Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI7975.3.5                         94 END     1           1        1                CXXC finger 1 (PHD domain) [Xenopus tropicalis]
     2   2.0    0Xt7.1-XZG8897.5.5                          86 END     1           1        1                similar to chromosome 11 open reading frame 10 [Gallus gallus]

 This cluster: approximate FL confidence score = 93%

 1012073444 Xt7.1-CABI11827.3 - 53 ESTs
                                                                       -200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABI11827.3                                                                                                                                                                                                         TGAGCTGCTGCTGGAGGTGCCGGAGTGAGGGAGGGAAGGCACATGTAGGAGATATAGTGCCCCGGAACCTGGATTAGTTATTTCTATAAGGATTTGTACGCGGGGCATTAGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATTAAAAAAAAAAGTAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008225493                                                                                                                                                                                                               GCTGCTGGAGGTGCCGGAGTGAGGGAGGGAAGGCACATGTAGGAGATATAGTGCCCCGGAACCTGGATTAGTTATTTCTATAAGGATTTGTACGCGGGGCATTAGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATTAAAAAAAAAAGTAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                              2     4     2     4     2     5     3     9     5    10     5    10     6    11     7    12     7    12     9    12     9    13    13    14    14    15    15    16    16    18    16    18    18    19    20    21    21    21    22    22    22    22    22    22    21    22    21    22    22    23    22    23    23    23    23    23    24    25    24    25    23    24    23    25    23    25    24    25    24    25    24    25    25    26    25    26    25    26    26    27    24    28    25    28    25    27    23    27    24    28    24    28    23    28    24    28    24    28    23    28    31    36    32    37    32    37    32    37    30    37    32    37    33    38    33    38    33    38    33    38    34    38    35    39    36    40    36    40    36    41    35    41    35    39    36    39    36    40    35    40    34    39    34    39    34    38    34    37    34    37    34    37    34    36    34    36    32    34    31    33    31    33    31    33    30    33    32    33    29    30    28    30    28    30    27    28    27    28    27    28    27    28    26    27    26    27    25    27    23    24    23    24    23    26    24    26    24    26    24    26    23    26    23    26    23    26    22    25    22    25    22    24    22    24    22    24    21    23    21    23    18    21    17    19    12    14     5     8     4     6
                                                                   VAR                                                                                                                                                                                                                                                                                                                                 AATCGCAGGGGA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                             -------GA---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------AG
                                               BLH ATG     173       7                                                                                                                                                                                                         
                                               BLH MIN     173      62                                                                                                                                                                                                         
                                               BLH OVR     173     317                                                                                                                                                                                                         
                                               ORF LNG     173      23                                                                                                                                                                                                         
                                                                                                                                                                                                                              PROTEIN --- Dm ---- 1e-009     NP_525120.1 Nucleolar protein at 60B CG3333-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 1e-010     NP_499370.1 centromere microtubule binding protein like (50.2 kD) (3L839) [Caenorhabditiselegans] ---------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xl ---- 2e-021     AAI29716.1 Unknown (protein for MGC:160403) [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - ?? ---- 2e-021     NP_001091191.1 hypothetical protein LOC100036957 [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Xt ---- 1e-022     AAH84478.1 Hypothetical LOC496499 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Sc ==== 2e-023     NP_014107.1 catalyzes formation of Psi55 (modified uridine) in mitochondrial and cytoplasmictRNAs; Pus4p [Saccharomyces cerevisiae] ===============================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---= 3e-062     XP_001201653.1 PREDICTED: similar to TruB pseudouridine (psi) synthase homolog 1 (E. coli) [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Dr ==== 1e-096     XP_684583.1 PREDICTED: similar to