Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TNeu091k05.3                          5 END     1           1       20                similar to KIAA1645 protein [Gallus gallus]

 This cluster: approximate FL confidence score = 98%

 1012073386 Xt7.1-XZG47763.3.5 - 70 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZG47763.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACGCGTGTACCCTCATTTCCCATCCCAGCACCGACACACACTGGATTCCTTATAAAGTGACACCTCTGGGAGACAGAGCGCTACATACTCGCCATCTGCTGCTTTTTTCTCTTCTGATTTCCTTTCCTTTGGGTTCACGAGCAGAGAGAGAATTAGAGACATAGCTGGAATTATTGCTTGGACTCGGGATTGACAGAATAAACCATATCGCCAAGTATTTGGATTTTTGTATTCCTAATGGACCTGGTAATGAATTGACACCAACTGGATTGAGAGAAGCTAAAGTTGCACAGTCGAATTGCGCGCAGCCTTTACCTGGGGCCAATCCTAACCTTTCATAGGTTTTTTTTTACTGCAATTCAGAAAGTCTGTCACTCTATGAAAGGGCGGATCTAAAGAGAAGCTTGAAGAAAGAAAGCAGATCCCTGACTACTGCAGTGTAGTTTGGGACAAGCCGCTTTGCGCCTTGTGCCTTGTAGCGCTATCGCACCGGCAAGTGCTGCGAGGCATATCAGCCAACATGGGACAGCAATGCATGCTGACTCTCCTCGTCCTCTTCGCCGTACTCTGTCAGATATCCTGCTCCGGACTTTTCGAACTCAGGCTGCAGGAGTTTTTAAATAAGAAGGGGCTGCTCGGAAATATGAACTGCTGCAGACCTGGATCGCTTGGCACTTTGCAGCGGTGCGATTGCAAGACCTTCTTCAGAATCTGCCTTAAACACTATCAAAGCAACGTGTCTCCGGAGCCTCCATGTACATACGGCAGCGCGGTTACCCCTGTATTGGGCACCAACTCCTTCGTTGTACCGGAGAGCAGCAGTTCGGACCCCACTTTCAGCAATCCTATTCGATTCCCTTTTGGATTCACATGGCCTGGTACCTTTTCCCTTATCATTGAAGCAATACATGCGGATTCTGCTGATGATTTAAACACAGAGAACCCAGAACGTCTCATTAGTCGCCTTGCCACCCAACGTCACCTTACCGTTGGAGAGCAGTGGTCCCAAGATTTGCACAGCAGTGACCGGACAGAACTGAAATATTCCTACCGCTTTGTATGTGATGAACACTACTACGGGGAAGGCTGCTCTGACTACTGCCGTCCCAGAGATGATGCTTTTGGTCATTTTTCCTGCGGTGAAAAAGGAGAGAAATTGTGCAACCCTGGATGGAAGGGCCTGTACTGCACAGAACCAATTTGTTTGCCTGGATGTGATGAACATCATGGATATTGTGACAAGCCTGGGGAATGCAAATGCAGAGTTGGTTGGCAAGGCCGATACTGTGATGAATGCATTCGTTACCCAGGGTGCCTGCATGGCACCTGCCAGCAACCATGGCAATGCAACTGCCAAGAAGGCTGGGGAGGACTTTTCTGTAACCAAGATCTTAACTACTGCACCCACCACAAGCCATGCAAAAATGGAGCCACATGCACCAACACTGGCCAAGGAAGCTACACTTGCTCCTGCCGTCCTGGGTACACTGGCTCCAACTGTGAAATCGAAATCAATGAATGTGATGCAAACCCTTGCAAGAATGGAGGCAGCTGCACTGACCTGGAAAACAGCTATTCATGTTCCTGCCCACCAGGCTTCTATGGCAAAAACTGTGAACTCAGTGCTATGACCTGCGCCGATGGCCCATGCTTTAATGGAGGCCGGTGCTCTGACAACCCAGATGGCGGATATATCTGTTTCTGCCCAGTGGGTTACTCGGGATTTAACTGTGAGAAGAAAATTGATTACTGCAGCTCGAATCCTTGTGCCAACGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAATAAAAAAAAAATCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATATTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAA
                                                  Xt7.1-CHK-1008224363                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTACCCTCATTTCCCATCCCAGCACCGACACACACTGGATTCCTTATAAAGTGACACCTCTGGGAGACAGAGCGCTACATACTCGCCATCTGCTGCTTTTTTCTCTTCTGATTTCCTTTCCTTTGGGTTCACGAGCAGAGAGAGAATTAGAGACATAGCTGGAATTATTGCTTGGACTCGGGATTGACAGAATAAACCATATCGCCAAGTATTTGGATTTTTGTATTCCTAATGGACCTGGTAATGAATTGACACCAACTGGATTGAGAGAAGCTAAAGTTGCACAGTCGAATTGCGCGCAGCCTTTACCTGGGGCCAATCCTAACCTTTCATAGGTTTTTTTTTACTGCAATTCAGAAAGTCTGTCACTCTATGAAAGGGCGGATCTAAAGAGAAGCTTGAAGAAAGAAAGCAGATCCCTGACTACTGCAGTGTAGTTTGGGACAAGCCGCTTTGCGCCTTGTGCCTTGTAGCGCTATCGCACCGGCAAGTGCTGCGAGGCATATCAGCCAACATGGGACAGCAATGCATGCTGACTCTCCTCGTCCTCTTCGCCGTACTCTGTCAGATATCCTGCTCCGGACTTTTCGAACTCAGGCTGCAGGAGTTTTTAAATAAGAAGGGGCTGCTCGGAAATATGAACTGCTGCAGACCTGGATCGCTTGGCACTTTGCAGCGGTGCGATTGCAAGACCTTCTTCAGAATCTGCCTTAAACACTATCAAAGCAACGTGTCTCCGGAGCCTCCATGTACATACGGCAGCGCGGTTACCCCTGTATTGGGCACCAACTCCTTCGTTGTACCGGAGAGCAGCAGTTCGGACCCCACTTTCAGCAATCCTATTCGATTCCCTTTTGGATTCACATGGCCTGGTACCTTTTCCCTTATCATTGAAGCAATACATGCGGATTCTGCTGATGATTTAAACACAGAGAACCCAGAACGTCTCATTAGTCGCCTTGCCACCCAACGTCACCTTACCGTTGGAGAGCAGTGGTCCCAAGATTTGCACAGCAGTGACCGGACAGAACTGAAATATTCCTACCGCTTTGTATGTGATGAACACTACTACGGGGAAGGCTGCTCTGACTACTGCCGTCCCAGAGATGATGCTTTTGGTCATTTTTCCTGCGGTGAAAAAGGAGAGAAATTGTGCAACCCTGGATGGAAGGGCCTGTACTGCACAGAACCAATTTGTTTGCCTGGATGTGATGAACATCATGGATATTGTGACAAGCCTGGGGAATGCAAATGCAGAGTTGGTTGGCAAGGCCGATACTGTGATGAATGCATTCGTTACCCAGGGTGCCTGCATGGCACCTGCCAGCAACCATGGCAATGCAACTGCCAAGAAGGCTGGGGAGGACTTTTCTGTAACCAAGATCTTAACTACTGCACCCACCACAAGCCATGCAAAAATGGAGCCACATGCACCAACACTGGCCAAGGAAGCTACACTTGCTCCTGCCGTCCTGGGTACACTGGCTCCAACTGTGAAATCGAAATCAATGAATGTGATGCAAACCCTTGCAAGAATGGAGGCAGCTGCACTGACCTGGAAAACAGCTATTCATGTTCCTGCCCACCAGGCTTCTATGGCAAAAACTGTGAACTCAGTGCTATGACCTGCGCCGATGGCCCATGCTTTAATGGAGGCCGGTGCTCTGACAACCCAGATGGCGGATATATCTGTTTCTGCCCAGTGGGTTACTCGGGATTTAACTGTGAGAAGAAAATTGATTACTGCAGCTCGAATCCTTGTGCCAACGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATAxxxxxxxTxxxxAAAAAAxxAAAxCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATATTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     6     5     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     8     7     8     6     7     6     7     6     7     6     7     6     7     6     7     5     7     5     7     5     7     5     7     5     7     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     7     5     7     6     7     6     7     7     8     8     9     8     9     8     9     7    10     8    10     8    10     8    10     8    10     8    10     8    10     7     9     7     9     7     9     8    10     7    10     8    10     8    10     8    10     8    10     8    10     8    10     7     9     6     8     6     8     6     8     6     8     5     8     6     8     5     7     5     7     5     7     7     8     8     9     8     9     7     8     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11     9    10     9    10     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11     8     9     8     9     8     9     8     9     8     9     8     9     7     8     8     9     8     9     8     9     8     9     8     9     9    10     9    10    10    11    11    11    11    11     9    10     9    10     9    10     9    11    10    12     9    11     8    11     9    11     9    11     8    11     8    10     9    12     9    12     9    13    14    18    16    20    18    22    21    26    21    26    21    26    22    26    24    28    24    28    25    29    25    29    27    31    28    32    28    32    28    32    28    32    28    32    28    32    28    32    28    32    28    32    28    32    28    32    28    32    28    32    28    34    28    34    28    34    28    34    28    34    29    34    28    34    28    34    28    34    28    34    28    33    28    34    28    34    28    34    28    34    28    34    28    34    24    33    23    33    24    32    23    32    22    32    22    31    22    31    21    31    21    31    21    31    21    31    21    33    21    34    22    36    24    36    24    35    24    35    24    36    22    33    23    33    19    31    18    30    16    29    10    24     5    13     4     7     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     3     4     3     4     2     4
