Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012073393 Xt7.1-XZT33803.5 - 55 ESTs
                                                                       -120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT33803.5                                                                                                                         GGAAGTTTCAGGGAAGCTGTTTAGGTTGTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATCTGTTATCTTCAGCCACAACTCCCAGCATTCTCTGACAGCCAAGTTGTAGTATAGCAGCCTGTTTAGAACCGGAAGAGAACTACACACCTTTTGTCTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTCTTCCCTTTTCCAAAACAATATTTATGATTTTTCCTTTGTTTGGATCTGAATTGGCTCAGAGTAAACCCCTGAGGGAAAGTTTGCGCCTGCTCTGTTTTCTCTATGCTTTATTTAGCAGAAAACAATGTTACATATTTTGTGTTGGGGAACCAACGCTAATGGCAGTTGCCCAGGAACCTCCGGCTGCAGGCAATGCCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCTGTCTCAATGCACTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGCTGTT
                                                  Xt7.1-CHK-1008225294                                                                                                                               TTCAGGGAAGCTGTTTAGGTTGTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATCTGTTATCTTCAGCCACAACTCCCAGCATTCTCTGACAGCCAAGTTGTAGTATAGCAGCCTGTTTAGAACCGGAAGAGAACTACACACCTTTTGTCTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTCTTCCCTTTTCCAAAACAATATTTATGATTTTTCCTTTGTTTGGATCTGAATTGGCTCAGAGTAAACCCCTGAGGGAAAGTTTGCGCCTGCTCTGTTTTCTCTATGCTTTATTTAGCAGAAAACAATGTTACATATTTTGTGTTGGGGAACCAACGCTAATGGCAGTTGCCCAGGAACCTCCGGCTGCAGGCAATGCCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCTGTCTCAATGCACTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGCTGTTTTTACT
                                                      consensus depths                                                                                                                              4     6     8    10    12    13    12    15    18    18    21    21    24    24    24    24    24    24    25    25    25    25    27    28    27    28    27    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    29    29    28    29    30    30    30    30    30    30    30    31    30    31    29    31    31    31    31    32    33    33    32    33    32    34    34    35    33    35    34    35    33    35    33    35    34    36    32    36    34    37    34    37    35    37    35    37    35    37    35    37    35    37    34    37    33    36    32    35    31    35    31    35    30    34    31    35    29    34    30    34    29    34    29    33    28    33    28    33    27    33    25    32    23    29    20    27    21    26    20    26    20    26    15    26    18    27    16    23    16    24    16    23    15    23    17    23    15    19    15    18    14    17    14    17    13    17    12    17    12    18    12    18    11    18    12    17     9    16    13    21    13    22    12    22    14    21    13    21    12    21    13    21    11    20     9    19     7    18     7    16    10    16     8    17     7    17     5    17     8    17     8    17     8    17    10    17     8    17    11    17     7    17    12    18    14    17    15    17    15    17    15    17    14    17    12    17    13    17    15    17    11    17    15    17    15    17    15    17    15    17    14    17    15    16    15    16    15    16    15    16    15    16    15    16    14    15    14    15    14    15    14    15    13    15    12    14    13    14     6    12
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --C--------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T-T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------C-C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------T-T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --A----T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----C--T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------T--C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -T----------
                                               BLH ATG      45     583                                                                                                                         
                                               BLH MIN      45     102                                                                                                                         
                                               BLH OVR      45     651                                                                                                                         
                                               CDS MIN      45       4                                                                                                                         