TruB pseudouridine (psi) synthase homolog 1 [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                        PREDICTED - Mm ---- 1e-097     NP_082391.1 RIKEN cDNA 2610009I02 [Mus musculus] -------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Gg ==== 5e-099     XP_421776.1 PREDICTED: similar to TruB pseudouridine (psi) synthase homolog 1 [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                    PROTEIN --- Hs ---- 4e-100     NP_631908.1 TruB pseudouridine (psi) synthase homolog 1 [Homo sapiens] ---------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABI11827.3                                                                                                                                                                                                                                                                                   TAG---------TAA------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAATGTGA---TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------TGA---TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   1           TbA  FL                     TTbA069n10.FL-Sanger                                                                                                                                                                                              GGAAGAGGAAGTGAGCTGCTGCTGGAGGTGCCGGAGTGAGGGAGGGAAGGCACATGTAGGAGATATAGTGCCCCGGAACCTGGATTAGTTATTTCTATAAGGATTTGTACGCGGGGCATTAGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGACTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACAGACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATTAAAAAAAAAAGTAAAAAAAAAAAAAAAAAAAA
  5   1   2   12  bld Ovi1 5g3  in                        CABI11827.5p GGCGGCAGTAGTTTAGTGCATTAGTGTTTAGTTTGCAGCAGCGTCTCTTCCCTCCCACACTCCCGCACCTGCTTTGCTTGCCAAAAACCCAATCTCCCCCCTCCCTGCTCTGTTGTGACTGGCCTGGTAGGAGAAGGAACCGTGTGATTGGCTGTAGGTGATCACATGGTAGCAGGAATCCCCAGGACAGGAAGAGGAAGTGAGCTGCTGCTGGAGGTGCCGGAGTGAGGGAGGGAAGGCACATGTAGGAGATATAGTGCCCCGGAACCTGGATTAGTTATTTCTATAAGGATTTGTACGCGGGGCATTAGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAA
  5   1   2       bld Neu  5g                        TNeu090n18.p1cSP6                                                                                                                                                                                 GGAATCCCCAGGACAGGAAGAGGAAGTGAGCTGCTGCTGGAGGTGCCGGAGTGAGGGAGGGAAGGCACATGTAGGAGATATAGTGCCCCGGAACCTGGATTAGTTATTTCTATAAGGATTTGTACGCGGGGCATTAGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGTTACGGAGCGCGTGGGGGGGGATTCGCTGTCAAACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGT
  5   1   2       chi Gas7      in                         XZG25017.5p                                                                                                                                                                                           ATCCCCAGGACAGGAAGAGGAAGTGAGCTGCTGCTGGAGGTGCCGGAGTGAGGGAGGGAAGGCACATGTAGGAGATATAGTGCCCCGGAACCTGGATTAGTTATTTCTATAAGGATTTGTACGCGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGCTCGCTCTTAGGTGTCAGTGACCTTGCACATACTCAGTGAGTTCCCTGCTGCTGCTTTTGAGCATGCTCAGATTGTACCCACCCAGAGGCAGGGAAGCGTATACATGAAGATATGACTGACCCTGTATATACCCACATATGTGGGTCATCGACAATAAATGATTTTGCAGAATAACTTTGCTTCATTCTCACCATACCT
  5   1   2       bld TbA  FL   in                   TTbA069n10.p1kSP6                                                                                                                                                                                                AAGAGGAAGTGAGCTGCTGCTGGAGGTGCCGGAGTGAGGGAGGGAAGGCACATGTAGGAGATATAGTGCCCCGGAACCTGGATTAGTTATTTCTATAAGGATTTGTACGCGGGGCATTAGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGACTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTG
  5   1   2       bld Neu0 5g                            IMAGE:6994096                                                                                                                                                                                                                                GAGGGAAGGCCATGTAGGAGATATAGTGCCCCGGAACCTGGATTAGTTATTTCTATAAGGATTGTACGCGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGACTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGGTCATGATTTGGGGAAAGCACTGAAGAGCTGTGCGAGTGTGAAAGGAACTTGGTCCGTACCAAGCAGGGGTCCCCTTTTACCCTTGGAGGATCACACCCTGGAAAGGAAGAAGAACTGGAAACATCAATTCCGGAATAGCGCAAGGCAT
  5   1   2       bld Gas1 5g3  in                     NISC_mq12d08.y1                                                                                                                                                                                                                                     CCGGAGTGAGGGAGGGAAGGCACATGTAGGAGATATAGTGCCCCGGAACCTGGATTAGTTATTTCTATAAGGATTTGTACGCGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGC
  5   1   2       chi Tbd0 5x                            IMAGE:6980637                                                                                                                                                                                                                                       GGGAGGGAGGCCATGTAGGAGATATAGTGCCCCGGAACCTGGATTAGTTATTTCTATAAGGATTTGTACGCGGGGCATTAGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACTCGCTGGATGCTTCTCGCTCAGTATCAGAAGATTGACCTTTTGACCACCTCACTTAGGAAAACTTGAAGGGGGTACTGCACTTAATTACTGGCACCATTCTGCATGTCCCCCTCTCATCTCTATATAATATGGTGTGATCATGACTTTTTGCCTGCTACTATACTCTGCTGAGTGGGGCAAATCTGCTAGGCATGTCTTACTTCTTTCGTCTCTGGACATTCACTCCTATTTGATTTTGGTTCATTCTCCGTGCCTTGCTTATAGCTGTTCACTTCGCTTCTGGTAGTCTCACACTCTTCATTTTTCTATTAGGTCTCCG