  5   1   2  SIG                                      Xt7.1-XZG47763.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACGCGTGTACCCTCATTTCCCATCCCAGCACCGACACACACTGGATTCCTTATAAAGTGACACCTCTGGGAGACAGAGCGCTACATACTCGCCATCTGCTGCTTTTTTCTCTTCTGATTTCCTTTCCTTTGGGTTCACGAGCAGAGAGAGAATTAGAGACATAGCTGGAATTATTGCTTGGACTCGGGATTGACAGAATAAACCATATCGCCAAGTATTTGGATTTTTGTATTCCTAATGGACCTGGTAATGAATTGACACCAACTGGATTGAGAGAAGCTAAAGTTGCACAGTCGAATTGCGCGCAGCCTTTACCTGGGGCCAATCCTAACCTTTCATAGGTTTTTTTTTACTGCAATTCAGAAAGTCTGTCACTCTATGAAAGGGCGGATCTAAAGAGAAGCTTGAAGAAAGAAAGCAGATCCCTGACTACTGCAGTGTAGTTTGGGACAAGCCGCTTTGCGCCTTGTGCCTTGTAGCGCTATCGCACCGGCAAGTGCTGCGAGGCATATCAGCCAACATGGGACAGCAATGCATGCTGACTCTCCTCGTCCTCTTCGCCGTACTCTGTCAGATATCCTGCTCCGGACTTTTCGAACTCAGGCTGCAGGAGTTTTTAAATAAGAAGGGGCTGCTCGGAAATATGAACTGCTGCAGACCTGGATCGCTTGGCACTTTGCAGCGGTGCGATTGCAAGACCTTCTTCAGAATCTGCCTTAAACACTATCAAAGCAACGTGTCTCCGGAGCCTCCATGTACATACGGCAGCGCGGTTACCCCTGTATTGGGCACCAACTCCTTCGTTGTACCGGAGAGCAGCAGTTCGGACCCCACTTTCAGCAATCCTATTCGATTCCCTTTTGGATTCACATGGCCTGGTACCTTTTCCCTTATCATTGAAGCAATACATGCGGATTCTGCTGATGATTTAAACACAGAGAACCCAGAACGTCTCATTAGTCGCCTTGCCACCCAACGTCACCTTACCGTTGGAGAGCAGTGGTCCCAAGATTTGCACAGCAGTGACCGGACAGAACTGAAATATTCCTACCGCTTTGTATGTGATGAACACTACTACGGGGAAGGCTGCTCTGACTACTGCCGTCCCAGAGATGATGCTTTTGGTCATTTTTCCTGCGGTGAAAAAGGAGAGAAATTGTGCAACCCTGGATGGAAGGGCCTGTACTGCACAGAACCAATTTGTTTGCCTGGATGTGATGAACATCATGGATATTGTGACAAGCCTGGGGAATGCAAATGCAGAGTTGGTTGGCAAGGCCGATACTGTGATGAATGCATTCGTTACCCAGGGTGCCTGCATGGCACCTGCCAGCAACCATGGCAATGCAACTGCCAAGAAGGCTGGGGAGGACTTTTCTGTAACCAAGATCTTAACTACTGCACCCACCACAAGCCATGCAAAAATGGAGCCACATGCACCAACACTGGCCAAGGAAGCTACACTTGCTCCTGCCGTCCTGGGTACACTGGCTCCAACTGTGAAATCGAAATCAATGAATGTGATGCAAACCCTTGCAAGAATGGAGGCAGCTGCACTGACCTGGAAAACAGCTATTCATGTTCCTGCCCACCAGGCTTCTATGGCAAAAACTGTGAACTCAGTGCTATGACCTGCGCCGATGGCCCATGCTTTAATGGAGGCCGGTGCTCTGACAACCCAGATGGCGGATATATCTGTTTCTGCCCAGTGGGTTACTCGGGATTTAACTGTGAGAAGAAAATTGATTACTGCAGCTCGAATCCTTGTGCCAACGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAATAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABK5183.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCATCGATTCAATTCGGCCGAGGCACAAGGACTCTGTAATGTTTAAGGGGAAATACCATATAATAGAAAAACAGGGTGTTAGAAAATGATCACCCCCTGGTTATGCATTTGCACTGTGCTTAGCCAAGTTTCTTTAACCTTTGGCTCTCCAGCTGTTGTTGTACTGCAGTTCTCAAAATGAGGATTTATTGCAAACAACAGCTGAAGAAATATTAGGTGAAGATCACTGTGTAAAGAATATATTGGTTTTGCCAAAATTAGAAACAAGGCTATTTATATAGAAAACAATCCATTTCAATTGTAGTGCTTTTGCTGACAATTTACTGCTTGGCTGTGTTTCAGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAAGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCACCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTATAGAAGAGCGTAGCAAATGCGAAGCATAGTGCAGCTCATACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAA------------CAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTCAGTATCCTCTCCCATGGCCATAATTATTGATATTTGTCAGTAGCTTTTTAATATATTGCTGTTCCGGACATGGCAAAAAGTAAAACCTCTTTCTGTGGTTTTGTCAAGATTGTCATTTATATTGTCATTTATTTAAAATCTAAATCATGGTAAATATTGCAGTGAATCCCTATAAAAATGTATATCACAAGAGCAATGATACAGCAGAAGTGTGTATACTACACTCATATATGATAAACTCCAGTTTGTTGGCCTGCAATATACACTAAGTCATTAGAATCTTGTTATCAGTGGTAATTCCATGATAAGAGACAGCTAGTAATTGATCTAATAGGATTGCCACTGCTGCAACTGAATTTTCACAAATACATAACTCTGCTTTTGCAAAGATAGGAAGTAGTATGGGTTGTGCCATCTAAATACTGATCAACTAAATGTATCCCTACAGAATAATATATCACAGGAATTTTAGAAATGAGAAAAACAGTTGTGTGTTTCATAGCATAGCAAAATGCATTTCATATAAATGTTTTGTTAAATGGAACAACTGCCTGGTAAACCATTTGCCAAGGATAAGAACATTTAGGAAGAATTTCCTTTAGTAGTGTATCCCGGTAATGCACGTGCATGCAAACAGGTGCCAGCACATCTGGCTAACAGTATGTTTCTGTTTCCTTCACAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATATTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTTAAATAAAAAAAAAAAAAAAAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCACATCTGGCTAACAGTATGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGTCAGATAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----G------
                                               BLH ATG     521    2641                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     521     294                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     521     272                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     521      38                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- ?? ---- 6e-007     AAF26301.1 proprotein convertase aPC6B isoform [Branchiostoma californiense] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bb ---- 3e-035     BAC06835.1 Bb-cadherin [Branchiostoma belcheri] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 3e-060     NP_500460.1 EGF-like protein [Caenorhabditis elegans] --------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bf ---- 1e-074     CAC19873.1 putative notch receptor protein [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sp ---- 5e-119     NP_001027542.1 delta protein [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 2e-138     BAE06370.1 delta protein [Ciona intestinalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Cs ---- 1e-139     BAB70657.1 Delta [Ciona savignyi] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ==== 2e-165     NP_477264.1 CG3619-PA, isoform A [Drosophila melanogaster] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN -== Dr ==== 0          NP_571030.1 deltaD [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 0          NP_031891.2 delta-like 1 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 0          NP_005609.3 delta-like 1 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Gg ==== 0          NP_990304.1 C-Delta-1 [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 0          AAC38017.1 x-Delta-1 [Xenopus laevis]  =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 0          AAI35593.1 Unknown (protein for MGC:121362) [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 0          NP_001093689.1 delta-like 1 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZG47763.