Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 311.0    0Xt7.1-EC2CAA20BA02.3                        6 PI      100        40      202                Hypothetical protein MGC76088 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 94%

 1012073560 Xt7.1-CABE5357.3 - 69 ESTs
                                                                       ........-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABE5357.3                                                                                                                                                                                                                                                                                       CGGCGATTCTCTGTGCACACTTCTCCGGAGTCGGCCAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTGGGACAGATCTCCCAACGCTCTTATGGAAGCTGGTTGAAGTTATCCCTGAGGGCGCTATGCTGCGGCTAGGCATGACCAACCCCCCTTATATATTAGAGCACCTGGAGGAGATGGCAAAGATCCTGAATCATCCAAGAGTGTATGCGTTCCTGCACATCCCTGTACAATCTGCCTCAGACAGTGTGCTCATGGACATGAAGAGAGAATACTGTATTGCAGACTTCAAAAGAGTGGTGGATTTTCTTAAAGAGAGAGTGCCCGGAATAACAATCGCTACGGACATCATTTGTGGCTTTCCAGGAGAGACAGATGAGGATTTTAAGGAGACATTAAAATTGGTTGAGGAGTACAAATTCCCCAGTCTCTTCATTAATCAGTTTTACCCACGCCCTGGGACCCCAGCTGCTAAAATGGAGCAAGTTCCAGCTCATGTGAAAAAGCAAAGGACCAAGGAGCTGTCCCAACTCTTCCATTCATATAGTCCCTATGATCACAAGATTGGGGAGGAGCAACACGTTTTGGTAACAGAAGAGTCCTTTGATTCCCAGTATTATGTGTCTCATAATCGTTTCTACGAACAGGTTCTTGTCCCTAAGGATCCTGCATTTGTGGGAAAAATGGTTGAAGTGAAAATTTTTGAAGCAGGGAAACATTTTATGAAGGGGCAACCAGTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAAAAGGAGAAGTTTCCGGATTAACGGAGGAGTCAAAGCCACCAAACAACCCCGAATCCCTTCTGCAGACGTCCCGGGAAGGACTACAAACCTTCTTTTTTGTCACTGCTCTGCTGGCTGCTGTCATTGCTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224421                                                                                                                                                                                                                                                                                             TTCTCTGTGCACACTTCTCCGGAGTCGGCCAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTGGGACAGATCTCCCAACGCTCTTATGGAAGCTGGTTGAAGTTATCCCTGAGGGCGCTATGCTGCGGCTAGGCATGACCAACCCCCCTTATATATTAGAGCACCTGGAGGAGATGGCAAAGATCCTGAATCATCCAAGAGTGTATGCGTTCCTGCACATCCCTGTACAATCTGCCTCAGACAGTGTGCTCATGGACATGAAGAGAGAATACTGTATTGCAGACTTCAAAAGAGTGGTGGATTTTCTTAAAGAGAGAGTGCCCGGAATAACAATCGCTACGGACATCATTTGTGGCTTTCCAGGAGAGACAGATGAGGATTTTAAGGAGACATTAAAATTGGTTGAGGAGTACAAATTCCCCAGTCTCTTCATTAATCAGTTTTACCCACGCCCTGGGACCCCAGCTGCTAAAATGGAGCAAGTTCCAGCTCATGTGAAAAAGCAAAGGACCAAGGAGCTGTCCCAACTCTTCCATTCATATAGTCCCTATGATCACAAGATTGGGGAGGAGCAACACGTTTTGGTAACAGAAGAGTCCTTTGATTCCCAGTATTATGTGTCTCATAATCGTTTCTACGAACAGGTTCTTGTCCCTAAGGATCCTGCATTTGTGGGAAAAATGGTTGAAGTGAAAATTTTTGAAGCAGGGAAACATTTTATGAAGGGGCAACCAGTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAAAAGGAGAAGTTTCCGGATTAACGGAGGAGTCAAAGCCACCAAACAACCCCGAATCCCTTCTGCAGACGTCCCGGGAAGGACTACAAACCTTCTTTTTTGTCACTGCTCTGCTGGCTGCTGTCATTGCTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                            4     6     5     7     7    11    11    13    16    18    16    18    16    18    19    21    19    21    20    22    20    22    20    22    20    22    21    22    21    22    21    22    21    22    21    22    21    22    21    22    21    22    22    22    22    22    22    22    23    24    23    24    23    24    23    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    25    25    25    25    25    25    24    25    24    25    24    25    24    25    23    25    22    23    22    23    21    22    21    22    20    21    19    20    19    20    19    20    18    19    18    19    16    19    16    19    15    18    13    16    13    16    13    16    13    17    12    17    12    17    12    17    12    17    12    17    12    16    11    15    11    14    10    13    10    12    10    12    10    12    10    11     7     7     7     7     7     7     6     6     6     6     5     5     5     5     5     5     5     5     7     7     6     7     7     7     7     7     6     7     7     8     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     8     9     8     9     8     8     8     8     8     8     8     9     7     8     7     9     9    10     9    10     9    10     9    10     9    10     9    10     9     9     9     9     9     9    10    10    10    10    10    11    11    11    12    12    12    12    12    12    12    12    12    13    12    13    13    13    12    13    11    12    11    12    11    12    11    12    10    12    10    12    12    15    14    16    14    17    15    18    17    20    18    21    20    24    20    24    23    27    22    26    24    29    25    30    26    30    26    30    27    31    28    32    30    32    28    32    28    32    28    32    29    33    29    33    29    33    29    33    29    33    29    34    29    34    29    34    28    32    28    32    28    32    28    32    28    32    28    32    28    32    28    32    27    30    30    30    30    30    30    30    30    30    29    29    29    29    29    29    29    29    28    28    28    28    28    28    28    28    29    29    29    29    28    28    28    28    27    27    27    27    27    27    27    27    26    27    26    27    26    27    26    27    26    27    25    26    25    26    25    26    25    26    26    26    24    26    24    25    24    25    23    24    21    23     6    11     5     7     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----T------