  5   1   2       bld Neu0 5g                            IMAGE:6994478                                                                                                                                                                                                                                          GGGAAGGCCATGTAGGAGATATAGTGCCCCGGAACCTGGATTAGTTATTTCTATAAGGATTTGTACGCGGGGCATTAGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACCGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCCAGCCCCAGTTTTTTACTCCTTGAATGTTAANTGCGGAAAGTTGGTTTTTATGTTAAGAAGCCCTGGGTCAATGAATTTGGGGGAAAAGCACCTGGAAAAACCCTGTGTCCGAATTGTTGAAAGGGGAAACTTTGTTCCCGGTAACCAAAGCT
  5   1   2       bld Gas8 5x3  out                        st106l02.5p                                                                                                                                                                                                                                           ATGTAGGAGATATAGTGCCCCGGAACCTGGATTAGTTATTTCTATAAGGATTGTACGCGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGACTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCC
  5   1   2       bld Gas8 5g                               st70n17.5p                                                                                                                                                                                                                                                    TGTAGGAGATATAGTGCCCCGGAACCTGGATTAGTTATTTCTATAAGGATTTGTACGCGGGGCATTAGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCCAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAG
  5   1   2       bld Gas8 5x3  out                         st39f18.5p                                                                                                                                                                                                                                                                             CTGGATTAGTTATTTCTATAAGGATTTGTACGCGGGGCATTAGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCNAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGC
  5   1   2       bld Egg  5g                        TEgg141d12.p1kSP6                                                                                                                                                                                                                                                                                          TTCTATAAGGATTTGTACGCGGGGCATTAGGGGCATTAGGGCGGTGCCAGGAGGCGCAATCGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAGGGCTCCTTACTGAAAGAAGCCGGACTGAAGGAATATGTGA
  5   1   2       bld Gas8 5g3  in                          st19o12.5p                                                                                                                                                                                                                                                                                                                           AGGCGCAATCGCAGGGGAAGGCGCAGACGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGACTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGANGTGGGTTTTATGTAANA
  5   1   2   12  bld Gas7 5g3  in                         XZG45869.5p .........................................................................................................................................................................................................................................................................................................................................AGGAGGCGCAATCGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGC
  5   1   2   12  bld Gas7 5g3  in                         XZG52019.5p .................................................................................................................................................................................................................................................................................................................................................CAATCGCAGGGGAAGGCGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTT
  5   1   2       bld Hrt1 5g3  in                         CAAQ5806.5p                                                                                                                                                                                                                                                                                                                                                                  CGCAGACGTTACGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGNGAATGAATGTGAGTTTAAACAGC
  5   1   2   10  bld Lun1 5g3  in                         CABD1658.5p ............................................................................................................................................................................................................................................................................................................................................................................CGGGAGCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGC
  3   1   2       chi Gas7      in                         XZG25017.3p                                                                                                                                                                                                                                                                                                                                                                                 GCGCATGGCGGGGGATTCGGCTGTCAGACTGTTAGCGCTGAGCGGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAATTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGCTCGCTCTTAGGTGTCAGTGACCTTGCACATACTCAGTGAGTTCCCTGCTGCTGCTTTTGAGCATGCTCAGATTGTACCCACCCAGAGGCAGGGAAGCGTATACATGAAGATATGACTGACCCTGTATATACCCACATATGTGGGTCATCGACAATAAATGATTTTGCAGAATAACTTTGCTTCATTCTCACCATACCTTTGGGTTTCCATATCACTTGGCAGGGAGCCTCCTACATATTCCAGTAATTATACAGTGTTGTTGGATATGATTGACTGGGCTAAAGGCCATTTGTGGTCATCTTTAGTATGGAATGTATAACTGTACCTGAACTAATAAACCCCTTCTGGTATCCCCGGGC