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAA---------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------TAA---------TAATGA---------------------------TAA---------------------------------------------TAA------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATGAATG---------------------------------------------------------------------------TAA---------------------------------------------------------------------ATG------------TGA---------------------------------------------TGA------------TAA------------TAA---------------------------------------------------ATG---------------------ATG---------------------------------TAATGA------TAA------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATGAATG---------------------------------------------------------------------------TAA---------------------------------------------------------------------ATG------------TGA---------------------------------------------TGA------------TAA------------TAA---------------------------------------------------ATG---------------------ATG---------------------------------TAATGA------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2  SIG                                      Xt7.1-XZG47763.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACGCGTGTACCCTCATTTCCCATCCCAGCACCGACACACACTGGATTCCTTATAAAGTGACACCTCTGGGAGACAGAGCGCTACATACTCGCCATCTGCTGCTTTTTTCTCTTCTGATTTCCTTTCCTTTGGGTTCACGAGCAGAGAGAGAATTAGAGACATAGCTGGAATTATTGCTTGGACTCGGGATTGACAGAATAAACCATATCGCCAAGTATTTGGATTTTTGTATTCCTAATGGACCTGGTAATGAATTGACACCAACTGGATTGAGAGAAGCTAAAGTTGCACAGTCGAATTGCGCGCAGCCTTTACCTGGGGCCAATCCTAACCTTTCATAGGTTTTTTTTTACTGCAATTCAGAAAGTCTGTCACTCTATGAAAGGGCGGATCTAAAGAGAAGCTTGAAGAAAGAAAGCAGATCCCTGACTACTGCAGTGTAGTTTGGGACAAGCCGCTTTGCGCCTTGTGCCTTGTAGCGCTATCGCACCGGCAAGTGCTGCGAGGCATATCAGCCAACATGGGACAGCAATGCATGCTGACTCTCCTCGTCCTCTTCGCCGTACTCTGTCAGATATCCTGCTCCGGACTTTTCGAACTCAGGCTGCAGGAGTTTTTAAATAAGAAGGGGCTGCTCGGAAATATGAACTGCTGCAGACCTGGATCGCTTGGCACTTTGCAGCGGTGCGATTGCAAGACCTTCTTCAGAATCTGCCTTAAACACTATCAAAGCAACGTGTCTCCGGAGCCTCCATGTACATACGGCAGCGCGGTTACCCCTGTATTGGGCACCAACTCCTTCGTTGTACCGGAGAGCAGCAGTTCGGACCCCACTTTCAGCAATCCTATTCGATTCCCTTTTGGATTCACATGGCCTGGTACCTTTTCCCTTATCATTGAAGCAATACATGCGGATTCTGCTGATGATTTAAACACAGAGAACCCAGAACGTCTCATTAGTCGCCTTGCCACCCAACGTCACCTTACCGTTGGAGAGCAGTGGTCCCAAGATTTGCACAGCAGTGACCGGACAGAACTGAAATATTCCTACCGCTTTGTATGTGATGAACACTACTACGGGGAAGGCTGCTCTGACTACTGCCGTCCCAGAGATGATGCTTTTGGTCATTTTTCCTGCGGTGAAAAAGGAGAGAAATTGTGCAACCCTGGATGGAAGGGCCTGTACTGCACAGAACCAATTTGTTTGCCTGGATGTGATGAACATCATGGATATTGTGACAAGCCTGGGGAATGCAAATGCAGAGTTGGTTGGCAAGGCCGATACTGTGATGAATGCATTCGTTACCCAGGGTGCCTGCATGGCACCTGCCAGCAACCATGGCAATGCAACTGCCAAGAAGGCTGGGGAGGACTTTTCTGTAACCAAGATCTTAACTACTGCACCCACCACAAGCCATGCAAAAATGGAGCCACATGCACCAACACTGGCCAAGGAAGCTACACTTGCTCCTGCCGTCCTGGGTACACTGGCTCCAACTGTGAAATCGAAATCAATGAATGTGATGCAAACCCTTGCAAGAATGGAGGCAGCTGCACTGACCTGGAAAACAGCTATTCATGTTCCTGCCCACCAGGCTTCTATGGCAAAAACTGTGAACTCAGTGCTATGACCTGCGCCGATGGCCCATGCTTTAATGGAGGCCGGTGCTCTGACAACCCAGATGGCGGATATATCTGTTTCTGCCCAGTGGGTTACTCGGGATTTAACTGTGAGAAGAAAATTGATTACTGCAGCTCGAATCCTTGTGCCAACGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAATAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008283962                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTACCCTCATTTCCCATCCCAGCACCGACACACACTGGATTCCTTATAAAGTGACACCTCTGGGAGACAGAGCGCTACATACTCGCCATCTGCTGCTTTTTTCTCTTCTGATTTCCTTTCCTTTGGGTTCACGAGCAGAGAGAGAATTAGAGACATAGCTGGAATTATTGCTTGGACTCGGGATTGACAGAATAAACCATATCGCCAAGTATTTGGATTTTTGTATTCCTAATGGACCTGGTAATGAATTGACACCAACTGGATTGAGAGAAGCTAAAGTTGCACAGTCGAATTGCGCGCAGCCTTTACCTGGGGCCAATCCTAACCTTTCATAGGTTTTTTTTTACTGCAATTCAGAAAGTCTGTCACTCTATGAAAGGGCGGATCTAAAGAGAAGCTTGAAGAAAGAAAGCAGATCCCTGACTACTGCAGTGTAGTTTGGGACAAGCCGCTTTGCGCCTTGTGCCTTGTAGCGCTATCGCACCGGCAAGTGCTGCGAGGCATATCAGCCAACATGGGACAGCAATGCATGCTGACTCTCCTCGTCCTCTTCGCCGTACTCTGTCAGATATCCTGCTCCGGACTTTTCGAACTCAGGCTGCAGGAGTTTTTAAATAAGAAGGGGCTGCTCGGAAATATGAACTGCTGCAGACCTGGATCGCTTGGCACTTTGCAGCGGTGCGATTGCAAGACCTTCTTCAGAATCTGCCTTAAACACTATCAAAGCAACGTGTCTCCGGAGCCTCCATGTACATACGGCAGCGCGGTTACCCCTGTATTGGGCACCAACTCCTTCGTTGTACCGGAGAGCAGCAGTTCGGACCCCACTTTCAGCAATCCTATTCGATTCCCTTTTGGATTCACATGGCCTGGTACCTTTTCCCTTATCATTGAAGCAATACATGCGGATTCTGCTGATGATTTAAACACAGAGAACCCAGAACGTCTCATTAGTCGCCTTGCCACCCAACGTCACCTTACCGTTGGAGAGCAGTGGTCCCAAGATTTGCACAGCAGTGACCGGACAGAACTGAAATATTCCTACCGCTTTGTATGTGATGAACACTACTACGGGGAAGGCTGCTCTGACTACTGCCGTCCCAGAGATGATGCTTTTGGTCATTTTTCCTGCGGTGAAAAAGGAGAGAAATTGTGCAACCCTGGATGGAAGGGCCTGTACTGCACAGAACCAATTTGTTTGCCTGGATGTGATGAACATCATGGATATTGTGACAAGCCTGGGGAATGCAAATGCAGAGTTGGTTGGCAAGGCCGATACTGTGATGAATGCATTCGTTACCCAGGGTGCCTGCATGGCACCTGCCAGCAACCATGGCAATGCAACTGCCAAGAAGGCTGGGGAGGACTTTTCTGTAACCAAGATCTTAACTACTGCACCCACCACAAGCCATGCAAAAATGGAGCCACATGCACCAACACTGGCCAAGGAAGCTACACTTGCTCCTGCCGTCCTGGGTACACTGGCTCCAACTGTGAAATCGAAATCAATGAATGTGATGCAAACCCTTGCAAGAATGGAGGCAGCTGCACTGACCTGGAAAACAGCTATTCATGTTCCTGCCCACCAGGCTTCTATGGCAAAAACTGTGAACTCAGTGCTATGACCTGCGCCGATGGCCCATGCTTTAATGGAGGCCGGTGCTCTGACAACCCAGATGGCGGATATATCTGTTTCTGCCCAGTGGGTTACTCGGGATTTAACTGTGAGAAGAAAATTGATTACTGCAGCTCGAATCCTTGTGCCAACGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATAxxxxxAAxxAAAAAAAAAAAAAAA
  0   1   1           Tad5 FL                          XZT29558.