                                               EST CLI      12       4                                                                                                                         
                                               ORF LNG      45      24                                                                                                                         
                                                                                                                                                                                                                                         PROTEIN --- Sc ---- 1e-023     NP_012883.1 involved in secretion; Vps24p [Saccharomyces cerevisiae] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Ce ==== 8e-056     NP_494919.1 RiboNuclease H (2F287ANDrnh-1) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 3e-062     XP_001201148.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Dm ==== 1e-069     NP_649451.1 CG9779-PA [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Dr ==== 1e-096     NP_998485.1 zgc:76972 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = Gg ==== 9e-101     XP_420858.2 PREDICTED: similar to CGI-149 protein [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Hs ==== 2e-102     NP_057163.1 neuroendocrine differentiation factor; comparative gene identificationtranscript 149 [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Mm ==== 1e-102     NP_080059.2 neuroendocrine differentiation factor [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Xl ==== 6e-115     AAH70719.1 MGC83677 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = ?? ==== 6e-115     NP_001084828.1 hypothetical protein LOC431872 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Xt ==== 3e-117     CAJ81451.1 vacuolar protein sorting 24 (yeast) [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT33803.5                                                                                                                                              TAG---------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---ATG---------------------------------------------------------ATG------ATG------------------------------------ATG------------------ATGATG---------------------ATG---------------------ATG---------------ATG---------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------TAA---------------------------------------------TGA------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------TAG------------------------------------------------TGA------------TAA------------------------------------------------TAG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------TGA---------------------------------TAG------------------------TAGTAA------TGA---TGA---TAG---------TGA---------------TAA---TGA------------ATG
                                                                   ORF                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   1           AbdN FL                     IMAGE:7022166.FL-MGC                                                                                                                              TTTCAGGGAAGCTGTTTAGGTTGTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGATTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACTGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGACATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATATTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATCTGTTATCTTCAGCCACAACTCCCAGCATTCTCTGACAGCCAAGTTGTAGTATAGCAGCCGGTTTAGAACCGGAAGAGAACTACACACCTTTTGTCTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTCTTCCCTTTTCCAAAACTATATTTATGATTTTTCCTTTGTCTGGATCTGAATTGGCTCAGAGTAAACCCCTGAGGGAAAGTTTGCGCCTGCTCTGTTTTCTCTATGCTTTATTTAGCAGAAAACAATGTTACATATTTTGTGTTGGGGAACCAACGCTAATGGCAGTTGCCCAGGAACCTCCGGCTGCAGGCAATGCAACCCCCCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCCGTCTCAATGCACTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGCTGTTTTTACTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg091h16.FL-Sanger                                                                                                                                            TTTAGGTTGTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATCTGTTATCTTCAGCCACAACTCCCAGCATTCTCTGACAGCCAAGTTGTAGTATAGCAGCCTGTTTAGAACCGGAAGAGAACTACACACCTTTTGTCTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTCTTCCCTTTTCCAAAACAATATTTATGATTTTTCCTTTGTTTGGATCTGAATTGGCTCAGAGTAAACCCCTGAGGGAAAGTTTGCGCCTGCTCTGTTTTCTCTATGCTTTATTTAGCAGAAAACAATGTTACATATTTTGTGTTGGGGAACCAACGCTAATGGCAGTTGCCCAGGAACCTCCGGCTGCAGGCAATGCCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCTGTCTCAATGCACTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGCTGTTTTTACTCC
  5   1   2       chi 1030 5g                         IMAGE:7094008.5p                        TCCACTCCCAGGTCCTCTGCTCCTCNTTTCTNTCCTCCCCCTTTAAAANCTACTTTTTCTTTTTTCACTCTATTTAATTCTTCCCCCCCCCCCCCTTTTAATTTTCAAGTAAACTTTTTATGTTTTTTTCACTAAATGTATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACTGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCTTTCTAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCATAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTATTGAAAATACCCGAGATCCACGCTACCATGAGAGACCTGTCCAAAGATATGATGAAGGCAGGTATATTATAAGAAATGCTGGAGGACACATTTGAAGGCTTGGTAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGGAGGGGCCTTGGGGAAAGCTCCCAGCAATTCAAAGATGCCTTACGGAACCTGAATTACGGGGGCATGGTTGCTTCCGATAATAGAATGAGAGGACTGAAGCCTTGCATCTCGTTGG
  5   1   2   14  bld Te5  5g3  in                         CAAO6883.5p ............................................................................................................AGGAAGTGGTGGGGAAGTTTCAGGGAAGCTGTTTAGGTTGTTGTCACTGATTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGGTACATATTCTTATTCTAGGGAGACTTCCCTGGTTTTTTGAAATGAAAACCTTTCTTTTTGGGAAAATATTTTGGGT
  5   1   2       bld Gas  5g                        TGas003f10.p1kSP6                                                                                                              AAGTGGTGGGGGAAGTTTCAGGGNAAGCTGTTTAGGTTGTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTAC
  5   1   2   14  bld Brn4 5g3  in                        CAAL18076.5p ..............................................................................................................GAAGTGGTGGGGAAGTTTCAGGGAAGCTGTTTAGGTTGTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTNTTGAAATGTAAACTTTCTTTTG
  5   1   2   14  bld Te5  5g3  in                        CAAO11593.5p ....................................................................................................................GTGGGGAAGTTTCAGGGAAGCTGTTTAGGTTGTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTC
  5   1   2   32  bld Gas7 5g                              XZG58028.5p ....................................................................................................................GTGGGGAAGTTTCAGGGAAGCTGTTTAGGTTGTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGANATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCNACCATNATGATCTCTCTCTGCTTTA
  5   1   2       chi Tail                                 CBSW8984.b1                                                                                                                             GGATCCATCGATTCAATTCTCGACCCCGCGTCCGGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTCTTCCCTTTTCCAAAACAATATTTATGATTTTTCCTTTGTTTGGATCTGAATTGGCTCAGAGTAAACCCCTGAGGGAAAGTTTGCGCCTGCTCTGTTTTCTCTATGCTTTATTTAGCAAAAAACAATGTTACATATTTTGTGTTGGGGAACCAACGCTAATGGCAGTTGCCCAGGAACCTCCGGCTGCAGGCAATGCCCCCCCCCCCCCAC
  5   1   2       bld AbdN FL                            IMAGE:7022166                                                                                                                              TTTCAGGGAAGCTGTTTAGGTTGTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGATTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATTGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGGCCTTGGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAAACCTGAAAATTACTGGGGGGCCATGGCCTGCATCCCCGATGGAATAGGAAGGAAGAAGGACCTTGGGAGGGCCCATGCCAGTCCCGGGCTGTGGCAGCCCCTCAGGGAGTTAAAGGAACTTACTGGTACATTATTCTTTATTTCTAAGGAGAACTTCCCTTGGGTTTTTTGACATGGTAAAAATTTTCCTTTTTGTTGAAAAAAATTTTTTCGGGGTTTATACTAATTATAATAATAATTCTCCTATAAACAGACTTGTGGGGCCTAAAACCCTTTTCCCCTTCCAAACCCTTATTTTTGG
  5   1   2       bld Te5                                  CAAO7005.5p                                                                                                                                     GAAGCTGTTTAGGTTGTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAATGTAAACTTTCTTTTGTGAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTTCTCCAACCCATATGATCTCTCTCTGC
  5   1   2   12  bld Gas7 5g3  in                         XZG23476.5p ....................................................................................................................................GAAGCTGTTTAGGTTGTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACTGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGACATGTAAACTTTCTTTTGTGAAAATATTT
  5   1   2   12  bld Tad5 5g3  in                          XZT6551.5p .........................................................................................................................................TGTTTAGGTTGTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGACATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACACCAATGTCCCTG
