Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Oct 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG33371.5                            4 END     1           1       25                utrophin [Homo sapiens]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 353.0    0Xt7.1-TGas143k02.3                         39 PI      74        193      971                dystrophin (muscular dystrophy, Duchenne and Becker types) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012073529 Xt7.1-CABC2006.3 - 51 ESTs
                                                                       .....-1010.....-1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABC2006.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTCTAGGTGACTTAAATAATGTGCGCTTTTCTGCTTATCGCACTGCCATGAAGATAAGAAGACTACAGAAAACATTGTGCTTGGACCTCCTGGAACTGAGTACAACACACAGCATTTTCAAACAACATGAACTGAATCAAAACAATCAACTGCTATCAGTCCCGGAAGTTATCAGTGTCCTCACTACCGTCTATGATGGACTAGAGCAGAAGCACAAGGAACTGGTGAACGTACCACTCTGCATCGATATGTGTCTAAATTGGCTGCTAAATGTTTATGACACAGGTCGAACTGGTAAGCTACGAGTCTTGTCCCTGAAGATTGGGCTCATGTGTTTATCTAAAGGCCTTCTAGAAGAGAAATACAGACATCTCTTTAAGGAAATATGTGGGGCAGGAGATACATGTGACCAGAGGCAGCTTGGCTTGCTACTTCATGATGCCATCCAAATCCCACGCCAGCTTGGGGAAGTGGCAGCCTTTGGAGGGAGTAACATTGAGCCAAGTGTACGCAGCTGCTTTCAACATGCTCAAAATAAACCCGAAATTGATGTCAAGCATTTTATTGAGTGGATGCGCTTGGAACCTCAGTCTATGGTATGGCTACCTGTACTACACAGAGTAGCCGCTGCTGAAACTGCTAAGCATCAAGCCAAGTGTAACATCTGTAAAGAATGCCCCATTGTTGGATTCAGGTACAGGAGTCTAAAGCATTTTAACTATGATGTGTGCCAAAGTTGCTTCTTTTCTGGAAGGACAGCAAAGGGTCACAAGCTACATCACCCAATGGTGGAATACTGCACTCCTACAACATCAGGGGAGGATGTTCGGGACTTCACCAAGGTGCTGAAGAACAAATTCCGCTCCAAGAAATATTTTGACAAACATCCCAGGCTAGGTTACTTGCCGGTCCAGACAGTGCTGGAAGGGGACAACATGGAGACTCCTATAACCCTTATCAGCATGTGGCCTGATCAGTTTGATGGTATGCACTCCCCGGAACTGCTTGATGATGACACGCACTCGAGGATAGAGCAGTATGCCAGCAGGCTGGCACAAATGGAACGAACCAATGGTTCACTGTTCACTGACAGCAGCTCTGCCACCGGGAGTATGGAGGATGAGCATGCCCTTATCCAGCAGTACTGTCACACCCTGGGAGGAGATTCGCCCATTGGACAACCGCAGAGTCCAGCCCAGATATTGAAGTCAGTAGAAAAAGCAGAGAGGGGAGAGTTGGAGCATATTATTGCTGATCTGGAGGAAGAACAAAGAAACTTGAAGATTGAGTATGAGCAGCTGAAAGCACAGCACTTGCGAAGGGGCCTGACCCCGCCATCGTCGCCCCCGGACTCTGTGCTATCCCTGCAGCACAATTCGGAGGATGCAGAACTCATTGCAGAGGCAAAACTGCTCAGACAGCACAAAGGGCGCCTGGAAGCTAGAATGCAAATTTTAGAAGACCACAACAAACAGTTGGAGTCCCAGCTTCATCGATTACGTCAGTTATTAGAGCAGCCTGAATCAGAGTCCAGGGTTAATGGAGTCTCTATATCTGTCTCGCCACAGCCGCCTGCCCCCAGATATTCAGCTGATCATGATTATAGCTCTCAGTTTCAACAGACAGTTGATGTATTGCACCCTCCGCACAGCGCCGCCACAGACCTAACAGATGTGATGGAACAATTCAACAGCACATTTCCCCTGAGCAGCTCAAGCCTTTCTGGGAGACAGTAGGTAATGGGAAAATACATCCATGAAAACATTTGTCCTTGGCACAAAGTCCCTTCATAACACAGCCAGTGGGAAAGTCTATTGTGATGAAGTTACAAGGGACCGAAAGAACCATTCTACCACTTTCAACTGTGTGTTCTACTGAAGGATTACAACACTGAATATCCAAAGATGAAGATGTTGTGTTTTTTATGTAATGTCTGTCCACTATTTTTGTTCCCTTTCTATGCAAATGTAAATTAACAATCTGTGGAGTATTTGGAAATAATTATACCTACATTGTTTGTATAAATATAAACATTACTAGGATTTGGAGGGATGGTTTTAGAATTTATATTTTTTTTGTAATCACGTACAATGCATCTGCTTTATAGCAGGTATGCTCACTCCACTTCTCATTCCCGGCATTTGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGTAAAAAAAAAAA
                                                  Xt7.1-CHK-1008225661                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTGACTTAAATAATGTGCGCTTTTCTGCTTATCGCACTGCCATGAAGATAAGAAGACTACAGAAAACATTGTGCTTGGACCTCCTGGAACTGAGTACAACACACAGCATTTTCAAACAACATGAACTGAATCAAAACAATCAACTGCTATCAGTCCCGGAAGTTATCAGTGTCCTCACTACCGTCTATGATGGACTAGAGCAGAAGCACAAGGAACTGGTGAACGTACCACTCTGCATCGATATGTGTCTAAATTGGCTGCTAAATGTTTATGACACAGGTCGAACTGGTAAGCTACGAGTCTTGTCCCTGAAGATTGGGCTCATGTGTTTATCTAAAGGCCTTCTAGAAGAGAAATACAGACATCTCTTTAAGGAAATATGTGGGGCAGGAGATACATGTGACCAGAGGCAGCTTGGCTTGCTACTTCATGATGCCATCCAAATCCCACGCCAGCTTGGGGAAGTGGCAGCCTTTGGAGGGAGTAACATTGAGCCAAGTGTACGCAGCTGCTTTCAACATGCTCAAAATAAACCCGAAATTGATGTCAAGCATTTTATTGAGTGGATGCGCTTGGAACCTCAGTCTATGGTATGGCTACCTGTACTACACAGAGTAGCCGCTGCTGAAACTGCTAAGCATCAAGCCAAGTGTAACATCTGTAAAGAATGCCCCATTGTTGGATTCAGGTACAGGAGTCTAAAGCATTTTAACTATGATGTGTGCCAAAGTTGCTTCTTTTCTGGAAGGACAGCAAAGGGTCACAAGCTACATCACCCAATGGTGGAATACTGCACTCCTACAACATCAGGGGAGGATGTTCGGGACTTCACCAAGGTGCTGAAGAACAAATTCCGCTCCAAGAAATATTTTGACAAACATCCCAGGCTAGGTTACTTGCCGGTCCAGACAGTGCTGGAAGGGGACAACATGGAGACTCCTATAACCCTTATCAGCATGTGGCCTGATCAGTTTGATGGTATGCACTCCCCGGAACTGCTTGATGATGACACGCACTCGAGGATAGAGCAGTATGCCAGCAGGCTGGCACAAATGGAACGAACCAATGGTTCACTGTTCACTGACAGCAGCTCTGCCACCGGGAGTATGGAGGATGAGCATGCCCTTATCCAGCAGTACTGTCACACCCTGGGAGGAGATTCGCCCATTGGACAACCGCAGAGTCCAGCCCAGATATTGAAGTCAGTAGAAAAAGCAGAGAGGGGAGAGTTGGAGCATATTATTGCTGATCTGGAGGAAGAACAAAGAAACTTGAAGATTGAGTATGAGCAGCTGAAAGCACAGCACTTGCGAAGGGGCCTGACCCCGCCATCGTCGCCCCCGGACTCTGTGCTATCCCTGCAGCACAATTCGGAGGATGCAGAACTCATTGCAGAGGCAAAACTGCTCAGACAGCACAAAGGGCGCCTGGAAGCTAGAATGCAAATTTTAGAAGACCACAACAAACAGTTGGAGTCCCAGCTTCATCGATTACGTCAGTTATTAGAGCAGCCTGAATCAGAGTCCAGGGTTAATGGAGTCTCTATATCTGTCTCGCCACAGCCGCCTGCCCCCAGATATTCAGCTGATCATGATTATAGCTCTCAGTTTCAACAGACAGTTGATGTATTGCACCCTCCGCACAGCGCCGCCACAGACCTAACAGATGTGATGGAACAATTCAACAGCACATTTCCCCTGAGCAGCTCAAGCCTTTCTGGGAGACAGTAGGTAATGGGAAAATACATCCATGAAAACATTTGTCCTTGGCACAAAGTCCCTTCATAACACAGCCAGTGGGAAAGTCTATTGTGATGAAGTTACAAGGGACCGAAAGAACCATTCTACCACTTTCAACTGTGTGTTCTACTGAAGGATTACAACACTGAATATCCAAAGATGAAGATGTTGTGTTTTTTATGTAATGTCTGTCCACTATTTTTGTTCCCTTTCTATGCAAATGTAAATTAACAATCTGTGGAGTATTTGGAAATAATTATACCTACATTGTTTGTATAAATATAAACATTACTAGGATTTGGAGGGATGGTTTTAGAATTTATATTTTTTTTGTAATCACGTACAATGCATCTGCTTTATAGCAGGTATGCTCACTCCACTTCTCATTCCCGGCATTTGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGTAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             2     2     2     2     2     2     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     2     3     2     3     2     3     2     3     2     3     3     4     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     6     4     5     5     6     5     5     4     4     4     4     4     4     4     4     4     4     4     5     3     4     4     4     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     8     7     8     7     8     7     8     7     8     4     5     4     5     6     6     6     6     6     6     6     6     6     6     8     8     8     8     7     8     6     8     6     8     6     8     6     8     7     8     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     4     4     6     6     9     9    10    10    10    10    10    10    12    12    12    12    13    14    14    14    14    15    17    17    17    18    20    20    20    20    21    21    21    21    22    22    24    24    25    26    28    28    28    29    29    29    29    29    29    29    29    29    29    29    30    30    30    30    30    30    30    30    30    30    30    30    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    30    30    29    29    29    29    29    29    29    31    29    31    29    31    29    31    29    31    28    30    28    30    28    30    28    30    28    30    28    30    28    30    28    30    28    30    28    30    27    30    26    30    28    30    27    29    27    29    25    29    25    29    25    29    25    29    25    29    25    29    25    29    25    29    25    29    25    29    23    27    20    23     5     8
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ------T-----
                                                                                      ...PROTEIN --- Ce ---- 7e-098     NP_492946.1 Dystrophin DYS-1 (417.4 kD) (dys-1) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ci ---- 6e-108     CAA68087.1 dystrophin [Ciona intestinalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Dr ==== 5e-151     XP_683644.1 PREDICTED: similar to putative dystrophin [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                      ...PROTEIN --- Dm ---- 1e-158     NP_001036727.1 dystrophin CG34157-PE, isoform E [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Br ---- 9e-167     CAA68069.1 dystrophin-like protein [Branchiostoma lanceolatum] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                      ...PROTEIN --- Sp ---- 1e-171     NP_999661.1 dystrophin-like protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- ?? ---- 0          NP_001084146.1 dystrophin [Xenopus laevis] -================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Xt ---- 0          CAJ82628.1 dystrophin (muscular dystrophy, Duchenne and Becker types) [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                      ...PROTEIN --- Hs ---- 0          NP_009055.2 utrophin [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                      ...PREDICTED - Gg ---- 0          XP_419648.2 PREDICTED: similar to utrophin (dystrophin related protein) [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Xl ---- 0          CAA68032.1 utrophin, or dystrophin-related protein 1 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                      ...PROTEIN --- Mm ---- 0          NP_035812.3 utrophin [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABC2006.