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACGCGTGTACCCTCATTTCCCATCCCAGCACCGACACACACTGGATTCCTTATAAAGTGACACCTCTGGGAGACAGAGCGCTACATACTCGCCATCTGCTGCTTTTTTCTCTTCTGATTTCCTTTCCTTTGGGTTCACGAGCAGAGAGAGAATTAGAGACATAGCTGGAATTATTGCTTGGACTCGGGATTGACAGAATAAACCATATCGCCAAGTATTTGGATTTTTGTATTCCTAATGGACCTGGTAATGAATTGACACCAACTGGATTGAGAGAAGCTAAAGTTGCACAGTCGAATTGCGCGCAGCCTTTACCTGGGGCCAATCCTAACCTTTCATAGGTTTTTTTTTACTGCAATTCAGAAAGTCTGTCACTCTATGAAAGGGCGGATCTAAAGAGAAGCTTGAAGAAAGAAAGCAGATCCCTGACTACTGCAGTGTAGTTTGGGACAAGCCGCTTTGCGCCTTGTGCCTTGTAGCGCTATCGCACCGGCAAGTGCTGCGAGGCATATCAGCCAACATGGGACAGCAATGCATGCTGACTCTCCTCGTCCTCTTCGCCGTACTCTGTCAGATATCCTGCTCCGGACTTTTCGAACTCAGGCTGCAGGAGTTTTTAAATAAGAAGGGGCTGCTCGGAAATATGAACTGCTGCAGACCTGGATCGCTTGGCACTTTGCAGCGGTGCGATTGCAAGACCTTCTTCAGAATCTGCCTTAAACACTATCAAAGCAACGTGTCTCCGGAGCCTCCATGTACATACGGCAGCGCGGTTACCCCTGTATTGGGCACCAACTCCTTCGTTGTACCGGAGAGCAGCAGTTCGGACCCCACTTTCAGCAATCCTATTCGATTCCCTTTTGGATTCACATGGCCTGGTACCTTTTCCCTTATCATTGAAGCAATACATGCGGATTCTGCTGATGATTTAAACACAGAGAACCCAGAACGTCTCATTAGTCGCCTTGCCACCCAACGTCACCTTACCGTTGGAGAGCAGTGGTCCCAAGATTTGCACAGCAGTGACCGGACAGAACTGAAATATTCCTACCGCTTTGTATGTGATGAACACTACTACGGGGAAGGCTGCTCTGACTACTGCCGTCCCAGAGATGATGCTTTTGGTCATTTTTCCTGCGGTGAAAAAGGAGAGAAATTGTGCAACCCTGGATGGAAGGGCCTGTACTGCACAGAACCAATTTGTTTGCCTGGATGTGATGAACATCATGGATATTGTGACAAGCCTGGGGAATGCAAATGCAGAGTTGGTTGGCAAGGCCGATACTGTGATGAATGCATTCGTTACCCAGGGTGCCTGCATGGCACCTGCCAGCAACCATGGCAATGCAACTGCCAAGAAGGCTGGGGAGGACTTTTCTGTAACCAAGATCTTAACTACTGCACCCACCACAAGCCATGCAAAAATGGAGCCACATGCACCAACACTGGCCAAGGAAGCTACACTTGCTCCTGCCGTCCTGGGTACACTGGCTCCAACTGTGAAATCGAAATCAATGAATGTGATGCAAACCCTTGCAAGAATGGAGGCAGCTGCACTGACCTGGAAAACAGCTATTCATGTTCCTGCCCACCAGGCTTCTATGGCAAAAACTGTGAACTCAGTGCTATGACCTGCGCCGATGGCCCATGCTTTAATGGAGGCCGGTGCTCTGACAACCCAGATGGCGGATATATCTGTTTCTGCCCAGTGGGTTACTCGGGATTTAACTGTGAGAAGAAAATTGATTACTGCAGCTCGAATCCTTGTGCCAACGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAATAAAAAAAAAAAAAAAAA
  5   1   4   10 seed Spl2 5g3  in                        CBSS4486.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CACGGACAGACAGGGCTGAAAGAGACTGAGATAGGGACGCGTGTACCCTCATTTCCCATCCCAGCACCGACACACACTGGATTCCTTATAAAGTGACACCTCTGGGAGACAGAGCGCTACATACTCGCCATCTGCTGCTTTTTTCTCTTCTGATTTCCTTTCCTTTGGGTTCACGAGCAGAGAGAGAATTAGAGACATAGCTGGAATTATTGCTTGGACTCGGGATTGACAGAATAAACCATATCGCCAAGTATTTGGATTTTTGTATTCCTAATGGACCTGGTAATGAATTGACACCAACTGGATTGAGAGAAGCTAAAGTTGCACAGTCGAATTGCGCGCAGCCTTTACCTGGGGCCAATCCTAACCTTTCATAGGTTTTTTTTTACTGCAATTCAGAAAGTCTGTCACTCTATGAAAGGGCGGATCTAAAGAGAAGCTTGAAGAAAGAAAGCAGATCCCTGACTACTGCAGTGTAGTTTGGGACAAGCCGCTTTGCGCCTTGTGCCTTGTAGCGCTATCGCACCGGCAAGTGCTGCGAGGCATATCAGCCAACATGGGACAGCAATGCATGCTGACTCTCCTCGTCCTCTTCGCCGTACTCTGTCAGATATCCTGCTCCGGACTTTTCGAACTCAGGCTGCAGGAGTTTTTAAATAAGAAGGGGCTGCTCGGAAATATGAACTGCTGCAGACCTGGATCGCTTGGCACTTTGCAGCGGTGCGATTGCAAGACCTTCTTCAGAATCTGCCTTANACACTATCAAAGCAACGTGTCTCCGGAGCCTCCATGT
  5   1   3        nb Tad5 FL   in                         XZT29558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACGCGTGTACCCTCATTTCCCATCCCAGCACCGACACACACTGGATTCCTTATAAAGTGACACCTCTGGGAGACAGAGCGCTACATACTCGCCATCTGCTGCTTTTTTCTCTTCTGATTTCCTTTCCTTTGGGTTCACGAGCAGAGAGAGAATTAGAGACATAGCTGGAATTATTGCTTGGACTCGGGATTGACAGAATAAACCATATCGCCAAGTATTTGGATTTTTGTATTCCTAATGGACCTGGTAATGAATTGACACCAACTGGATTGAGAGAAGCTAAAGTTGCACAGTCGAATTGCGCGCAGCCTTTACCTGGGGCCAATCCTAACCTTTCATAGGTTTTTTTTTACTGCAATTCAGAAAGTCTGTCACTCTATGAAAGGGCGGATCTAAAGAGAAGCTTGAAGAAAGAAAGCAGATCCCTGACTACTGCAGTGTAGTTTGGGACAAGCCGCTTTGCGCCTTGTGCCTTGTAGCGCTATCGCACCGGCAAGTGCTGCGAGGCATATCAGCCAACATGGGACAGCAATGCATGCTGACTCTCCTCGTCCTCTTCGCCGTACTCTGTCAGATATCCTGCTCCGGACTTTTCGAACTCAGGCTGCAGGAGTTTTTAAATAAGAAGGGGCTGCTCGGAAATATGAACTGCTGCAGACCTGGATCGCTTGGCACTTTGCAGCGGTGCGATTGCAAGACCTTCTTCAGAATCTGCCTTAAACACTATCAAAGCAACGTGTCTCCGGAGCCTCCATGTACATACGGCAGCGCGGGTTACCCCTGTA
  5   1   3        nb HdA                            THdA009n05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCCTTATAAAGTGACACCTCTGGGAGACAGAGCGCTACATACTCGCCATCTGCTGCTTTTTTCTCTTCTGATTTCCTTTCCTTTGGGTTCACGAGCAGAGAGAGAATTATAGACATAGCTGGAATTATTGCTTGGACTCGGGATTGACAGAATAAACCATATCGCCAAGTATTTGGATTT
  5   1   2       add 1030 5g                         IMAGE:7026994.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCAGTGTAGTTTGGGACAAGCCGCTTTGCGCCTTGTGCCTTGTAGCGCTATCGCACCGGCAAGTGCTGCGAGGCATATCAGCCAACATGGGACAGCAATGCATGCTGACTCTCCTCGTCCTCTTCGCCGTACTCTGTCAGATATCCTGCTCCGGACTTTTCGAACTCAGGCTGCAGGAGTTTTTAAATAAGAAGGGGCTGCTCGGAAATATGAACTGCTGCAGACCTGGATCGCTTGGCACTTTGCAGCGGTGCGATTGCAAGACCTTCTTCAGAATCTGCCTTAAACACTATCAAAGCAACGTGTCTCCGGAGCCTCCATGTACATACGGCAGCGCGGTTACCCCTGTATTGGGCACCAACTCCTTCGTTGTACCGGAGAGCAGCAGTTCGGACCCCACTTTCAGCAATCCTATTCGATTCCCTTTTGGATTCACATGGCCTGGTACCTTTTCCCTTATCATTGAAGCAATACATGCGGATTCTGCTGATGATTTAAACACAGAGAAACCCGAACGTCTCATTAGTCGGCTTGCCACCCAACGTCACCTTACCGTTGGGAAAGCAGTGGGTCCCAAAATTTGCACAGCAGTGACCGGACAGAACTGAAATATTCCTACCGCTTTTGAATGTGATGAACACTACTTACGGGGAAAGCTGGTTCTGACTAACTGCCGTCCCAAAAAAAGAAGGCTTTTTGGTCCTTTTTTCCCTGCCGGGGGAAAAAAGGAGAAAAAAATTTGTGCAAACCCTTGGAAAGGAAAGGGGCCTTGTTATCTTGCCCAAAAAAACCAATATTTTGTTTTTCCCCTGGGGAATGTGTAAATTAA
  5   1   3   12   nb Gas7 5g3  in                         XZG21951.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGTGTAGTTTGGGACAAGCCGCTTTGCGCCTTGTGCCTTGTAGCGCTATCGCACCGGCAAGTGCTGCGAGGCATATCAGCCAACATGGGACAGCAATGCATGCTGACTCTCCTCGTCCTCTTCGCCGTACTCTGTCAGATATCCTGCTCCGGACTTTTCGAACTCAGGCTGCAGGAGTTTTTAAATAAGAAGGGGCTGCTCGGAAATATGAACTGCTGCAGACCTGGATCGCTTGGCACTTTGCAGCGGTGCGATTGCAAGACCTTCTTCAGAATCTGCCTTAAACACTATCAAAGCAACGTGTCTCCGGAGCCTCCATGTACATACGGCAGCGCGGTTACCCCTGTATTGGGCACCAACTCCTTCGTTGTACCGGAGAGCAGCAGTTCGGACCCCACTTTCAGCAATCCTATTCGATTCCCTTTTGGATTCACATGGCCTGGTACCTTTTCCCTTATCATTGAAGCAATACATGCGGATTCTGCTGATGATTTAAACACAGAGAACCCAGAACGTCTCATTAGTCGCCTTGCCACCCAACGTCACCTTACCGTTGGAGAGCAGTGGTCCCAAGATTTGCACAGCAGTGACCGGACAGAACTGAAATATTCCTACCGCTTTGTATGTGATGAACACTACTACGGGGAAGGCTGCTCTGACTACTGCCGTCCCAGAGATGATGCTTTTGGTCATTTTT
  5   1   3        nb Tad5      in                         XZT32713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAATGCATGCTGACTCTCCTCGTCCTCTTCGCCGTACTCTGTCAGATATCCTGCTCCGGACTTTTCGAACTCAGGCTGCAGGAGTTTTTAAATAAGAAGGGGCTGCTCGGAAATATGAACTGCTGCAGACCTGGATCGCTTGGCACTTTGCAGCGGTGCGATTGCAAGACCTTCTTCAGAATCTGCCTTAAACACTATCAAAGCAACGTGTCTCCGGAGCCTCCATGTACATACGGCAGCGCGGTTACCCCTGTATTGGGCACCAACTCCTTCGTTGTACCGGAGAGCAGCAGTTCGGACCCCACTTTCAGCAATCCTATTCGATTCCCTTTTGGATTCACATGGCCTGGTACCTTTTCCCTTATCATTGAAGCAATACATGCGGATTCTGCTGATGATTTAAACACAGAGAACCCAGAACGTCTCATTAGTCGCCTTGCCACCCAACGTCACCTTACCGTTGGAGAGCAGTGGTCCCAAGATTTGCACAGCAGTGACCGGACAGAACTGAAATATTCCTACCGCTTTGTATGTGATGAACACTACTACGGGGAAGGCTGCTCTGACTACTGCCGTCCCAGAGATGATGCTTTTGGTCATTTTTCCTGCGGTGAAAAAGGAGAGAAATTGTGCAACCCTGGATGGAAGGGCCTGTACTGCACAGAACCAATTTGTTTGCCTGGATGTGATGAACATCATGGATATTGTGACAAGCCTGGGGAATGCAAATGCAGAGTTGGTTGGCAAGGCCGATACTGTGATGAATGCATTCGTTACCCAGGGTGCCTGCATGGCACCTGCCAGCAACCATGGCAATGCAACTGCCAAGAAGGCTGGGGAGGACTTTTCTGTACCAAGA