  5   1   2       bld Egg  FL                        TEgg091h16.p1kSP6                                                                                                                                            TTTAGGTTGTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGA
  5   1   2       bld Gas  5g                        TGas033n07.p1kSP6                                                                                                                                            TTTAGGTTGTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGAT
  5   1   2   30  bld Tail 5x3                             CBSW6624.b1 ...................................................................................................................................................GTTGTCACTGAGTGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTCAGAGTCTCCGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACTGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGACATGTAAACTTTCTTTTGT
  5   1   2   30  bld Tbd1 5x3                             CBXT2808.b1 .......................................................................................................................................................GTCACTGAGTAGAAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCTAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTCAGAGTCTCCGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCACGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCCTGGTTTTTGACATGTAAAC
  5   1   2   14  bld Te5  5g3  in                         CAAO1666.5p ...............................................................................................................................................................TGGATAATGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCNACCATATTGATCTCTCTCT
  5   1   2      seed Tad5                                 XZT33803.5p                                                                                                                                                                       TGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGNGTATGGCATGTTTTTG
  5   1   2       bld Tad5      in                         XZT48846.5p                                                                                                                                                                       TGGGGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATG
  5   1   2       bld Gas1                               IMAGE:6987335                                                                                                                                                                          GGCTGTTCGGCAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAAAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTACCCAAAGAGGTGGTGCATTCAAAAAAAGCCGTCAACAAGCTGTATGCATCCGAGGCTCACATGAACTCCGTGCTAATGAACAAGAAAAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAAAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATCCCCGAGATCCGGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAAAAAAAATGCTGGAGGACACTTTTGAAGGCATGGAAAACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATCGGATTTTGTTTGAAATGCCGGCAGGGGCCTTGGGGAAACCTCCCAGCAAAGTCACAGATGCCTTAACGGATCCTGAAATTGCGGGGGCCATGGCTGCCACATAAAAAAAGGAGGAGGAGGGACTGGAGGCCTTCCGTCCCCGGTCGCCCCCCTCAGGAGTAAGGAGGAAATGTATTTTTTTTTTCTGGGAAACTTCCCTGGTTTTTGAAAGAAATTTTTTTTTGAAAAATTTTGTTTAAATAAAAAA
  5   1   2       bld Tad5                                 XZT56547.5p                                                                                                                                                                                    CAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGACATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCCTATGNGTATGGCATGTTTTTGCACT
  5   1   2       bld Te1       in                         CBWN3437.b1                                                                                                                                                                                    CAAGACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCAGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTCAGAGTCTCCGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCAAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGACATGTAAACTTTCTTTT
  5   1   2       bld Gas7                                 XZG62820.5p                                                                                                                                                                                       GACGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGACATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCCAACATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATGGGGTATGGCATGTTTTTGCACT