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------TAG---ATG------------------------------------------------TAA------------------------TGATGA---------------------------------------------------------------------------------ATG---ATG------------------------------------------------------------TAA---------------------------------------------TAA---TAA---------------------ATG------------------------TAA---------ATG------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------TAG---------TGA---TAG---------------------------------------------------------------------------------TAA---------------TAG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TGA------------------------ATG------------------------------------------------------------TGA------------------------------------------TGA---------ATG---------------ATG---------------------TAA---TAA------TAA---------------------------------------------------------TAA---------------------------TAA---ATG---------------------------------------------------------ATGTAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   0       add Gas7                                 XZG11128.5p CCGGCAGAAGATGGTGAAAGCACTGGGAACCTCAGAAGAAGCAGCTCTCCTTCAGCAAAGACTAGATGATATGAACCACCGGTGGAACGATTTAAAGGCCAAGTCATCCAACATCAGAACACACTTAGAAGTGAGTGCAGACAAATGGAATTACTTGCTGAAATCCCTGGAAGAACTCATCAGCTGGTTAGATGTTAGAAATGAAGAACTTAAAAAGCAAATGCCTGTGGGAGGAGATGTCCCTACAGTACAACAACAGTTTGAATACTGTAAGCTTCTGAAGCGGGAATTAAAGGACAAAGAGGCCTCCATCATACACACCATAGAACAAGCACGAATATTTATATCAGAGCAACCCATTGAGGGTCCCGAAGAGCCAAGAAGGAACTTGCTTCCCAAAACAGAATTAACCCCAGAAGAAAAAGCACAGAAAGTGACAAGAGCTATGCGTAAGCAGTCTTTGGAGGTTAAAGAGAAGTGGGACTGCCTGAATTCTCAGGCCAGCAGTTGGCAGAAGCAAGTGGACAAAGCCTTGGAGAAGTTAAAGGACTTACAAAGTGCAATGGATGAACTTGATGTGGAGCTAATGAATGCAGAAAGAGTACGGGGAAGCTGGAAACCTGTAGGAGATCTGTTAATTGATTCTTTGAAGGATCACATTGAGACAACCACAGCATTTGGAGAGGAGATTGCCCCAGTCAGCTCTAAAGTAAACACACTGAATGATATGGCCAGTCAGCTTTGCACCTTTGACATTCAGCCATCTGCAAAAACGTCTCGCCAGTTGGATGACCTCAACATCAGATGGAAGCTTTTACAGGCAGCTGTTGAAGAGCGTCT
  5   1   2       bld Egg       in                   TEgg017k02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAATGAATGCAGAAAGAGTACGGGGAAGCTGGAAACCTGTAGGAGATCTGTTAATTGATTCTTTGAAGGATCACATTGAGACAACCACAGCATTTGGAGAGGAGATTGCCCCAGTCAGCTCTAAAGTAAACACACTGAATGATATGGCCAGTCAGCTTTGCACCTTTGACATTCAGCCATCTGCAAAAACGTCTCGCCAGTTGGATGACCTCAACATCAGATGGAAGCTTTTACAGGCAGCTGTTGAAGAGCGTCTCAAACAACTCCAAGAAGCACATCGGGATTTTGGACCTGCCTCCCAACACTTTCTCTCTACATCAGTGCAGCTTCCATGGCAACGATCGGTCTCACTTAACAAAGTACCCTATTACATCAACCATCAAACACAAACTACTTGTTGGGATCACCCAAAAATGACAGAGCTTTTTCAGTCTCTAGGTGACTTAAATAATGTGCGCTTTTCTGCTTATCGCACTGCCATGAAGATAAGAAGACTACAGAAAACATTGTGCTTGGACCTCCTGGAACTGAGTACAACACACAGCATTTTCAAACAACATGAACTGAATCAAAACAATCAACTGCTATCAGTCCCGGAAGTTATCAGTGTCCTCACTACCGTCTATGAT
  5   1   2       bld Hrt1      in                        CAAQ11735.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGTCTCTAGGTGACTTAAATAATGTGCGCTTTTCTGCTTATCGCACTGCCATGAAGATAAGAAGACTACAGAAAACATTGTGCTTGGACCTCCTGGAACTGAGTACAACACACAGCATTTTCAAACAACATGAACTGAATCAAAACAATCAACTGCTATCAGTCCCGGAAGTTATCAGTGTCCTCACTACCGTCTATGATGGACTAGAGCAGAAGCACAAGGAACTGGTGAACGTACCACTCTGCATCGATATGTGTCTAAATTGGCTGCTAAATGTTTATGACACAGGTCGAACTGGTAAGCTACGAGTCTTGTCCCTGAAGATTGGGCTCATGTGTTTATCTAAAGGCCTTCTAGAAGAGAAATACAGACATCTCTTTAAGGAAATATGTGGGGCAGGAGATACATGTGACCAGAGGCAGCTTGGCTTGCTACTTCATGATGCCATCCAAATCCCACGCCAGCTTGGGGAAGTGGCAGCCTTTGGAGGGAGTAACATTGAGCCAAGTGTACGCAGCTGCTTTCAACATGCTCAAAATAAACCCGAAATTGATGTCAAGCATTTTATTGAGTGGATGCGCTTGGAACCTCAGTCTATGGTATGGCTACCTGTACTACACAGAGTAGCCGCTGCTGAAACTGCTAAGCATCAAGCCAAGTGTAACATCTGTAAAGAATGCCCCATTGTTGGATTCAGGTACAGGAGTCTAAAGCATTTTAACTATGATGTGTGCCAAAGTTGCTTCTTTTCTGGAAGGACAGCAAAGGGTCACAAGCTACATCACCCAATGGTGGAATACTGCACTCCTACAACATCAGGGGAGGATGTTCGGGACTT
  5   1   2       bld Brn3      in                        CAAK12959.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTATCGCACTGCCATGAAGATAAGAAGACTACAGAAAACATTGTGCTTGGACCTCCTGGAACTGAGTACAACACACAGCATTTTCAAACAACATGAACTGAATCAAAACAATCAACTGCTATCAGTCCCGGAAGTTATCAGTGTCCTCACTACCGTCTATGATGGACTAGAGCAGAAGCACAAGGAACTGGTGAACGTACCACTCTGCATCGATATGTGTCTAAATTGGCTGCTAAATGTTTATGACACAGGTCGAACTGGTAAACTACGAGTCTTGTCCCTGAAGATTGGGCTCATGTGTTTATCTAAAGGCCTTCTAGAAGAGAAATACAGACATCTCTTTAAGGAAATATGTGGGGCAGGAGATACATGTGACCAGAGGCAGCTTGGCTTGCTACTTCATGATGCCATCCAAATCCCACGCCAGCTTGGGGAAGTGGCAGCCTTTGGAGGGAGTAACATTGAGCCAAGTGTACGCAGCTGCTTTCAACATGCTCAAAATAAACCCGAAATTGATGTCAAGCATTTTATTGAGTGGATGCGCTTGGAACCTCAGTCTATGGTATGGCTACCTGTACTACACAGAGTAGCCGCTGCTGAAACTGCTAAGCATCAAGCCAAGTGTAACATCTGTAAAGAATGCCCCATTGTTGGATTCAGGTACAGGAGTCTAAAGCATTTTAACTATGATGTGTGCCAAAGTTGCTTCTTTTCTGGAAGGACAGCAAAGGGTCACAAGCTACATCACCCAATGGTGGAATACTGCACTCCTACAACATCAGGNGAGGATGTTCGGGACTTCACAAGGTGCTG
  5   1   2       bld TbA       in                   TTbA066o24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGATAAGAAACTACAGAAAAATTGTGCTTGGACCTCCTGGAACTGAGTACAACACACAGCATTTTCAAACAACATGAACTGAATCAAAACAATCAACTGCTATCAGTCCCGGAAGTTATCAGTGGTCCTCACTACCGTCTATGATGGACTAGAGCAGAAGCACAAGGGAACTGGGTGAACGTACCACTCTGCATCGATATGTGTCTAAATTGGCTGGCTAAATGTTTATGAACACAGGTCGAACTGGTAAACTACGAGTCTTGGTCCCTGAAGAATGNGCTCCATGTGTTTATCTAAAGGCCTTCTAGAAGAGAAATACAGACATCTCCTTAAGAAATTGTGGGGCAGGAGATACATGTGACCAGAGGCAGCTTGGCTTGCTACTTCATGATGCCATCCAAATCCCACGCCAGCTCTGGGGGAAGTGGCAGCCTTTTGGGAGGGAGTANACATTGAGCCAAGTGTACGCAGCTGCTTTCAACATGCTCAAAATAAACCCGGAAATTGATGTCAAGCATTTTANTTGAGTGGATGCGCTTGGAACCTCAGTCCTATGGTATGGCTACCTGTACTACACAGAGTAGCCGCTGCTGAAACTGCTAAGCATCAAGCCAAGTGTAACATCCTGTAAAGAATGCCCCCATTGGTTGGATTCANNGTACANGGAGTCTAAAGCATTTTTAACTATGATGGTGTGCCAAAGTTGCTTCCTTTTTCTGGAAAGACAGCAAAGGGTCACAAGCTA