  5   1   2       add Egg                            TEgg140m01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGCAGTGCCTCGCTGCTTGTGGGATCGCAGATATCCTGCTCCGGACTTTTCGAACTCAGGCTGCAGGAGTTTTTAAATAAGAAGGGGCTGCTCGGAAATATGAACTGCTGCAGACCTGGATCGCTTGGCACTTTGCAGCGGTGCGATTGCAAGACCTTCTTCAGAATCTGCCTTAAACACTATCAAAGCAACGTGTCTCCGGAGCCTCCATGTACATACGGCAGCGCGGTTACCCCTGTATTGGGCACCAACTCCTTCGTTGTACCGGAGAGCAGCAGTTCGGACCCCACTTTCAGCAATCCTATTCGATTCCCTTTTGGATTCACATGGCCTGGTACCTTTTCCCTTATCATTGAAGCAATACATGCGGATTCTGCTGATGATTTAAACACAGAGAACCCAGAACGTCTCATTAGTCGCCTTGCCACCCAACGTCACCTTACCGTTGGAGAGCAGTGGTCCCAAGATTTGCACAGCAGTGACCGGACAGAACTGAAATATTCCTACCGCTTTGTATGTGATGAACACTACTACGGGGAAGGCTGCTCTGACTACTGCCGTCCCAGAGATGATGCTTTTGGTCATTTTTCCTG
  5   1   2       ext Tad5      in                         XZT66299.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGTTTTTAAATAAGAAGGGGCTGCTCGGAAATATGAACTGCTGCAGACCTGGATCGCTTGGCACTTTGCAGCGGTGCGATTGCAAGACCTTCTTCAGAATCTGCCTTAAACACTATCAAAGCAACGTGTCTCCGGAGCCTCCATGTACATACGGCAGCGCGGTTACCCCTGTATTGGGCACCAACTCCTTCGTTGTACCGGAGAGCAGCAGTTCGGACCCCACTTTCAGCAATCCTATTCGATTCCCTTTTGGATTCACATGGCCTGGTACCTTTTCCCTTATCATTGAAGCAATACATGCGGATTCTGCTGATGATTTAAACACAGAGAACCCAGAACGTCTCATTAGTCGCCTTGCCACCCAACGTCACCTTACCGTTGGAGAGCAGTGGTCCCAAGATTTGCACAGCAGTGACCGGACAGAACTGAAATATTCCTACCGCTTTGTATGTGATGAACACTACTACGGGGAAGGCTGCTCTGACTACTGCCGTCCCAGAGATGATGCTTTTGGTCATTTTTCCTGCGGTGAAAAAGGAGAGAAATTGTGCAACCCTGGATGGAAGGGCCTGTACTGCACAGAACCAATTTGTTTGCCTGGATGTGATGAACATCATGGATATTGTGACAAGCCTGGGGAATGCAAATGCAGAGTTGGTTGGCAAGGCCGATACTGTGATGAATGCATTCGTTACCCAGGGTGCCTGCATGGCACCTGCCAGCAACCATGGCAATGCAACTGCCAAGAAGGCTGGNGAGGACTTTTCTGTAACCAAGATCTTAACTACTGCACCCACCACAAGCCATGCAAAAATGGAGCCACATGCACCAACA
  5   1   3        nb Gas7                                 XZG34082.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACTTTGCAGCGGTGCGATTGCAAGACCTTCTTCAGAATCTGCCTTAAACACTATCAAAGCAACGTGTCTCCGGAGCCTCCATGTACATACGGCAGCGCGGTTACCCCTGTATTGGGCACCAACTCCTTCGTTGTACCGGAGAGCAGCAGTTCGGACCCCACTTTCAGCAATCCTATTCGATTCCCTTTTGGATTCACATGGCCTGGTACCTTTTCCCTTATCATTGAAGCAATACATGCGGATTCTGCTGATGATTTAAACACAGAGAACCCAGAACGTCTCATTAGTCGCCTTGCCACCCAACGTCACCTTACCGTTGGAGAGCAGTGGTCCCAAGATTTGCACAGCAGTGACCGGACAGAACTGAAATATTCCTACCGCTTTGTATGTGATGAACACTACTACGGGGAAGGCTGCTCTGACTACTGCCGTCCCAGAGATGATGCTTTTGGTCATTTTTCCTGCGGTGAAAAAGGAGAGAAATTGTGCAACCCTGGATGGAAGGGCCTGTACTGCACAGAACCAATTTGTTTGCCTGGATGTGATGAACATCATGGATATTGTGACAAGCCTGGGGAATGCAAATGCAGAGTTGGTTGGCAAGGCCGATACTGTGATGAATGCATTCGTTACCCAGGGTGCCTGCATGGCACCTGCCAGCAACCATGGCAATGCAACTGCCAAGAAGGCTGGGGAGGACTTTTCTGTAACCAAGATCTTAACTACTGCACCCACCACAAGCCATGCAAAAATGGAGCCACATGCACCAACACTGGCCAAGGAAGCTACACTTGCTCCTGCCGTCCTGGGTACACTGGCTCCAACTGTGAAATCGAAATCAATGAATGTGATGC
  5   1   2       add TbA                            TTbA055i10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGGAGAGCAGTGGTCCCAAGATTTGCACAGCAGTGACCGGACAGAACTGAAATATTCCTACCGCTTTGTATGTGATGAACACTACTACGGGGAAGGCTGCTCTGACTACTGCCGTCCCAGAGATGATGCTTTTGGTCATTTTTCCTGCGGTGAAAAAGGAGAGAAATTGTGCAACCCTGGATGGAAGGGCCTGTACTGCACAGAACGTAAGTCCTGAGGGGGCAAGCAAGGGCAAAAGAATGGTAGCCACTGAGAGATTAGCACTTGCTAGTCAGTCACTAATATATCAGTGGTGCAATAGCTAAAATGCAGAAATAATCAGAATTTGACAGGTCTGGCTATAACTACATGTTCTTATCACTAACTACTAAAGTATCAGTTGGGTTGTTGCAAGTTTTATCTTAATTATTCCTTTTCAGTTGCTGGGTTTATTTCAATTATCCTGCTATATAAAGAGTTTTCCCCCCATAGCTTATCTCATTAATCATGTTGACCAGCTTCTTTTCATTCTGGGGATAGAGGAGGGGGGTGATGCACTCTATTTTTCTGCATCCAGTGTCACATTGCTGTGTAAAATGTGCCCTGATTGCCTAACAAGTTTGTTTTAAGCAAGAGGAGCAGGAAGGACCTCCCTTCCCCCTTCTCCCTTTTGTGAGCCGGGTGCCCCTCTTTCTTCTGAGAACTTTAGACCATTTATTTGA
  5   1   3        nb Gas7      in                         XZG38916.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCACGCGTCCGGAGATGATGCTTTTGGTCATTTTTCCTGCGGTGAAAAAGGAGAGAAATTGTGCAACCCTGGATGGAAGGGCCTGTACTGCACAGAACCAATTTGTTTGCCTGGATGTGATGAACATCATGGATATTGTGACAAGCCTGGGGAATGCAAATGCAGAGTTGGTTGGCAAGGCCGATACTGTGATGAATGCATTCGTTACCCAGGGTGCCTGCATGGCACCTGCCAGCAACCATGGCAATGCAACTGCCAAGAAGGCTGGGGAGGACTTTTCTGTAACCAAGATCTTAACTACTGCACCCACCACAAGCCATGCAAAAATGGAGCCACATGCACCAACACTGGCCAAGGAAGCTACACTTGCTCCTGCCGTCCTGGGTACACTGGCTCCAACTGTGAAATCGAAATCAATGAATGTGATGCAAACCCTTGCAAGAATGGAGGCAGCTGCACTGACCTGGAAAACAGCTATTCATGTTCCTGCCCACCAGGCTTCTATGGCAAAAACTGTGAACTCAGTGCTATGACCTGCGCCGATGGCCCATGCTTTAATGGAGGCCGGTGCTCTGACAACCCAGATGGCGGATATATCTGTTTCTGCCCAGTGGGTTACTTGGGATTTAACTGTGAGAAGAAAATTGATTACTGCAGCTCGAATCCTTGTGCCAACGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTTGCA
  5   1   3        nb Gas       in                   TGas060o02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTTTCCTGCGGTGAAAAAGGAGAGAAATTGTGCAACCCTGGATGGAAGGGCCTGTACTGCACAGAACCAATTTGTTTGCCTGGATGTGATGAACATCATGGATATTGTGACAAGCCTGGGGAATGCAAATGCAGAGTTGGTTGGCAAGGCCGATACTGTGATGAATGCATTCTTTACCCAGGGTGCCTGCATGGCACCTGCCAGCAACCATGGCAATGCAACTGCCAAGAAGGCTGGGGAGGACTTTTCTGTAACCAAGATCTTAACTACTGCACCCACCACAAGCCATGCAAAAATGGAGCCACATGCACCAACACTGGTCAAGGAAGCTACACTTGCTCCTGCCGTCCTGGGTACACTGGCTCCAACTGTGAAATCGAAATCAATGAATGTGATGCAAACCCTTGCAAGAATGGAGGCAGCTGCACTGACCTGGAAAACAGCTATTCATGTTCCTGCCCACCAGGCTTTTATGGCAAAAACTGTGAACTCAGTGCTATGACCTGCGCCGATGGCCCATGCTTTAATGGAGGCCGGTGC
  5   1   3        nb TbA                            TTbA018d19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGCAACCATGGCAATGCAACTGCCCACATTGCTGGGGAGGACTTTTCTGTAACCAAGATCTTAACTACTGCACCCACCACAAGCCATGCAAAAATGGAGCCACATGCACCAACACTGGCCAAGGAAGCTACACTTGCTCCTGCCGTCCTGGGTACACTGGCTCCAACTGTGAAATCGAAATCAATGAATGTGATGCAAACCCTTGCAAGAATGGAGGCAGCTGCACTGACCTGGAAAACAGCTATTCATGTTCCTGCCCACCAGGCTTCTATGGCAAAAACTGTGAACTCAGTGCTATGACCTGCGCCGATGGCCCATGCTTTAATGGAGGCCGGTGCTCTGACAACCCAGATGGCGGATATATCTGTTTCTGCCCAGTGGGTTACTCGGGATTTAACTGTGAGAAGAAAATTGATTACTGCAGCTCGAATCCTTGTGCCAACGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGC
  5   1   2       ext TbA       in                   TTbA064d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTCTGTAACCAAGATCTTAACTACTGCACCCACCACAAGCCATGCAAAAATGGAGCCACATGCACCAACACTGGCCAAGGAAGCTACACTTGCTCCTGCCGTCCTGGGTACACTGGCTCCAACTGTGAAATCGAAATCAATGAATGTGATGCAAACCCTTGCAAGAATGGAGGCAGCTGCACTGACCTGGAAAACAGCTATTCATGTTCCTGCCCACCAGGCTTCTATGGCAAAAACTGTGAACTCAGTGCTATGACCTGCGCCGATGGCCCATGCTTTAATGGAGGCCGG
  5   1   3        nb Neu       out                  TNeu091k05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAACTACTGCACCCACCACAAGCCATGCAAAAATGGAGCCACATGCACCAACACTGGCCAAGGAAGCTACACTTGCTCCTGCCGTCCTGGGTACACTGGCTCCAACTGTGAAATCGAAATCAATGAATGTGATGCAAACCCTTGCAAGAATGGAGGCAGCTGCACTGACCTGGAAAACAGCTATTCATGTTCCTGCCCACCAGGCTTCTATGGCAAAAACTGTGAACTCAGTGCTATGACCTGCGCCGATGGCCCATGCTTTAATGGAGGCCGGTGCTCTGACAACCCAGATGGCGGATATATCTGTTTCTGCCCAGTGGGTTACTCGGGATTTAACTGTGAGAAGAAAATTGATTACTGCAGCTCGAATCCTTGTGCCAACGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTG
  5   1   2       ext TpA       in                   TTpA071c22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTACTGCACCCACCACAAGCCATGCAAAAATGGAGCCACATGCACCAACACTGGTCAAGGAAGCTACACTTGCTCCTGCCGTCCTGGGTACACTGGCTCCAACTGTGAAATCGAAATCAATGAATGTGATGCAAACCCTTGCAAGAATGGAGGCAGCTGCACTGACCTGGAAAACAGCTATTCATGTTCCTGCCCACCAGGCTTCTATGGCAAAAACTGTGAACTCAGTGCTATGACCTGCGCCGATGGCCCATGCTTTAATGGAGGCCGGTGCTCTGACAACCCAGATGGCGGATATATCTGTTTCTGCCCAGTGGGTTACTCTGGATTTAACTGTGAGAAGAAAATTGATTACTGCAGCTCGAATCCTTGTGCCAACGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGC
  5   1   3        nb Gas                            TGas021j01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACATGCACCAACACTGGCTACGGAAGCTACACTTGCTCCTGCCGTCCTGGGTACACTGGCTCCAACTGTGAAATCGAAATCAATGAATGTGATGCAAACCCTTGCAAGAATGGAGGCAGCTGCACTGACCTGGAAAACAGTTTTTTATTTTCCTGCCCACCAGGCTTCTATGGCAAAAACTGTGAACTCAGTGCTATGACCTGCGCCGATGGCCCATGCTTTATTGGTTGCCGGTGCTCTGACAACCCAGATGGCGGATNTATCTGTTTCTGCCCAGTGGGTTACTCGGGATTTAACTGTGAGAAGAAAA
  5   1   2       ext Tad5      in                         XZT15521.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGCACTGACCTGGAAAACAGCTATTCATGTTCCTGCCCACCAGGCTTCTATGGCAAAAACTGTGAACTCAGTGCTATGACCTGCGCCGATGGCCCATGCTTTAATGGAGGCCGGTGCTCTGACAACCCAGATGGCGGATATATCTGTTTCTGCCCAGTGGGTTACTCGGGATTTAACTGTGAGAAGAAAATTGATTACTGCAGCTCGAATCCTTGTGCCAACGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGAC
  5   1   2       ext TpA       in                   TTpA066d14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGATGGCGGATATATCTGTTTCTGCCCAGTGGGTTACTCGGGATTTAACTGTGAGAAGAAAATTGATTACTGCAGCTCGAATCCTTGTGCCAACGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCANATGCGAAGCAAAGTGCAG
  5   1   3        nb Gas1                               IMAGE:6988912                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTTCAGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCNAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGCATT
  5   1   3        nb Gas                            TGas110d23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAG
  5   1   3        nb Eye       in                         CCAX3701.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCAC
  5   1   3        nb Gas7      in                         XZG22171.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCAAACGACTCTG
  5   1   3        nb Gas7                                 XZG23595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGACGCGTGGGCATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCCTCATTTG
  5   1   3        nb Gas       in                   TGas126c22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTGAGCGTCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAA
  5   1   2       ext Spl1      in                         CABK2095.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCAGCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACC
  5   1   2       ext Gas7      in                         XZG47763.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTTGTGAACTATTTTTACG
  5   1   3        nb Gas7                                 XZG24122.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACT
  5   1   3        nb Tad5      in                          XZT5040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAATGGCTACAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTT
  3   1   2       ext Tad5      in                         XZT66299.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAAGAAGAGCGTAGCAAATGCGAAGCAAAGTGCAGCTCAAACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTAT
  3   1   3        nb Gas       in                    TGas060o02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCAAATGCGAAGCAAAGTGCAGCTCAAATGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATGTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAATGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGAAATGTTTAAACTATTTTTCCAAAATAAATACTTAAATAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG38916.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAAAAAAAAAAAGG
  3   1   2       ext Spl1      in                         CABK2095.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTACACTCAAAGAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAAT
  5   1   3        nb Mus1      in                         CABH8605.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGGAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGGGCAAATGGAATTTGATTTTTTTT
  3   1   2       ext TpA       in                   TTpA071c22.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATGTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAATGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAAATTTTAAACTATTTTTCCAAAATAAATACTATAATAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Mus1      in                         CABH8605.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAAT
  3   1   2       ext Gas7      in                         XZG47763.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTAT
  3   1   2       ext TbA       in                    TTbA064d01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAATAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       ext TpA       in                   TTpA066d14.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACNTATTTTTCCAAAATAAATACTATAAATAATAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Tad5      in                         XZT15521.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAATAAT
  3   1   3        nb Tad5      in                         XZT32713.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCANCAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAAT
  5   1   2       ext HdA       in                  THdA009j22.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGGGCTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATGTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAATGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAATAAAAA
  3   1   4      seed Spl2 5g3  in                        CBSS4486.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAATAATT
  3   1   3        nb Tad5      in                          XZT5040.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTAT
  3   1   2       ext HdA       in                    THdA009j22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATGTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAATGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTTAAATAAAAAAAAAAAAAAAAGCG
  3   1   3        nb Gas7 5g3  in                         XZG21951.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAAT
  3   1   3        nb Gas       in                    TGas126c22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGATGAGAAAGATGAATGCATCATTGCACAGAGGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAATAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7      in                         XZG56483.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGAATGCATCATTGCAACAGAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGCTTTTTTTTGTTAATGAAGGAA
  5   1   3        nb Gas                            TGas057n20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATGTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAATGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTA
  3   1   3        nb Gas7      in                         XZG56483.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATA
  3   1   3        nb Gas7      in                         XZG22171.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATCCTATAAAT
  5   1   3        nb TbA       in                   TTbA038f24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCACAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTACGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTATTTTCTACTGTTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAA
  3   1   3        nb TbA       in                    TTbA038f24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGATGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGAGTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTGTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAAATATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGAGACTATATTTTTTTGTATATATAGGTATTTATGGAATATTGTGCAAATGGTATTGGATTTTTTTTCTACAGTTTTTTTTTTGTTAAAGAAGGGAAGTAATTTTTAAACTATTTT
  3   1   3        nb Tad5 FL   in                         XZT29558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAAT
  5   1   3        nb Gas                            TGas131p13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAATGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGCATATATATGCATTCATGGAATATTGAGCCAATGGCATCTGATTTTTTTCTACTGTTTTTTTTTGCTAATG
  3  -1   3        nb Kid1      in                         CABA7092.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAATGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTT
  5  -1   3        nb Kid1      in                         CABA7092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAATGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTT
  3   1   3        nb Gas                             TGas087o10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTTGTTAATGAAGGAAGTAATTTTGAAACTATTTTTCCAAAATAAATACTATAAATAAAAAAAAAAAAAAAAA
  5   1   2       add TbA       in                   TTbA008e03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAACTAGTGTCGACCCGTCCGCTTTTTTTTTTTTTTTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAAT
  3   1   2       add TbA       in                   TTbA008e03.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAACTAGTGTCGACCCGTCCGCTTTTTTTTTTTTTTTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACNTATTTTTCCAAAATAAATACTATAAATAAAAAAAAAAAAAAAAAAG
  3   1   3        nb Eye       in                         CCAX3701.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTAT
  3   1   2       ext Gas                             TGas058j07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATTCCTATAATTANAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABK5183.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCATCGATTCAATTCGGCCGAGGCACAAGGACTCTGTAATGTTTAAGGGGAAATACCATATAATAGAAAAACAGGGTGTTAGAAAATGATCACCCCCTGGTTATGCATTTGCACTGTGCTTAGCCAAGTTTCTTTAACCTTTGGCTCTCCAGCTGTTGTTGTACTGCAGTTCTCAAAATGAGGATTTATTGCAAACAACAGCTGAAGAAATATTAGGTGAAGATCACTGTGTAAAGAATATATTGGTTTTGCCAAAATTAGAAACAAGGCTATTTATATAGAAAACAATCCATTTCAATTGTAGTGCTTTTGCTGACAATTTACTGCTTGGCTGTGTTTCAGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAAGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCACCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTATAGAAGAGCGTAGCAAATGCGAAGCATAGTGCAGCTCATACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAA------------CAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTCAGTATCCTCTCCCATGGCCATAATTATTGATATTTGTCAGTAGCTTTTTAATATATTGCTGTTCCGGACATGGCAAAAAGTAAAACCTCTTTCTGTGGTTTTGTCAAGATTGTCATTTATATTGTCATTTATTTAAAATCTAAATCATGGTAAATATTGCAGTGAATCCCTATAAAAATGTATATCACAAGAGCAATGATACAGCAGAAGTGTGTATACTACACTCATATATGATAAACTCCAGTTTGTTGGCCTGCAATATACACTAAGTCATTAGAATCTTGTTATCAGTGGTAATTCCATGATAAGAGACAGCTAGTAATTGATCTAATAGGATTGCCACTGCTGCAACTGAATTTTCACAAATACATAACTCTGCTTTTGCAAAGATAGGAAGTAGTATGGGTTGTGCCATCTAAATACTGATCAACTAAATGTATCCCTACAGAATAATATATCACAGGAATTTTAGAAATGAGAAAAACAGTTGTGTGTTTCATAGCATAGCAAAATGCATTTCATATAAATGTTTTGTTAAATGGAACAACTGCCTGGTAAACCATTTGCCAAGGATAAGAACATTTAGGAAGAATTTCCTTTAGTAGTGTATCCCGGTAATGCACGTGCATGCAAACAGGTGCCAGCACATCTGGCTAACAGTATGTTTCTGTTTCCTTCACAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATATTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTTAAATAAAAAAAAAAAAAAAAG