  3  -1   2       bld Ovi1      in                         CABI4010.3p                                                                                                                                                                                                                                                                                                                                                                                                  TCGGCTGTCAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGT
  5   1   2       bld Ovi1      in                         CABI6919.5p                                                                                                                                                                                                                                                                                                                                                                                                          CAGACTGTTAGCGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGNGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCT
  5   1   2       bld Ovi1      in                         CABI8820.5p                                                                                                                                                                                                                                                                                                                                                                                                            CATCGATTCGGCTGAGCGGGCTGTTCCCGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCC
  5   1   2       bld Gas7                                  XZG8920.5p                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGTGTATAAGCCCAAGGGCCCCACCTCAGCGCAAGTAGTGGCGCAACTAAAGGGCTCCTTACTGAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGNGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTACAGGGC
  3   1   2       bld Ovi1      in                         CABI6919.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAAGAAGCCGGGCTGAAGGAATATGTGAAGAAAAGGAAACAGACCNTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGAT
  5   1   2       bld TbA       in                   TTbA011l19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAATATGTGAAGAAAAGGAAACAGACCCTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACAT
  3   1   2       bld Tad0      in                       IMAGE:6982201                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGAAAACCCTTCTTATATGCCCCCTTTAGGGGCGCTATTTTGGGGGGCGCCTCTTATTGAGAACAAGTTTTGTTACAAAAAAAAGGCCGGGCGGGGGCACCGGTTCCGGGATTTCCCGGGAATGGGGGAAGGGCCACAGGACCCGGCGGGATGCTTCCGGGCCCCGTTAACGGAAAGAAAAACTTTATGGCCCACATCCCTAAGGGAAGACTTGGAGGGGGGCGTGGAAGTTTTTTTACAGGAAACATCAGGCAGGTCCCCCCTCTCTTTTTAGCACTGAAAAGGGACGGAAAAAGATTTTCTTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTACTTGTGTTTACACAGACCACAGTGAGAAGTAGACCAGTGGAGGGCATAACANATCACCTCACAAGCAAGAACAGTGACAGAATTAACCCAACTCATGGGCATAATTTCACGTGCCAACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGGTGGTTCGACCTGACGGTAGTCGGAGGCCAGGACTGACTACATTTCTTTGATT
  5   1   2       bld Hrt1      in                         CAAQ7243.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGAGGTGAAGATTGGCCACGGGGGGACCCTGGATAGTTCCGCCTCAGGGGTGCTTGTAATTGGCATCGGGGATGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAGTGCTTTTCCCAAATCATTGACCAGGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCT
  5   1   2       bld HeRe      in                     EC2CAA35BG01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTACCGGTCCGGAATTCTTTTTTTATGGCCGGGCACCAAGATGCTGAGCACAATGCTTGCAGGGTCCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACACTGGATGCATCGGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGGAAAAGACTTTCCTGCCTGCTGCGAGACGGCTCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAGGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGCCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTA
  5   1   2       bld Gas7      in                         XZG50924.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGGGTCAAGAAATACACAACGGTGGGTGAGCTGGGGAAGGCCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCTCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGNGAGCCACAAGTGCCACTATT
  5   1   2       bld Tad0      in                       IMAGE:6982201                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGGAAGGCCACAGACACGCTTGACGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCTGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAAGCATTGAAAAGGGCAAGTAAATTTTCCCTGCTCGCAGAAGGGAGCGGCCTTCTGAAAATTCCATTTTTGCTGCGGTCCGGAACTTCCGGGAACGAAGCCCCTGGCGCCCCTAACAGAGGCCCACCGGGGAATTCTTCGGAGGGGAACCCCTTTTTTCCTTGGTGGTTTCCAACAGGCCCCAGGTGGGAAGATAAACCCCGTTGGGGGGGGCCTACCAAATTCCCCTTCCCAGCCAAGAAACGTGTGGCAAAATTTAACCCCACCTCCTGGGGGCTATAATTTTTCCGGTGGCCCAACTTGGGGGGGACCCACCCAAGTTGCCCCACTTATTTTAACCGGAAATTCCAAAAAACCTTGGGTCTCAACCTTGGAACGGTAACTCCGGAAGGCCCCCCGAAATGGAACTAACCTTTTCCTTTGAAATCCCATTTATTGTTTTAACTTTAAAAAAAAAGAAAAAAAATAAAAAAAAGGGGGGGCCGCCCCCCCCTAAAGATATATCTCCCTCGAAAGGGGGCCCCAAACTTTTACACCGCATATCCCAACCTTTTCTCTGTGTACAACAGAGTGTGCCCCCTTAAGAGTGGAGCCCCAATTTATAACCCCCTGGGGCCGGG
  3   1   2       bld Hrt1      in                         CAAQ7243.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACAGACACGCTGGATGCATCAGGCACAGTAACAGAAGAAAAACCTTATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAGTGCTTTTCCCAAATCATTGACCAGGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGAT
  3   1   2      seed Ovi1 5g3  in                        CABI11827.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGACCACATCACTAAGGAAGACTTGGAGGGGGCGCTGAAGTTATTTACAGGAAACATCATGCAGGTCCCCCCTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATTAAAAAAAAAAGT
  3   1   2       bld Egg       in                    TEgg055o23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATTAAAAAAAAAAGTAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg055o23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTCTTCTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATT
  3   1   2       bld Hrt1 5g3  in                         CAAQ5806.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATTAAAAAAAAAAGT
  3   1   2       bld Lun1 5g3  in                         CABD1658.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATTAAAAAAAA
  5  -1   2       bld Ovi1      in                         CABI4010.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATCAAAAAAAAAAACGAATCGATGG
  3   1   2       bld Ovi1      in                         CABI8820.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTATATTTCTTTGATTCATTTATTTTTAATTAAAAAAAAAAGT
  3   1   2       bld HeRe      in                     EC2CAA35BG01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCACTGAAAAGGGACGGGAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAGGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGCCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAGAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACAGACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCGCGACTGACTAC
  3   1   2       bld Gas7 5g3  in                         XZG45869.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTT
  3   1   2       bld TbA  FL   in                    TTbA069n10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCACTGAAAAGGGACGGAAAAAGACTTTCCTGCCTGCTGCGAGACGGCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTTTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACAGACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATTAAAAAAAAAAGTAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld TbA       in                    TTbA011l19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCCGAGGTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTTTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATTAAAAAAAAAGGTAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas7      in                         XZG50924.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGAGGCAAAGCCGGCCAGGCCTGTGACTGTCTATCAGCTGTCTCTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATT
  3   1   2       bld Gas8 5g3  in                          st19o12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAGGCCTGTGACTGTNTATCAGCTGTCTTTGAGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTNGGATNTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTTTGAGAATCCATTTGCTGCGTCCGGACATNGGGAACGAGCCCTGCGCTNTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTNTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTNTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCAACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTC
  3   1   2       bld Egg  5x3  ?                     TEgg030g14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATTAAAAAAAAAAAAAGGAAAAANAAAGC
  3   1   2       bld Gas7 5g3  in                         XZG52019.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAGACTTCCAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATT
  3   1   2       bld Gas8      in                          st45j12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCCCCCAGTTTTTACTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACG
  5   1   2       bld Gas8      in                          st45j12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCTTGATGTTGAGTGCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATTAAAAAAAAAA
  3   1   2       bld HeRe      in                     EC2CAA15BG11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGCCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAGAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACAGACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGGCCTGACGGTAGTCGGAGGCCACGACTGA
  5   1   2       bld HeRe      in                     EC2CAA15BG11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGAGGTGGGTTTTATGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGCCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAGAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACAGACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGGCCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTT
  3   1   2       bld Gas1 5g3  in                     NISC_mq12d08.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTAAGAAGCCTGGTCAATGATTTGGGAAAAGCACTGAAGAGCTGTGCGAGTGTGAAGGAACTTGTCCGTACCAAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACTGGAACATCAGTCGGATAGCGCAGGCACTGCAGGAATACGGTCCCCTCCTTCCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATGAATGTGAGTTTAAACAGCCTTGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATTAAAAAAAAAAGTAAAAAAAAAAAAAAAG
  5   1   2       bld TbA                            TTbA023g12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGAACTTGTCCGTACCAGCAGGGTCCCTTTACCCTGGAGGATCACACCCTGAAAGAAGAAGACCGGAACATCAGTCGGATAGCGCAGGCACCGCAGGAATACGGTCCCCTCCTTTCAGCAGAGCCGGGCAACAAGCGGTTAAAGAAGGAAAATGCAGATAATACAGTCGGATCTGGGGAATCGAATGTGAGTTTAAACAGCCTCGAAAGCATTGAAAGGGCAAGTAATTTTCCTGCTCGCAGAGGGAGCGGCTTCTGAGAATCCATTTGCTGCGTCCGGACATCGGGAACGAGCCCTGCGCTCTAACAGGGCCACGGGATTCTCGAGGGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCAACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTA
  5  -1   2       bld Lun1      in                         CABD6388.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGACCCTTTTCTTGTGTTTCACAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATT
  3  -1   2       bld Lun1      in                         CABD6388.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGACCCTTTTCTTGTGTTTCCAGCCCAGTGGAGTAGCCGTGGGGGCTACAATCCCTCCAGCAGAACGTGCAGATTACCCACTCTGGGCTAATTTCCGTGCCACTTGGGAGCCACAAGTGCCACTATTTAACGGAGTCGAGAGCTGGTTCGACCTGACGGTAGTCGGAGGCCACGACTGACTACATTTCTTTGATTCATTTATTTTTAATTAAAAAAAAAAGTAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)