  5   1   2       bld Fat1      in                        CABC11146.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTGTCTAAATTGGCTGCTAAATGTTTATGACACAGGTCGAACTGGTAAGCTACGAGTCTTGTCCCTGAAGATTGGGCTCATGTGTTTATCTAAAGGCCTTCTAGAAGAGAAATACAGACATCTCTTTAAGGAAATATGTGGGGCAGGAGATACATGTGACCAGAGGCAGCTTGGCTTGCTACTTCATGATGCCATCCAAATCCCACGCCAGCTTGGGGAAGTGGCAGCCTTTGGAGGGAGTAACATTGAGCCAAGTGTACGCAGCTGCTTTCAACATGCTCAAAATAAACCCGAAATTGATGTCAAGCATTTTATTGAGTGGATGCGCTTGGAACCTCAGTCTATGGTATGGCTACCTGTACTACACAGAGTAGCCGCTGCTGAAACTGCTAAGCATCAAGCCAAGTGTAACATCTGTAAAGAATGCCCCATTGTTGGATTCAGGTACAGGAGTCTAAAGCATTTTAACTATGATGTGTGCCAAAGTTGCTTCTTTTCTGGAAGGACAGCAAAGGGTCACAAGCTACATCACCCAATGGTGGAATACTGCACTCCTACAACATCAGGGGAGGATGTTCGGGACTTCACCAAGGTGCTGAAGAACAAATTCCGCTCCAAGAAATATTTTGACAAACATCCCAGGCTAGGTTACTTGCCGGTCCAGACAGTGCTGGAAGGGGACAACATGGAGACTCCTATAACCCTTATCAGCATGTGGCCTGATCAGTTTGATGGTATGCACTCCCCGGAACTGCTTGATGATGACACGCACTCGAGGATAGAGCAGTATGCCAGCAGGCTGGCACANATGGAAC
  5   1   2       bld Egg                           TEgg126o09.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGGGGCTGCTAAATGTTTATGACACAGGTCGAACTGGTAAACTACGAGTCTTGTCCCTGAAGATTGGGCTCATGTGTTTATCTAAAGGCCTTCTAGAAGAGAAATACAGACATCTCTTTAAGGAAATATGTGGGGCAGGAGATACATGTGACCAGAGGCAGCTTGGCTTGCTACTTCATGATGCCATCCAAATCCCACGCCAGCTTGGGGAAGTGGCAGCCTTTGGAGGGAGTAACATTGAGCCAAGTGTACGCAGCTGCTTTCAACATGCTCAAAATAAACCCGAAATTGATGTCAAGCATTTTATTGAGTGGATGCGCTTGGAACCTCAGTCTATGGTATGGCTACCTGTACTACACAGAGTAGCCGCTGCTGAAACTGCTAAGCATCAAGCCAAGTGTAACATCTGTAAAGAATGCCCCATTGTTGGATTCAGGTACAGGAGTCTAAAGCATTTTAACTATGATGTGTGCCAAAGTTGCTTCTTTTCTGGAAGGACAGCAAAGGGTCACAAGCTACATCACCCAATGGTGGAATACTGCACTCCTACACATCGGGGGAGGGATGTTCGGGACTTCACCAAGGTGCTGAAGAACAAATTCCGCTCCAAGAAATATTTTGACAAACATCCCAGGCTAGGTTACTTGCCGGTCC
  5   1   2       bld Mus1      in                         CABH8931.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACAGGTCGAACTGGTAAGCTACGAGTCTTGTCCCTGAAGATTGGGCTCATGTGTTTATCTAAAGGCCTTCTAGAAGAGAAATACAGACATCTCTTTAAGGAAATATGTGGGGCAGGAGATACATGTGACCAGAGGCAGCTTGGCTTGCTACTTCATGATGCCATCCAAATCCCACGCCAGCTTGGGGAAGTGGCAGCCTTTGGAGGGAGTAACATTGAGCCAAGTGTACGCAGCTGCTTTCAACATGCTCAAAATAAACCCGAAATTGATGTCAAGCATTTTATTGAGTGGATGCGCTTGGAACCTCAGTCTATGGTATGGCTACCTGTACTACACAGAGTAGCCGCTGCTGAAACTGCTAAGCATCAAGCCAAGTGTAACATCTGTAAAGAATGCCCCATTGTTGGATTCAGGTACAGGAGTCTAAAGCATTTTAACTATGATGTGTGCCAAAGTTGCTTCTTTTCTGGAAGGACAGCAAAGGGTCACAAGCTACATCACCCAATGGTGGAATACTGCACTCCTACAACATCAGGGGAGGATGTTCGGGACTTCACCAAGGTGCTGAAGAACAAATTCCGCTCCAAGAAATATTTTGACAAACATCCCAGGCTAGGTTACTTGCCGGTCCAGACAGTGCTGGAAGGGGACAACATGGAGACTCCTATAACCCTTATCAGCATGTGGCCTGATCAGTTTGATGGTATGCACTCCCCGGAACTGCTTGATGATGACACGCACTCGAGGATAGAGCAGTATGCCAGCAGGCTGGCACAAATGGAACGAACCAATGGTTCACTGTTCACTGACAGCAGCTCTGCCACCGGGAGTATGGAGGATGAGCATGCCCTTATCCAGCAGTACTGTCACACC
  5   1   2       bld Egg       in                   TEgg061l06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGCATCAAGCCAAGTGTAACTTCTGTAAAGAATGCCCCATTGTTGGATTCAGGTACAGGAGTCTAAAGCATTTTAACTATGATGTGTGCCAAAGTTGTTTCTTTTCTGGAAGGACAGCAAAGGGTCACAAGCTACATCACCCAATGGTGGAATACTGCACTCCCTAC
  5   1   2       bld Gas7      in                         XZG39702.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAACATCAGGGGAGGATGTTCGGGACTTCACCAAGGTGCTGAAGAACAAATTCCGCTCCAAGAAATATTTTGACAAACATCCCAGGCTAGGTTACTTGCCGGTCCAGACAGTGCTGGAAGGGGACAACATGGAGACTCCTATAACCCTTATCAGCATGTGGCCTGATCAGTTTGATGGTATGCACTCCCCGGAACTGCTTGATGATGACACGCACTCGAGGATAGAGCAGTATGCCAGCAGGCTGGCACAAATGGAACGAACCAATGGTTCACTGTTCACTGACAGCAGCTCTGCCACCGGGAGTATGGAGGATGAGCATGCCCTTATCCAGCAGTACTGTCACACCCTGGGAGGAGATTCGCCCATTGGACAACCGCAGAGTCCAGCCCAGATATTGAAGTCAGTAGAAAAAGCAGAGAGGGGAGAGTTGGAGCATATTATTGCTGATTTGGAGGAAGAACAAAGAAACTTGAAGATTGAGTATGAGCAGCTGAAAGCACAGCACTTGCGAAGGGGCCTGACCCCGCCATCGTCGCCCCCGGACTCTGTGCTATCCCTGCAGCACAATTCGGAGGATGCAGAACTCATTGCAGAGGCAAAACTGCTCAGACAGCACAAAGGGCGCCTGGAAGCTAGAATGCAAATTTTAGAAGACCACAACAAACAGTTGGAGTCCCAGCTTCATCGATTACGTCAGTTATTAGAGCAGCCTGAATCAGAGTCCAGGGTTAATGGAGTCTCTATATCTGTCTCGCCACAGCCGCCTGCCCCCAGATATTCAGCTGATCATGATTATAGCTCTCAGTTTCAACAGACAGTTGATGTATTGCACCCTCCGCACAGCGCCCGCACAGACCT