  5   1   2       bld Ovi1      in                        CABI10550.5p                                                                                                                                                                                         CGCAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGATTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACTGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGACATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGNGTATGGCATATTTTTGCACTGTGCTCCTCTTTGCT
  5   1   2       bld In66                            IMAGE:8964333.5p                                                                                                                                                                                           TAGGAGAGGCCGCCCAAGGACCTGGTCAATGAATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGAGTTAAGACGTACTGTACATATTCTTATTCTAGGAGACTCCCTGGTTTTGAATGTAACTTTCTTTGTGAAATATTTGGTTATATATATATATATCTCTATACAGCTGTGCTACTTTCTCACATATTGATCTCTCTCTGCTTACACATGTCCTGGGCCATCTGCTATCTATGGGTTGCATGTTTGCACTGTGCTCTCTTGCTACTAGCCACAGCTTATACAGCATCCATCTGTATCTCAGCCACTCCAGCATCTGACGCAGTGATACACTGTAGACGAAGACACACTTTGCTCGAATGGGGAGTAGTCGAGTATTCTTCACATTGA
  5   1   2       bld Mus1      in                         CABH3180.5p                                                                                                                                                                                                                          AATGGTCACTCAAAATCCGGAAAGAAATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGNGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATCTGTTATCTTCAGCCAC
  5   1   2       bld In60                            IMAGE:8950972.5p                                                                                                                                                                                                                                                  GGATGAGCCCGGCACAGGCGTCCTAGCAATGAATAAAAATTCGTCCCGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGCAATCCCCATCTGTTATCTTCAGCCACACTCCAGCAATCTCTGACAGCAAGTGTAGTTATAGCAGCTGTTTAGATCGAGAGACCTACCACCTTTTGTTCTTATCCGGAGAAGT
  5   1   2       bld Te5                                 CAAO11044.5p                                                                                                                                                                                                                                                   AATGCGAGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGNGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCAT
  5   1   2       bld Ovi1      in                         CABI6277.5p                                                                                                                                                                                                                                                        GGGTGATTGACAGACAAATAAGAGATATACAGAGGGAACAGGAGAAAGTCAAGCGGTCAATCAAAGAATCGGCAAAAAAAGGCAACAGGGAGGCCTGTGTGATATTAGCCAAAGAGGTGGTGCATTCAAAGAAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACT
  5   1   2       bld In66                            IMAGE:8966032.5p                                                                                                                                                                                                                                                                                                                                                                                           AAAGCCGTCAACAAGCTGTATGCATCCAAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATCTGTTATCTTCAGCCACAACTCCCAGCATTCTCTGACAGCAAGTTGTAGTATAGCAGCCTGTTTAGAACCGAGAGACTACACACCTTTTGTCTATCGAGATGCTGGAGTACAGTCAGCACAGTAGTCTTCCCTTTCCAAACATATTATGAATTTCGTGGTGATCTGGATGTCCAGAGTAACCTGAGAAGGTTTGCGCCTGGCCCT
  5   1   2       bld Gas7      in                          XZG3589.5p                                                                                                                                                                                                                                                                                                                                                                                                                    TCCAGGCTCACATGAACTCCGTGCTAATGAGCATGAAGAACCAACTGGCTGTTCTTAGAGTCTCTGGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATCTGTTATCTTCAGCCACAACTCCCAGCATTCTCTGACAGCCAAGTTGTAGTATAGCAGCCTGTTTAGAACCGGAAGAGAACTACACACCTTTTGTCTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTCTTCCCTTTTCCAAAACAAT
  5   1   2       bld Gas7      in                         XZG43400.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATCGATTCAATTCGTCGACCCACGCGTCCGGTCATTGCAGAAGAGCACAGAAGTCATGAAGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATCTGTTATCTTCAGCCACAACTCCCAGCATTCTCTGACAGCCAAGTTGTAGTATAGCAGCCTGTTTAGAACCGGAAGAGAACTACACACCTTTTGTCTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTCTTCCCTTTTCCAAACAATATTTATGATTTTTCCTTTGTTTGGATCTGAATTGGCTC