                                                  Xt7.1-CHK-1008283958                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCAATTCGGCCGAGGCACAAGGACTCTGTAATGTTTAAGGGGAAATACCATATAATAGAAAAACAGGGTGTTAGAAAATGATCACCCCCTGGTTATGCATTTGCACTGTGCTTAGCCAAGTTTCTTTAACCTTTGGCTCTCCAGCTGTTGTTGTACTGCAGTTCTCAAAATGAGGATTTATTGCAAACAACAGCTGAAGAAATATTAGGTGAAGATCACTGTGTAAAGAATATATTGGTTTTGCCAAAATTAGAAACAAGGCTATTTATATAGAAAACAATCCATTTCAATTGTAGTGCTTTTGCTGACAATTTACTGCTTGGCTGTGTTTCAGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAAGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCACCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTATAGAAGAGCGTAGCAAATGCGAAGCATAGTGCAGCTCATACGACTCTGATTCAGAAGATGTAAACTCAGTAC------------------------TTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTCAGTATCCTCTCCCATGGCCATAATTATTGATATTTGTCAGTAGCTTTTTAATATATTGCTGTTCCGGACATGGCAAAAAGTAAAACCTCTTTCTGTGGTTTTGTCAAGATTGTCATTTATATTGTCATTTATTTAAAATCTAAATCATGGTAAATATTGCAGTGAATCCCTATAAAAATGTATATCACAAGAGCAATGATACAGCAGAAGTGTGTATACTACACTCATATATGATAAACTCCAGTTTGTTGGCCTGCAATATACACTAAGTCATTAGAATCTTGTTATCAGTGGTAATTCCATGATAAGAGACAGCTAGTAATTGATCTAATAGGATTGCCACTGCTGCAACTGAATTTTCACAAATACATAACTCTGCTTTTGCAAAGATAGGAAGTAGTATGGGTTGTGCCATCTAAATACTGATCAACTAAATGTATCCCTACAGAATAATATATCACAGGAATTTTAGAAATGAGAAAAACAGTTGTGTGTTTCATAGCATAGCAAAATGCATTTCATATAAATGTTTTGTTAAATGGAACAACTGCCTGGTAAACCATTTGCCAAGGATAAGAACATTTAGGAAGAATTTCCTTTAGTAGTGTATCCCGGTAATGCACGTGCATGCAAACAGGTGCCAGCACATCTGGCTAACAGTATGTTTCTGTTTCCTTCACAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATATTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTTAAATAAAAAAAAAAA
  5   1   2       ext Fat1      in                         CABC2138.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCATCGATTCAATTCGGCCGAGGCACAAGGACTCTGTAATGTTTAAGGGGAAATACCATATAATAGAAAAACAGGGTGTTAGAAAATGATCACCCCCTGGTTATGCATTTGCACTGTGCTTAGCCAAGTTTCTTTAACCTTTGGCTCTCCAGCTGTTGTTGTACTGCAGTTCTCAAAATGAGGATTTATTGCAAACAACAGCTGAAGAAATATTAGGTGAAGATCACTGTGTAAAGAATATATTGGTTTTGCCAAAATTAGAAACAAGGCTATTTATATAGAAAACAATCCATTTCAATTGTAGTGCTTTTGCTGACAATTTACTGCTTGGCTGTGTTTCAGGAGCTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAGGCTTTTCTGGAAGGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAGGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGA
  5   1   4      seed HdA       in                  THdA016o04.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCACTGTGAAGATCTTGGAAATTCCTATATATGTCAGTGCCAGGAAAGCTTTTCTGGAAAGAACTGCGATGACAACCTAGATGACTGTGCATCCTTTCCTTGCCAGAATGGCGGTACATGCCAGGATGGGATTAATGACTATACTTGTACCTGTCCTCCTGGCTACATTGGGAAGAACTGCAGTATGCCTATTACCAAGTGTGAACATAATCCATGCCACAATGGTGCAACGTGCCACGAGAGAAATAATCGATATGTGTGTCAGTGTGCACGAAGTTATGGTGGTAACAACTGCCAGTTTTTGCTTCCTGAAGAGAAAACTGTTGTTGTCGACTTCACTGAAAAATACACAGAAGGGCAAAGTGGACAGTTCCCATGGATTGCCGTATGTGCTGGGATTGTCTTGGTGCTGATGTTGCTGCTGGGCTGTGCTGCTGTGGTTGTCTGTGTAAGGGTTAGAGTGCAGAAGAGACGCCATCACCCTGAGGCCTGCCGTGGTGAGACCAAGACTATGAATAACCTGGCCAACTGTCAAAGAGACAAGGATATTTCTGTAAGCATCATAGGCACCACTCAAATCAAAAACACCAACAAGAAAGTGGACTTTCTCAGTGAAAGCAACAATGAAAAAAATGGCTACAAGCCCAGGTACCCTTCTGTGGATTACAATTTAGTTCACGAACTGAAGAATGAGGACTCACCTATAGAAGAGCGTAGCAAATGCGAAGCATAGTGCAGCTCATACGACTCTGATTCAGAAGATGTAAACTCAGTACACTCAAAG
  5   1   2       ext Gas       in                   TGas061f15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGAGATTCCTCAGAAAGAAGACGACCAGACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTCAGTATCCTCTCCCATGGCCATAATTATTGATATTTGTCAGTAGCTTTTTAATATATTGCTGTTCCGGACATGGCAAAAAGTAAAACCTCTTTCTGTGGTTTTGTCAAGATTGTCATTTATATTGTCATTTATTTAAAATCTAAATCATGGTAAATATTGCAGTGAATCCCTATAAAAATGTATATCACAAGAGCAATGATACAGCAGAAGTGTGTATACTACACTCATATATGATAAACTCCAGTTTGTTGGCCTGCAATATACACTAAGTCATTAGAATCTTGTTATCAGTGGTAATTCCATGATAAGAGACAGCTAGTAATTGATCTAATAGGATTGCCACTGCTGCAACTGAATTTTCACAAATACATAACTCTGCTTTTGCAAAGATAGGAAGTAGTATGGGTTGTGCCATCTAAATACTGATCAACTAAATTTATCCCTACAGAATAATATATCA
  5   1   2       ext Spl1      in                         CABK5183.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTCTGCCTACTCCACGTCAAAGGACACAAAATATCAATCGGTATATGTTATATCAGATGAGAAAGATGAATGCATCATTGCAACAGAGGTCAGTATCCTCTCCCATGGCCATAATTATTGATATTTGTCAGTAGCTTTTTAATATATTGCTGTTCCGGACCTGGCAAAAAGTAAAACCTCTTTCTGTGGTTTTGTCAAGATTGTCATTTATATTGTCATTTATTTAAAATCTAAATCATGGTAAATATTGCAGTGAATCCCTATAAAAATGTATATCACAAGAGCAATGATACAGCAGAAGTGTGTATACTACACTCATATATGATAAACTCCAGTTTGTTGGCCTGCAATATACACTAAGTCATTAGAATCTTGTTATCAGTGGTAATTCCATGATAAGAGACAGCTAGTAATTGATCTAATAGGATTGCCACTGCTGCAACTGAATTTTCACAAATACATAACTCTGCTTTTGCAAAGATAGGAAGTAGTATGGGTTGTGCCATCTAAATACTGATCAACTAAATGTATCCCTACAGAATAATATATCACAGGAATTTTAGAAATGAGAAAAACAGTTGTGTGTTTCATAGCATAGCAAAATGCATTTCATATAAATGTTTTGTTAAATGGAACAACTGCCTGGTAAACCATTTGCCAAGGATAAGAACATTTAGGAAGAATTTCCTTTAGTAGTGTATCCCGGTAATGCACGTGCATGCAAACAGGTGCCAGCACATCTGGCTAACAGTATGTTTCTGTTTCCTTCACAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCA
  3   1   4      seed HdA       in                   THdA016o04.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCATAGCAAAATGCATTTCATATAAATGTTTTGTTAAATGGAACAACTGCCTGGTAAACCATTTGCCAAGGATAAGAACATTTAGGAAGAATTTCCTTTAGTAGTGTATCCCGGTAATGCACGTGCATGCAAACAGGTGCCAGCACATCTGGCTAACAGTATGTTTCTGTTTCCTTCACAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATATTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTTAAATAAAAAAAAAAAAAAAAGCG
  3   1   2       ext Spl1      in                         CABK5183.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGCCAAGGATAAGAACATTTAGGAAGAATTTCCTTTAGTAGTGTATCCCGGTAATGCACGTGCATGCAAACAGGTGCCAGCACATCTGGCTAACAGTATGTTTCTGTTTCCTTCACAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATCTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAAAGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAAG
  3   1   2       ext Fat1      in                         CABC2138.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGATAAGACATTTTAGGAAGAATTTCCTTTAGTAGTGTATCCCGGTAATGCACGTGCATGCAAACAGGTGCCAGCACATCTAGCTAACAGTATGTTTCTGTTTCCTTCACAGGTGTAATACGGACGCTGTACAGCACAAGGTTCTTGTCAGATATTCAAAGCTGACGCCCATGTGAATGCTGCTGGTGAAAGAGTCAGGGGATATCCCTTTGTTGACTGCTGCTGAGACACTAAATTCAGGCTGAGCTGGTTCTCTACTGAAATTAGGGGAAATAAAAAGACTGCAAAACAATATGGACACCCCAAGCTAGTCTCCGTGTCCAGACATAAACTGTTGCACTGCCGTTTCCGTACTTCTCCATTGCACTATGGACAGTTGCTTTTTTTAAATTATTATAATAAATATATATATAAATATATATATATTTAATGAATGGACTTCAACATATGTCAGAAGAAGGGTGACCTGACTGAGGTGTATATTTTGGATTCGTTTGAGCCATTCCGTTGCTAAACTACAGACAGTCACTGCCTTCAATGGCTTCTTTTTTTATACTAAAAGGTGTTTTCTACTAGGTCAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAATGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAACTATTTTTCCAAAATAAATACTATAAAT
  3   1   2       ext Gas       in                    TGas061f15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAAAATGCGTAATATTTTTTGAACTTGTGAAACTATTTTTACGATATTTGTAATGCTTAAGTATTTGTGATGTTCATTTTTATAATTTAAACCTTGGTAAATATGTACAAAGGCACTTCGGGTCTATGTGACTATATTTTTTTGTATATATATGTATTTATGGAATATTGTGCAAATGGTATTTGATTTTTTTTCTACTGTTTTTTTTTGTTAATGAAGGAAGTAATTTTTAAANCTATTTTTCCAAAATAAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)