  5   1   2       bld Gas7      in                         XZG17946.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATCGATTCAATTCTCGACCCACGCGTCCGGCTGGAGGGGACAACATGGAGACTCCTATAACCCTTATCAGCATGTGGCCTGATCAGTTTGATGGTATGCACTCCCCGGAACTGCTTGATGATGACACGCACTCGAGGATAGAGCAGTATGCCAGCAGGCTGGCACAAATGGAACGAACCAATGGTTCACTGTTCACTGACAGCAGCTCTGCCACCGGGAGTATGGAGGATGAGCATGCCCTTATCCAGCAGTACTGTCACACCCTGGGAGGAGATTCGCCCATTGGACAACCGCAGAGTCCAGCCCAGATATTGAAGTCAGTAGAAAAAGCAGAGAGGGGAGAGTTGGAGCATATTATTGCTGATCTGGAGGAAGAACAAAGAAACTTGAAGATTGAGTATGAGCAGCTGAAAGCACAGCACTTGCGAAGGGGCCTGACCCCGCCATCGTCGCCCCCGGACTCTGTGCTATCCCTACAGCACAATTCGGAGGATGCAGAACTCATTGCAGAGGCAAAACTGCTCAGACAGCACAAAGGGCGCCTGGAAGCTAGAATGCAAATTTTAGAAGACCACAACAAACAGTTGGAGTCCCAGCTTCATCGATTACGCCAGTTATTAGAGCAGCCTGAATCGGAGTCCAGGGTTAATGGAGTCTCTATATCTGTCTCGCCACAGCCGCCTGCCCCCAGATATTCAGCTGATCATGATTATAGCTCTCAGTTTCAACAGACAGTTGATGTATTGCACCCTCCGCACAGCGCCGCCACAGACCTAACAGATGTGATGGAACAATTCAACAGCACATTTCCCCTGAGCAGCTCAAGC
  5   1   2       bld Tad5      in                         XZT13189.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACACATGGAGACTCCTATAACCCTTATCAGCATGTGGCCTGATCAGTTTGATGGTATGCACTCCCCGGAACTGCTTGATGATGACACGCACTCGAGGATAGAGCAGTATGCCAGCAGGCTGGCACAAATGGAACGAACCAATGGTTCACTGTTCACTGACAGCAGCTCTGCCACCGGGAGTATGGAGGATGAGCATGCCCTTATCCAGCAGTACTGTCACACCCTGGGAGGAGATTCGCCCATTGGACAACCGCAGAGTCCAGCCCAGATATTGAAGTCAGTAGAAAAAGCAGAGAGGGGAGAGTTGGAGCATATTATTGCTGATCTGGAGGAAGAACAAAGAAACTTGAAGATTGAGTATGAGCAGCTGAAAGCACAGCACTTGCGAAGGGGCCTGACCCCGCCATCGTCGCCCCCGGACTCTGTGCTATCCCTGCAGCACAATTCGGAGGATGCAGAACTCATTGCAGAGGCAAAACTGCTCAGACAGCACAAAGGGCGCCTGGAAGCTAGAATGCAAATTTTAGAAGACCACAACAAACAGTTGGAGTCCCAGCTTCATCGATTACGTCAGTTATTAGAGCAGCCTGAATCAGAGTCCAGGGTTAATGGAGTCTCTATATCTGTCTCGCCACAGCCGCCTGCCCCCAGATATTCAGCTGATCATGATTATAGCTCTCAGTTTCAACAGACAGTTGATGTATTGCACCCTCCGCACAGCGCCGCCACAGACCTAACAGATGTGATGGAACAATTCAACAGCACATTTCCCCTGAGCAGCTCAAGCCTTTCT
  5   1   2       bld Tad5                                 XZT22056.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGACTCCTATAACCCTTATCAGCATGTGGCCTGATCAGTTTGATGGTATGCACTCCCCGGAACTGCTTGATGATGACACGCACTCGAGGATAGAGCAGTATGCCAGCAGGCTGGCACAAATGGAACGAACCAATGGTTCACTGTTCACTGACAGCAGCTCTGCCACCGGGAGTATGGAGGATGAGCATGCCCTTATCCAGCAGTACTGTCACACCCTGGGAGGAGATTCGCCCATTGGACAACCGCAGAGTCCAGCCCAGATATTGAAGTCAGTAGAAAAAGCAGAGAGGGGAGAGTTGGAGCATATTATTGCTGATCTGGAGGAAGAACAAAGAAACTTGAAGATTGAGTATGAGCAGCTGAAAGCACAGCACTTGCGAAGGGGCCTGACCCCGCCATCGTCGCCCCCGGACTCTGTGCTATCCCTGCAGCACAATTCGGAGGATGCAGAACTCATTGCAGAGGCAAAACTGCTCAGACAGCACAAAGGGCGCCTGGAAGCTAGAATGCAAATTTTAGAAGACCACAACAAACAGTTGGAGTCCCAGCTTCATCGATTACGTCAGTTATTAGAGCAGCCTGAATCAGAGTCCAGGGTTAATGGAGTCTCTATATCTGTCTCGCCACAGCCGCCTGCCCCCAGATATTCAGCTGATCATGATTATAGCTCTCAGTTTCAACAGACAGTTGATGTATTGCACCCTCCGCACAGCGCCGCCACAGACCTAACAGATGTGATGGAACAATTCAACAGCACATTTTCCCTGAGCAGCTCAAGCCTTTCT
  3  -1   2       bld Fat1      in                         CABC5029.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATAGAGCAGTATGCCAGCAGGCTGGCACAAATGGAACGAACCAATGGTTCACTGTTCACTGACAGCAGCTCTGCCACCGGGAGTATGGAGGATGAGCATGCCCTTATCCAGCAGTACTGTCACACCCTGGGAGGAGATTCGCCCATTGGACAACCGCAGAGTCCAGCCCAGATATTGAAGTCAGTAGAAAAAGCAGAGAGGGGAGAGTTGGAGCATATTATTGCTGATCTGGAGGAAGAACAAAGAAACTTGAAGATTGAGTATGAGCAGCTGAAAGCACAGCACTTGCGAAGGGGCCTGACCCCGCCATCGTCGCCCCCGGACTCTGTGCTATCCCTGCAGCACAATTCGGAGGATGCAGAACTCATTGCAGAGGCAAAACTGCTCAGACAGCACAAAGGGCGCCTGGAAGCTAGAATGCAAATTTTAGAAGACCACAACAAACAGTTGGAGTCCCAGCTTCATCGATTACGTCAGTTATTAGAGCAGCCTGAATCAGAGTCCAGGGTTAATGGAGTCTCTATATCTGTCTCGCCACAGCCGCCTGCCCCCAGATATTCAGCTGATCATGATTATAGCTCTCAGTTTCAACAGACAGTTGATGTATTGCACCCTCCGCACAGCGCCGCCACAGACCTAACAGATGTGATGGAACAATTCAACAGCACATTTCCCCTGAGCAGCTCAAGCCTTTCTGGGAGACAGTAGGTAATGGGAAAATACATCCATGAAAACATTTGTCCTTGGCACAAAGTCCCTTCATAACACAGCCAGTGGGAAAGTCTATTGTGATGAAGTTACAAGGGGACCGAAAGAACCATTCTACCACTTTCAACTGTGTGTTCTACTGAAGGATACAACACTGAATAT
  3  -1   2       bld Lun1      in                        CABD13868.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATAGAGCAGTATGCCAGCAGGCTGGCACAAATGGAACGAACCAATGGTTCACTGTTCACTGACAGCAGCTCTGCCACCGGGAGTATGGAGGATGAGCATGCCCTTATCCAGCAGTACTGTCACACCCTGGGAGGAGATTCGCCCATTGGACAACCGCAGAGTCCAGCCCAGATATTGAAGTCAGTAGAAAAAGCAGAGAGGGGAGAGTTGGAGCATATTATTGCTGATCTGGAGGAAGAACAAAGAAACTTGAAGATTGAGTATGAGCAGCTGAAAGCACAGCACTTGCGAAGGGGCCTGACCCCGCCATCGTCGCCCCCGGACTCTGTGCTATCCCTACAGCACAATTCGGAGGATGCAGAACTCATTGCAGAGGCAAAACTGCTCAGACAGCACAAAGGGCGCCTGGAAGCTAGAATGCAAATTTTAGAAGACCACAACAAACAGTTGGAGTCCCAGCTTCATCGATTACGCCAGTTATTAGAGCAGCCTGAATCGGAGTCCAGGGTTAATGGAGTCTCTATATCTGTCTCGCCACAGCCGCCTGCCCCCAGATATTCAGCTGATCATGATTATAGCTCTCAGTTTCAACAGACAGTTGATGTATTGCACCCTCCGCACAGCGCCGCCACAGACCTAACAGATGTGATGGAACAATTCAACAGCACATTTCCCCTGAGCAGCTCAAGCCTTTCTGGGAGACAGTAGGTAATGGGAAAATACATCCATGAAAACATTTGTCCTTGGCACANAGTCCCTTCATAACACAGCCAGTGGGAAAGTCTATTGTGATGAAGTTACAAGGAACCCGAAAGAACCATTCTACCACTTTCAACTGTGTGTTCTACTGAAGGATTACAACACTGAATATCCCAAGATGAAGATGTTGTGTTTTTTAT