  3   1   2       chi Gas7      in                         XZG52341.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACGCGTCCGGGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGCTGTTTTTACTCCAAAAAAAAAAAT
  5   1   2       chi Gas7      in                         XZG52341.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCCATGCAAAACCTAGTGAAAATACCCGAGATCCAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGCTGTTTTTACTCCAAAAAAAAAAATAAAAAATAAAAAAAAAAAAAAAGG
  5   1   2       bld Tad5                                 XZT32153.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAATCATTGAGGTGAGTGGGGAACCATTAGTTACATGCTGTGATCTGTTTCCTCAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATCTGTTATCTTCAGCCACAACTCCCAGCATTCTCTGACAGCCAAGTTGTAGTATAGCAGCCTGTTTAGAACCGGAAGAGAACTACACACCTTTTGTCTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTCTTCCCTTTTCCAAACAATATTTATGATTTTTCCTTTGTTTGGATCTGAATTGGCTC
  5   1   2       bld Abd0                               IMAGE:7016236                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGGCTACCATGAGAGACCTGTCCAAAGAAATGATGAAGGCAGGTATAATAGAAGAAATGCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACTGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGACATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATATTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATCTGTTATCTTCAGCCACAACTCCCAGCATTCTCTGACAGCCAAGTTGTAGTATAGCAGCCGGTTTAGAACCGGAAGAGAACTACACACCTTTTGTCTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTCTTCCCTTTTCCAAACTATANTTATGATTTTTCTTTG
  5   1   2       bld Neu                            TNeu099e02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGGAGGACACATTTGAAGGCATGGAAGACCAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAAAGGAGGAGGAGGACCTGGAGGCCATGCATCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGGTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCT
  5   1   2       bld Neu                            TNeu039m18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGGATGAGATGGAGGAACAGGCAGAGATGGAAATCGATAGGATCTTGTTTGAAATCACGGCAGGGGCCTTGGGGAAAGCTCCCAGCAAAGTCACAGATGCCTTACCGGAGCCTGAGATTACGGGGGCCATGGCTGCATCCGATGAAGAGGAGGAGGAGGACCTGGAGGCCATGCATTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATCTGTTATCTTCAGCCACAACTCCCAGCATTCTCTGACAGCCAAGTTGTAGTATAGCAGCTTGTTTAGAACCGGAAGAGAACTACACACCTTTTGTCTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTCTTCCCTTTTCCAAAACAATATTTATGATTTTTC
  5   1   2       bld Gas                            TGas022g17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGAGGGACCTGGAGCCATGCAGTCCCGGCTGGCAGCCCTCAGGAGTTAAGGACGTACTGTACATATTCTTATTCTAGGAGACTTCCCTGGTTTTTGAAATGTAAACTTTCTTTTGTGAAAATATTTTGGTTTATATATATATATATCTCTATACAGCTGTGGCCTAACCTTTCCTCCAACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATCTGTTATCTTCAGCCACAACTCCCAGCATTCTCTGACAGCCAAGTTGTAGTATAGCAGCCTGTTTAGAACCGGAAGAGAACTACACACCTTTTGTCTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTCTTCCCTTTTCCAAAACAATATTTATGATTTTTCCTTTGTTTGGATCTGAATTGGCTCAGAGTAAACCCCTGAGGGAAAGTTTGCGCCTGCTCTGTTTTCTCTATGCTTTATTTAGCAGAAAACAATGTTACATATTTTGTGTTGGGGAACCAACGCTAATGGCAGTTGCCCAGGAACCTCCGGCTGCAGGCAATGCCCCCCCCCCC
  5   1   2       bld Tad5      in                         XZT55323.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTTCCTCCACCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATCTGTTATCTTCAGCCACAACTCCCAGCATTCTCTGACAGCCAAGTTGTAGTATAGCAGCCTGTTTAGAACCGGAAGAGAACTACACACCTTTTGTCTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTCTTCCCTTTTCCAAAACAATATTTATGATTTTTCCTTTGTTTGGATCTGAATTGGCTCAGAGTAAACCCCTGAGGGAAAGTTTGCGCCTGCTCTGTTTTCTCTATGCTTTATTTAGCAGAAAACAATGTTACATATTTTGTGTTGGGGAACCAACGCTAATGGCAGTTGCCCAGGAACCTCCGGCTGCAGGCAATGCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAACAACGCTGCTATCGTTTCCTTTATCTCTGTCTCAATGCACTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCA
  3  -1   2       bld Sto1      in                         CABG9058.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGGCCGCATATTGATCTCTCTCTGCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATCTGTTATCTTCAGCCACAACTCCCAGCATTCTCTGACAGCCAAGTTGTAGTATAGCAGCCTGTTTAGAACCGGAAGAGAACTACACACCTTTTGTCTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTCTTCCCTTTTCCAAAACAATATTTATGATTTTTCCTTTGTTTGGATCTGAATTGGCTCAGAGTAAACCCCTGAGGGAAAGTTTGCGCCTGCTCTGTTTTCTCTATGCTTTATTTAGCAGAAAACAATGTTACATATTTTGTGTTGGGGAACCAACGCTAATGGCAGTTGCCCAGGAACCTCCGGCTGCAGGCAATGCCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAACAACGCTGCTATCGTTTCCTTTATCTCTGTCTCAATGCACTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGCTGTTTTTA
  3   1   2       bld Mus1      in                         CABH3180.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTTTACAACCAATGTCCCTGGGCCCATCTGCTATTCCTATTGGGTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCCCTTTATAAACCAGGCAAATCCCCATTTGTTATTTTCAGCCACAACTCCCAGCATTTTTTGACAGCCAAGTTGTAGTATAGCAGCCTGTTTAGAACCGGAAGAGAACTACACACCTTTTGTCTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTTTTCCCTTTTCCAAAACAATATTTATGATTTTTCCTTTGTTTGGATCTGAATTGGCTCAGAGTAAACCCCTGAGGGAAAGTTTGCGCCTGCTCTGTTTTCTTTATGCTTTATTTAGCAGAAAACAATGTTACATATTTTGTGTTGGGGAACCAACGCTAATGGCAGTTGCCCAGGAACCTCCGGCTGCAGGCAATGCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCTGTCTCAATGCACTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGCTGTTTTACTCC
  3   1   2       bld Ovi1      in                         CABI6277.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTATGGCATGTTTTTGCACTGTGCTCCTCTTTGCTACTTTAAGCCCCAGCAGCACTTTATAAACCAGGCAAATCCCCATTTGTTATTTTCAGCCACAACTCCCAGCATTTTTTGACAGCCAAGTTGTAGTATAGCAGCCTGTTTAGAACCGGAAGAGAACTACACACCTTTTGTTTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTTTTCCCTTTTCCAAAACAATATTTATGATTTTTCCTTTGTTTGGATTTGAATTGGCTCAGAGTAAACCCCTGAGGGAAAGTTTGCGCCTGCTCTGTTTTCTTTATGCTTTATTTAGCAGAAAACAATGTTACATATTTTGTGTTGGGGAACCAACGCTAATGGCAGTTGCCCAGGAACCTCCGGCTGCAGGCAATGCCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCTGTCTCAATGCACTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGCTGTTTTTACTCC
  5  -1   2       add Sto1      in                         CABG9058.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGGGCAAATCCCCTTTTGTTTTTTTAAGCCACAATTCCCAGCTTTTTTTGACAACCAAGTTTTAGTTTACCCCCCTTTTTAGACCCGGAAGAGAATTCCCCCCCTTTTTTTTTTCCGAAAATGTTGGGGGGTCCATTTCACCACCGGGTTTTTTTTCCTTTTTCCAAAACAAAATTTAGGATTTTTCCTTTGTTGGGATTGGAATGGGCCCAGGGAAAACCCCTGGGGGAAATTTTGCCCCTCCTTTTTTTTTTTTAGGCTTTTTTTGGCAGAAAACAATGTTCCATTTTTTGGGTGGGGGAACCAACGTTAATGGCAGTTGCCCGGGAACCTCCGGGTGCGGGAAATGCCCCCCCCCCCCCCACGGGTGCCAAGTTTCCCCTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATTTCGGTCTCAATGCCCTTGAAGCATTACAGACCCCTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTTTGGGCAAGATACCCTTAGTGAGGTAGCACCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGCCCGTAGGCCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTTTAGGGAAGGGAAACAGCGGGCCCCTGTACATTTAT
  3   1   2       add Ovi1      in                        CABI10550.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGCCACAACTCCCAGCATTTTTTGACAGCCAAGTTGTAGTATAGCAGCCGGTTTAGAACCGGAAGAGAACTACACCCCTTTTTTTTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTTTTCCCTTTTCCAAAACTATATTTAGGATTTTTCCTTTGTCGGGATTTGAATTGGCTCAGAGTAAACCCCTGAGGGAAAGTTTGCCCCTGCTCTGTTTTCTTTATGCTTTATTTAGCAGAAAACAATGTTACATTTTTTGTGTGGGGGAACCAACGTTAATGGCAGTTGCCCAGGAACCTCCGGCTGCAGGCAATGAAACCCCCCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCCGTCTCAATGCACTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGCTGTTTTTACTCC
  3   1   2       bld Gas7 5g3  in                         XZG23476.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTCAGCCACAACTCCCAGCATTCTTTGACAGCCAAGTTGTAGTATAGCAGCCTGTTTAGAACCGGAAGAGAACTACACACCTTTTGTCTATCCGAGAATGCTGGGAGGTACAGTTCAGCAACAGGTTAGTCTTCCCTTTTCCAAAACAATATTTATGATTTTTCCTTTGTTTGGATCTGAATTGGCTCAGAGTAAACCCCTGAGGGAAAGTTTGCGCCTGCTCTGTTTTCTCTATGCTTTATTTAGCAAAAAACAATGTTACATTTTTTGTGTTGGGGAACCAACGCTAATGGCAGTTGCCCAGGAACCTCCGGCTGCAGGCAATGCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCTGTCTCAATGCACTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGCTGTTTTTACTCCAAAAAAAAAATT
  3   1   2       add Te5  5g3  in                         CAAO1666.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCAGCATTTTTTGACAGCCAAGTTGTAGTATAGCCCCCTGTTTAGACCCGGAAGAGAACTCCCCCCCTTTTTTTTTTCCGAGAATGCTGGGAGGTCCAGTTCACCACCAGGTTATTTTTCCCTTTTCCAAAACAAAATTTAGGATTTTTCCTTTGTTGGGATCGGAATTGGCCCAGAGTAAACCCCTGAGGGAAAGTTTGCCCCCCCTCTGTTTTCTCTAGGCTTTATTTAGCAGAAAACAATTTTCCATTTTTTGTGTTGGGGAACCACCCCTAATGGCAGTTGCCCAGGAACCTCCGGCTGCAGGCAATGCCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCTGTCTCAATGCACTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGCTGTTTTTACTCC
  3   1   2       add Tad5      in                         XZT48846.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCCTTTTTAGACCCGGAAGAGAACTCCCCCCCTTTTGTTTTTCCGAAAATGTTGGGGGGTCCATTTCACCAACGGGTTATTTTTCCTTTTTCCAAAACAATATTTAGGATTTTTCCTTTGTTGGGATTGGAATGGGCTCAGAGTAAACCCCTGGGGGAAAGTTGGCCCCCGCTCTGTTTTCTTTAGGCTTTTTTTAGCAGAAAACAATTTTACATTTTTTGTGTGGGGGAACCAACGTTAATGGCAGTTGCCCAGGAACCTCGGGTTGCGGGAAATGCCCCCCCCCCCCCCACGGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCTGTCTCAATGCACTTGAAGCATTACAGACCACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATACCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTTTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGGCTGTTTTTCCTCC
  3   1   2       add Te5  5g3  in                        CAAO11593.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTTTGGACCCGGAAGAGAACTCCCCCCCTTTTGTTTTTCCGAAAATGCTGGGGGGTCCATTTCACCACCAGGTTATTTTTCCCTTTTCCAAAACAAAATTTAAGATTTTTCCTTTGTTGGGATCGAAATGGGCTCAGAGTAAACCCCTGGGGGAAAGTTTGCCCCCGCTCTTTTTTCTTTAGGCTTTATTTGGCGGAAAACAATTTTCCATTTTTTGTGTGGGGGAACCAACCCTAATGGCAGTTGCCCGGGAACCTCCGGTTGCAGGAAATGCCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCTGTCTCAATGCCCTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATACCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGCCCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGGCTGTTTTTACTCCC
  3   1   2       add Te5  5g3  in                         CAAO6883.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTTTTTAGACCCGGAAGAGAACTCCCCCCCTTTTGTTTTTCCGAGAATGCTGGGGGGTACATTTCACCAACAGGTTATTTTTCCCTTTTCCAAAACAAAATTTAGGATTTTTCCTTTGTTGGGATCGAAATGGGCCCAGAGTAAACCCCTGGGGGAAAGTTTGCCCCCCCTCTGTTTTCTCTAGGCTTTTTTTAGCAAAAAACAATTTTCCTTTTTTTGTGTTGGGGAACCAACGTTAATGGCAGTTGCCCGGGAACCTCGGGCTGCAGGAAATGCCCCCCCCCCCCACCGGTGCCAAGTTTCCCCTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCTGTCCCAATGCCCTTGAAGCATTCCAGAACCCTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTTTGGGCAAGATACCCTTAGTGAGGTAGCACCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGCCCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTTTATGGAATGGAAACAGCGGGACCCTGTACATTTAT
  3   1   2       add Tad5      in                         XZT55323.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGTTTAGAACCGGAAGAGAATTACCCCCCTTTTTTTTTTCCGAGAATGTTGGGGGGTCCAGTTCAGCAACGGGTTAGTTTTCCCTTTTCCAAAACAATATTTAGGATTTTTCCTTTGTTGGGATCGGAATTGGCTCAGAGTAAACCCCTGGGGGAAAGTTTGCCCCTGCTCTGTTTTCTTTATGCTTTATTTGGCGGAAAACAATGTTACATTTTTTGTGTGGGGGAACCAACGTTAATGGCAGTTGCCCGGGAACCTCCGGTTGCGGGAAATGCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATTTCTGTCTCAATGCACTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGGCTGTTTTTACTCC
  3   1   2       add Brn4 5g3  in                        CAAL18076.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTAGAACCGGAAGGGAACTACCCCCCTTTTGTTTTTCCGAGAATGTTGGGGGGTACAGTTCAGCAACAGGTTATTTTTCCTTTTTCCAAAACAATATTTAGGATTTTTCCTTTGTTGGGATCTGAATGGGCTCAGAGTAAACCCCTGGGGGAAAGTTTGCCCCTGCTCTGTTTTCTTTAGGCTTTATTTAGCAAAAAACAATGTTACATTTTTTGTGTTGGGGAACCAACGTTAATGGCAGTTGCCCGGGAACCTCGGGTTGCAGGCAATGCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCTGTCTCAATGCACTTGAAGCATTACAGACCACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTTTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGGCTGTTTTTACTCC
  3   1   2       add Gas7      in                          XZG3589.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGAGAACTACCCCCCTTTTGTTTTTCCGAAAATGTTGGGGGGTACATTTCACCAACAGGTTATTTTTCCCTTTTCCAAAACAAAATTTAGGATTTTTCCTTTGTTGGGATCGAAATGGGCTCAGAGTAAACCCCTGAGGGAAAGTTGGCCCCCCCTCTGTTTTCTCTAGGCTTTATTTAGCAGAAAACAATTTTACTTTTTTTGTGTTGGGGAACCAACGCTAATGGCAGTTGCCCAGGAACCTCGGGCTGCAGGAAATGCCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTACTATCGTTTCCTTTATCTCTGTCTCAATGCACTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGGCTGTTTTTCC
  3   1   2       add Gas7      in                         XZG43400.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATGGGCCCAGGGTAAACCCCGGGGGGAAATTTTGCCCCCCCTCTTTTTTTTTTAGGCTTTTTTGGGCGGAAAACAATTTTCCTTTTTTTGGGTGGGGGAACCAACCTTAATGGCGGTTGCCCGGGAACCTCGGGGGGGGGGAAATGCCCCCCCCCCCCCCCCGGGGGCCAAGTTTCCCCTTTAAGTGCAGCAGAGCAACGCTACTTTGGTTTCCTTTATTTCGGTCTCAAGGCCCTTGAAGCATTACAGACCCCTATGAATTTCCTGTTGGGGATAAAATTTGGTATTGTCATTTTCCGGGTTTGTTGAGGGGAATTTTTGGGCAAGATACCCTTAGGGGGGTAGCACCCAGCTGAGCTTTGTTTCAGGTAGTAACTGTGCTGAACCTGCCCGTAGGGCCATG
  3   1   2       add Tad5 5g3  in                          XZT6551.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACCCCTGGGGGAAAGTTGGCCCCCCCTCGGTTTTCTCTAGGCTTTATTTGGCGGAAAACAATTTTACTTTTTTTGTGTTGGGGAACCAACCTTAATGGCAGTTGCCCGGGAACCTCGGGTTGCGGGCAATGCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCTGTCTCAATGCACTTGAAGCATTACAGAACCCTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATACCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGCCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTTTATGGAATGGAA
  3   1   2       chi Te1       in                         CBWN3437.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCAATGCCCCCCCCCCCCCCACCGGTGCCAAGTTTCCACTTTAAGTGCAGCAGAGCAACGCTGCTATCGTTTCCTTTATCTCCGTCTCAATGCACTTGAAGCATTACAGAACACTATGAATTTCCTGTATGAGATAAAATATCGTATTGTCATATTCCGGGTTTGTTGAGGTGAATTTCTGGGCAAGATAGCCTTAGTGAGGTAGCAGCCAGCTGAGCTCTGTATCAGGTAGTAACTGTGCTGAACCTGACCGTAGGGCCATGGGTGAGAGTCTGTAAATGTGTAAGAATGACTGTATTTTTCTATGGAATGGAAACAGCGCGACCCTGTACATTTATTAAAGGCTGTTTTTACTCCACGGCTGTTGTGCATTTCCTTCAGTGCTTCTGCCGGCCGCACACACACCCAGTACAGGTTCAGATATTGGCTGCTGCTTGAGACGCAATAGAAATTACATTACGTTACTTTACATCTGCAGAAATGAAAATTGCATTTAATTAAAGAAGAACAATAGAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)