGTTGGTCTCTTAGGCATAAGCATTTCTGGGAAAGTTTTACCAGGTGTGGATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAG
  5   1   2       bld Gas  5g3  in                   TGas128e19.p1kSP6                                                                                                                                                                                                                                                             TGCATTTTTACTAATTGCTAATTAGACAAACAGGTATGGGATTTATCTGAAATGATGGAGACTTGTGCTTTTACAGGTGTGGATTAAAACAAGGTGTGTGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCACGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATT
  5   1   2   10  bld Ova1 5g3  in                         CABE6761.5p ............................................................................................................................................................................................................................................................................CGAGGAAAGTATTACTGTGTTGGTCTCTTAGGCATAAGCATTTCTGGGAAAGTTTTACCAGGTGTGGATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCCTGACAGAGGATGGAGAATGCTTCATCATGATTTATC
  5   1   2   12  bld Gas7 5g3  in                         XZG65825.5p ...................................................................................................................................................................................................................................................................................................GGGATTTATCTGAAATGATGGAGACTTGTGCTTTTACGGTGTGGATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGGTATATTGTGAAAACCCAGAT
  5   1   2   10  bld Ova1 5g3  in                         CABE4535.5p .......................................................................................................................................................................................................................................................................................................................CTGGGAAAGTTTTACCAGGTGTGGATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCCGGCCCTGCATGAAATTGATACCTTC
  5   1   2   34  bld Te5  5g                             CAAO11042.5p ............................................................................................................................................................................................................................................................................................................................CTGTTGCTTTCAGGTGTGGATTAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGANATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTNGATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATC
  5   1   2       bld Gas  5g3  in                   TGas128n17.p1kSP6                                                                                                                                                                                                                                                                                                                              TTGTGCTTTTCAGGTGTGGATTAAAAAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCA
  5   1   2       bld Egg  FL   in                   TEgg040j12.p1kSP6                                                                                                                                                                                                                                                                                                                                                  TAAAACAAGGTGTGGGAGAACCACATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGC
  5   1   2   10  bld Ova1 5g3  in                        CABE12844.5p .........................................................................................................................................................................................................................................................................................................................................................CCGAGGCCTCGTGCCGATTTTTTTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCACATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTG
  5   1   2       bld Ova1      in                         CABE6150.5p                                                                                                                                                                                                                                                                                                                                                                                                                   TGAGAGAGTTTCAGAAGAACCGAGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAACCTATTTTATGTTCATGTACTGCATTATGTTGGGTACTAAAATA
  3   1   2       bld Gas  5g3  in                    TGas128e19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCTTGGATAAAGGGGATGGAGCTGAAGAGTGTGACTTGANTGATCNTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACCAATTGTGGTGCTTTCAGGCCCTTGTCAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2      seed Gas  5g3  in                    TGas128n17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGGGGATGGAGCTGAAGAGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTGTCAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE6150.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGCTGAAGAGTGTGACTTGATGATCCTGAATAAAAGCCATCAGAATGCGAGTGCGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTC
  3   1   2       bld Ova1 5g3  in                        CABE12844.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAGTGTGACTGGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGAAAATGGAGGAGGAGGCAGAGCGCTGAAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCACATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACCAATTGTGGTGCTTTCAGGCCTTGTC
  3   1   2       bld Gas       ?                     TGas105d13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTGTGACTTGGATGATCCTGAATTAAAAGCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTTTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTTTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGaaaaaaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Gas7 5g3  in                         XZG65825.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGTGTGACTTGGATGATCCTGAATTAAAGCCATCAGATGCGAGTGCGGAAATGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTCAAAAAAAAAAAAAAAG
  3   1   2       bld Ova1 5g3  in                         CABE6761.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCATCAGAATGCGAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTC
  3   1   2       bld Ova1 5g3  in                         CABE6574.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGTGCGGGAAATGGAGGAGGAGGCAGAGCGCCTGAAGGNGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTC
  3   1   2       bld Ova1 5g3  in                         CABE4535.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTGCNGGAAATGGAGGAGGAGGCAGAGCGCCTGAGGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTC
  3   1   2       bld Ova1      in                         CABE2784.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGGAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGGCTTTC
  3   1   2       bld Ova1 5g3  in                         CABE8459.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTC
  5   1   2       bld Ova1      in                         CABE2784.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGCAGAGCGCCTGAAGGGGTCATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATNTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAAAAAAAAAAAAA
  3   1   2       bld Ovi1 FL   in                         CABI8970.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGCAGAGCGCCTGAAGGGGTTATCTGGAGAGGATAAGAGTATTGGAGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTC
  5   1   2       bld Ova1      in                         CABE4575.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCATCGATTCGTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAACCCCCAGATGGCACCAAGACGATGTT
  3   1   2       bld Te5       in                         CAAO8792.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTTAGTTCCAGGCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTCCCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTC
  3   1   2       bld Lun1 5g3  in                         CABD2495.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTTAGTTCCAGCCCCTGCATGAAATTGATACATTCGAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTC
  3   1   2       bld Ova1      in                         CABE4575.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGATGACAGCAGGAGCATATACTGAGGGTCCCCCTCGGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAGCGATCAGTTTATGTTGGTAATGTGGATTACGGAGGTACAGCTCAGGATCTGGAGGCGCATTTTAGTAGCTGTGGTTCAATCAATCGCATCACTATTCTATGTGACAAATTCTCTGGACATCCAAAGGGATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTC
  3   1   2       bld Egg  FL   in                    TEgg040j12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATATGCATATATTGAGTTTGCAGAGAGGAACTCTGTAGATGTTGCAGTGGCAATGGATGAAACTGTATTCCGAGGACGAACAATTAAGGTCCTACCCAAGAGAACGAACATGCCAGGAATTAGTACCACAGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGAAACAGAGGAAATTACCAGAGAGGACAAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTCAAAAAATACTAGTGTATTTCTTTTTGCTTGCATAACATATTTGATTTACCAAGGAAGGCAAAGTATACTCTTTTACTGCAAAGAAAACTAAAGAGTTCTTTCAGCCATGCCATGGTCACCTTTTGCCCTATAAATAACATTGGCATTAAGCAGCATGTGAACTTAAAAGTGACACTAAAAAAAACTACTCTTCAAAATTTGAATTATTATTGAATGTGAATAATTGTGTATATAATATACCCCTTTTTTGTCTCTTCGGTGTATTGGAATAAGATACTTGGCTGCTTGTTTGTTTGGCTAAAGAAAGGAAGCAATAGATTTGTTGTAATTAAAGCAATATGCAAAAAGTATTTTAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1 5g3  in                         CABE6946.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGACCGAGAGGAAGGCCTTTCAGAGGTCGTGGAAGACCAGGTCCATTGAATAACCCCTACTGAATGAAAAGAGCCTTGTAGCTCTATGTGCACTTCATATACCTGACAAGAGGATGGAGAATGCTTCATCATGATTTATCTTCCACCTGAGGATGCTCTATGTATGTCTAGGCCAAAGAAATGTAATATTGTGAAAACCCAGATGGCACCAAGACGATGTTATGGGGATTTTGTGCTACTGAACTACAGTATGTAAATAGCTCTGTCCTAGAAAAACCTATTTAATGTTCATGTACTGCATTATGTTGGTTACTAAAATAAACAATTGTGGTGCTTTCAGGCCTTGTCAAAAAATACTAGTGTATTTCTTTTTGCTTGCATAACATATTTGATTTACCAAGGAAGGCAAAGTATACTTTTTTACTGCAAAGAAAACTAAAGAGTTCTTTCAGCCATGCCATGGTCACCTTTTGCCCTATAAATAACATTGGCATTAAGCAGCATGTGAACTTTAAAGTGACACTAAAAAAAACTACTCTTCAAAATTTGAATTATTATTGAATGTGAATAATTGTGTATATAATATACCCCTTTTTTGTCTTTTCGGTGTATTGGAATAAGATACTTGGCTGCTTGTTTGTTTGGCTAAAGAAAGGAAGCAATAGATTTGTTGTAATTAAAGCAATATGCaaaaattaaaaaaaaaaaaaaaaaaaagaaaaaaaaaaaaaC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)