  5   1   2       bld Tad5                                 XZT31615.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAGTTGGAGCATATTATTGCTGATCTGGAGGAAGAACAAAGAAACTTGAAGATTGAGTATGAGCAGCTGAAAGCACAGCACTTGCGAAGGGGCCTGACCCCGCCATCGTCGCCCCCGGACTCTGTGCTATCCCTGCAGCACAATTCGGAGGATGCAGAACTCATTGCAGAGGCAAAACTGCTCAGACAGCACAAAGGGCGCCTGGAAGCTAGAATGCAAATTTTAGAAGACCACAACAAACAGTTGGAGTCCCAGCTTCATCGATTACGTCAGTTATTAGAGCAGCCTGAATCAGAGTCCAGGGTTAATGGAGTCTCTATATCTGTCTCGCCACAGCCGCCTGCCCCCAGATATTCAGCTGATCATGATTATAGCTCTCAGTTTCAACAGACAGTTGATGTATTGCACCCTCCGCACAGCGCCGCCACAGACCTAACAGATGTGATGGAACAATTCAACAGCACATTTCCCCTGAGCAGCTCAAGCCTTTCTGGGAGACAGTAGGTAATGGGAAAATACATCCATGAAAACATTTGTCCTTGGCACAAAGTCCCTTCATAACACAGCCAGTGGGAAAGTCTATTGTGATGAAGTTACAAGGGACCGAAAGAACCATTCTACCACTTTCAACTGTGTGTTCTACTGAAGGATTACAACACTGAATATCCAAAGATGAAGATGTTGTGTTTTTTATGTAATGTCTGTCCACTATTTTTGTTCCCTTTCTATGCAAATGTAAATTAACAATCTGTGGAGTATTTGGGAATAATTATACCTACATTGTTTGTATAAATATAAACATTACTAGGATTTGGAG
  5   1   2       chi Spl2      in                        CBSS8275.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGATTGAGTATGAGCAGCTGAAAGCACAGCACTTGCGAAGGGGCCTGACCCCGCCATCGTCGCCCCCGGACTCTGTGCTATCCCTGCAGCACAATTCGGAGGATGCAGAACTCATTGCAGAGGCAAAACTGCTCAGACAGCACAAAGGGCGCCTGGAAGCTAGAATGCAAATTTTAGAAGACCACAACAAACAGTTGGAGTCCCAGCTTCATCGATTACGTCAGTTATTAGAGCAGCCTGAATCAGAGTCCAGGGTTAATGGAGTCTCTATATCTGTCTCGCCACAGCCGCCTGCCCCCAGATATTCAGCTGATCATGATTATAGCTCTCAGTTTCAACAGACAGTTGATGTATTGCACCCTCCGCACAGCGCCGCCACAGACCTAACAGATGTGATGGAACAATTCAACAGCACATTTCCCCTGAGCAGCTCAAGCCTTTCTGGGAGACAGTAGCCTTCGTTGTTCTGCTCCATACAGGTAATGGGAAAATACATCCATGAAAACATTTGTCCTTGGCACAAAGTCCCTTCATAACACAGCCAGTGGGAAAGTCTATTGTGATGAAGTTACAAGGAACCGAAAGAACCATTCTACCACTTTCAACTGTGTGTTCTACTGAAGGATTACAACACTGAATATCCAAAGATGAAGATGTTGTGTTTTTTATGTAATGTCTGTCCACTATTTTTGTTCCCTTTCTATGCAAATGTAAATTAACAATCTGTGGAGTATTTGGAAATAATTATACCTACATTGTTTGTATAAATATAAACATT
  5   1   2       bld Gas       in                   TGas091l24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACAGCCGCCTGCCCCCAGATATTCAGCTGATCATGATTATAGCTCTCAGTTTCAACAGACAGTTGATGTATTGCACCCTCCGCACAGCGCCGCCACAGACCTAACAGATGTGATGGAACAATTCAACAGCACATTTCCCCTGAGCAGCTCAAGCCTTTCTGGGAGACAGTAGGTAATGGGAAAATACATCCATGAAAACATTTGTCCTTGGCACAAAGTCCCTTCATAACACAGCCAGTGGGAAAGTCTATTGTGATGAAGTTACAAGGGACCGAAAGAACCATTCTACCACTTTCAACTGTGTGTTCTACTGAAGGATTACAACACTGAATATCCAAAGATGAAGATGTTGTGTTTTTTATGTAATGTCTGTCCACTATTTTTGTTCCCTTTCTATGCAAATGTAAATTAACAATCTGTGGAGTATTTGGAAATAATTATACCTACATTGTTTGTATAAATATAAACATTACTAGGATTTGGAGGGATGGTTTTAGAATTTATATTTTTTTTGTAATCACGTACAATGCATCTGCTTTATAGCAGGTATGCTCACTCCACTTCTCATTCCCGGCATTTGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACA
  5   1   2       bld Tad5      in                         XZT11730.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGTAGGTAATGGGAAAATACATCCATGAAAACATTTGTCCTTGGCACAAAGTCCCTTCATAACACAGCCAGTGGGAAAGTCTATTGTGATGAAGTTACAAGGGACCGAAAGAACCATTCTACCACTTTCAACTGTGTGTTCTACTGAAGGATTACAACACTGAATATCCAAAGATGAAGATGTTGTGTTTTTTATGTAATGTCTGTCCACTATTTTTGTTCCCTTTCTATGCAAATGTAAATTAACAATCTGTGGAGTATTTGGAAATAATTATACCTACATTGTTTGTATAAATATAAACATTACTAGGATTTGGAGGGATGGTTTTAGAATTTATATTTTTTTTGTAATCACGTACAATGCATCTGCTTTATAGCAGGTATGCTCACTCCACTTCTCATTCCCGGCATTTGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGCCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGC
  5   1   2       bld Fat1      in                         CABC1594.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACAGCCAGTGGGAAAGTCTATTGTGATGAAGTTACAAGGGACCGAAAGAACCATTCTACCACTTTCAACTGTGTGTTCTACTGAAGGATTACAACACTGAATATCCAAAGATGAAGATGTTGTGTTTTTTATGTAATGTCTGTCCACTATTTTTGTTCCCTTTCTATGCAAATGTAAATTAACAATCTGTGGAGTATTTGGAAATAATTATACCTACATTGTTTGTATAAATATAAACATTACTAGGATTTGGAGGGATGGTTTTAGAATTTATATTTTTTTTGTAATCACGTACAATGCATCTGCTTTATAGCAGGTATGCTCACTCCACTTCTCATTCCCGGCATTTGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTNTAAACATCTGAATAGCCTCTTTGCA
  5   1   2       bld Fat1      in                         CABC2006.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCCAGTGGGAAAGTCTATTGTGATGAAGTTACAAGGGACCGAAAGAACCATTCTACCACTTTCAACTGTGTGTTCTACTGAAGGATTACAACACTGAATATCCAAAGATGAAGATGTTGTGTTTTTTATGTAATGTCTGTCCACTATTTTTGTTCCCTTTCTATGCAAATGTAAATTAACAATCTGTGGAGTATTTGGAAATAATTATACCTACATTGTTTGTATAAATATAAACATTACTAGGATTTGGAGGGATGGTTTTAGAATTTATATTTTTTTTGTAATCACGTACAATGCATCTGCTTTATAGCAGGTATGCTCACTCCACTTCTCATTCCCGGCATTTGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGC
  3   1   2      seed Fat1      in                         CABC2006.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTGGAGGGATGGTTTTAGAATTTATATTTTTTTTGTAATCACGTACAATGCATCTGCTTTATAGCAGGTATGCTCACTCCACTTCTCATTCCCGGCATTTGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGTAAAAAAAA
  5  -1   2       bld Lun1      in                        CABD13868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGGTTTTAGATTTTATATTTTTTTTGTAATCACGTACAATGCATCTGCTTTATAGCAGGTATGCTCACTCCACTTCTCATTCCCGGCATTTGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTTGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAATGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAACATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACTGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTAACCTCGTGCCGAATTGAA
  3   1   2       bld Gas       in                    TGas091l24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTTTAGAATTTATATTTTTTTTGTAATCACGTACAATGCATCTGCTTTATAGCAGGTATGCTCACTCCACTTCTCATTCCCGGCATTTGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGAATGTTTTTTTTGCATAATAAAATGCATTTTAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg061l06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTATATTTTTTTTGTAATCACGTACAATGCATCTGCTTTATAGCAGGTATGCTCACTTCACTTCTCATTCCCGGCATTTGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTTGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAATGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAACATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACTGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCTAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAA
  3   1   2       bld Fat1      in                        CABC11146.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTATATTTTTTTTGTAATCACGTACAATGCATCTGCTTTATAGCAGGTATGCTCACTCCACTTCTCATTCCCGGCATTGTGGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTGCATAA
  3   1   2       bld Hrt1      in                        CAAQ11735.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTGTAATCACGTACAATGCATCTGCTTTATAGCAGGTATGCTCACTCCACTTCTCATTCCCGGCATTTGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGT
  3   1   2       bld Mus1      in                         CABH8931.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATAGCAGGTATGCTCACTCCACTTCTCATTCCCGGCATTTGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGT
  5   1   2       bld Tad5      in                          XZT5618.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTATGCTCACTCCACTTCTCATTCCCGGCATTTGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGT
  3   1   2       bld Fat1      in                         CABC1594.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATTCCCGGCATTTGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCNCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGTAAAAAAAA
  3   1   2       bld Gas7      out                        XZG19129.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATTCCCGGCATTGGTGGCATATCAGTATTAAGGCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTTGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAACATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACTGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGT
  5   1   2       bld Tail      in                         CBSW1554.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCAGTATTAAGGCAGTATCANGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATA
  3   1   2       bld Brn3      in                        CAAK12959.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTTGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAACATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACTGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGT
  3   1   2       bld Brn2      out                       CAAJ12866.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTATCAGTCTTATATCACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTTGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAACATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACTGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGTATATGGC
  5  -1   2       bld Fat1      in                         CABC5029.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACAGTTACCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGTAAA
  5   1   2       bld Limb      in                        CBSU3146.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCAATTCCTGTACATACTGTCAGCTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAGTATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAACATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGTAAAAAAAAAAAAAAAGGG
  3   1   2       bld Tad5      in                         XZT13189.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGTACATACTGTCAGCTGACAGAATCCCTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAAGGCATTTTA
  3   1   2       bld Tad5      in                          XZT5618.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACATACTGTCAGTTGACAGAATCCTTGTCGTACTGTATTGTCCAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGT
  3   1   2       bld Limb      in                        CBSU3146.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAATCCTTGTCGTACTGTATTGTCCAATGCTCAGTATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAACATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGT
  3   1   2       bld Spl2      in                        CBSS8275.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAATGCTCAATATAGCGCAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAACATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACTGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGT
  3   1   2       bld TpA       in                    TTpA059l07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAATGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAACATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTTTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACTGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGTAAAAAAAAAAAAAAAAA
  5   1   2       bld TpA       in                   TTpA059l07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAATATCGAGGGCACTCCCAAACATCACCAGTTGTTGTAGTATGCAATGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAACATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACTGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGT
  3   1   2       bld Tail      in                         CBSW1554.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCACTCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGTAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG39702.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACTCCCAAACCTCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAACATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACTGCCCCAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGCCACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGTAAAAAAAAACC
  3   1   2       bld Te5       out                        CAAO4466.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCAAACATCACCAGTTGTTGTAGTATGCAACGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTTTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGT
  3   1   2       bld Gas7      in                         XZG17946.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATCACCAGTTGTTGTAGTATGCAATGTATTTTAGCTCTTCCTGTGACTTTAGCACGTGCGAACCATTAAGTGCTGTAGGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAACATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACTGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAACGTAAAAAAAAAAATTAAAAAAAT
  3   1   2       bld Tad5      in                         XZT11730.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGTTGTTGTAGTATGCAAGGTATTTTAGCTCTTCCTGTGACTTTAGCACGTACGAACCATTAAGTGCTGTAAGAGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTCCTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATG
  3   1   2       bld Egg       in                    TEgg017k02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCCTCTATAGAATTGCATTTAAAAATCTGAATGCCCTTATATATTCAGGGGAGTAAGTTATCATTACCAGTTAGCTTGACTTATTCTGCATTGTACCATGGAACACTTCTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATCTGAATAGCCTCTTTGCAGAAGAGTCATACAGTCTGATCTTTAACATTACAGAGTCCTTTCTCCACTGGCAAGCCTGATCTGAATATCTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA066o24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGTTAGCTTGACTTATTTTGCATTGTACCATGGAACACTTTTGCTTGCTTCAGAATAAAAATGGATCCTCTTGGCCTCATTGTCCTCCAGTTAAAACATTTGAATAGCCTCTTTGCAGAAGAGTCATACAGTTTGATCTTTAACATTACAGAGTCCTTTTTCCACTGGCAAGCCTGATTTGAATATTTGAATGTGGCTAGTATGAGCCTAAATGCAAAGTTTTTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCCCAATAGGTAATTTTAATCACTTTAAAGTGAATATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTTTGCTCTCGGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGTAAAAAAAAAAAAAAAAAAAAAAAAAAAGAGC
  3   1   2       bld Ova1      in                          CABE695.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGGAATAAGATTACCTATTGTGGCGGTTTCTTTTCATACAGTAACAAAATAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTNGTTACNGTANGAAAAGAAACCGCCACAATAGGTAATCTTATTCACTTTAAAGTGATTATTTTAGAGCCCCAGTCTATAAACAGTTTGAATTTATTGAGGGAAATGAATAACACCCTGTTTGTTTTGTTGACACGAGATAAAACATGTACTTGAGCATTTTTCTGCTCTCTGTTTCTTTTTTTTGCATAATAAAATGCATTTTAATGT
  5   1   2       bld Ova1      in                          CABE695.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTAAGATTACCTATTGTGGCGGTTTCTTTTCATACAGTAACAAAATAGTATGAGCCTAAATGCAAAGTTTCTAAATGGTTGCCAACTGTGGGTTCCCAATCGTTTGGTGACATGAAAATGCCTTGATATTTTTATATATCCAGAACCATTGTTGTTGTGAATATGCTACATGCTATTTTGTTACTGTATGAAAAGAAACCGCCACAATAGGTAATCTTATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)