                                               BLH ATG      41    1113                                                                                                                                                                                                                                                                                       
                                               BLH MIN      29     291                                                                                                                                                                                                                                                                                       
                                               BLH MPR      20     291                                                                                                                                                                                                                                                                                       
                                               EST CLI      19       6                                                                                                                                                                                                                                                                                       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Ce ==== 2e-113     NP_740783.2 Y92H12BL.1 [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN -== Dm ==== 0          NP_611207.1 CG6550-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Sp ==== 0          XP_792404.2 PREDICTED: similar to CDK5 regulatory subunit associated protein 1-like 1 [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 0          NP_956921.1 CDK5 regulatory subunit associated protein 1-like 1 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Gg ==== 0          XP_418914.2 PREDICTED: similar to CDK5 regulatory subunit associated protein 1-like 1 [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN -== Hs ==== 0          NP_060244.2 CDK5 regulatory subunit associated protein 1-like 1 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Mm ==== 0          NP_653119.1 RIKEN cDNA 1190005B03 [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 0          AAH70521.1 MGC78779 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = ?? ==== 0          NP_001084956.1 hypothetical protein LOC432014 [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Xt ==== 0          AAH63205.1 Hypothetical protein MGC76088 [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABE5357.3                                                                                                                                                                                                                                                                                                                                ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------ATG---------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------TAG---------TAG---------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------ATG---TGA---------------ATG------------------------------------------------------------------------------------------ATGTGA------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------TGA---------------------------TAA---------------------------------------------ATG---TAA---------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   1           Gas1 FL                     IMAGE:5308174.FL-MGC                                                                                                                                                                                                                                                                                                      CACACTTCTCCGGAGTCGGCCAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTGGGACAGATCTCCCAACGCTCTTATGGAAGCTGGTTGAAGTTATCCCTGAGGGCGCTATGCTGCGGCTAGGCATGACCAACCCCCCTTATATATTAGAGCACCTGGAGGAGATGGCAAAGATCCTGAATCATCCAAGAGTGTATGCGTTCCTGCACATCCCTGTACAATCTGCCTCAGACAGTGTGCTCATGGACATGAAGAGAGAATACTGTATTGCAGACTTCAAAAGAGTGGTGGATTTTCTTAAAGAGAGAGTGCCCGGAATAACAATCGCTACGGACATCATTTGTGGCTTTCCAGGAGAGACAGATGAGGATTTTAAGGAGACATTAAAATTGGTTGAGGAGTACAAATTCCCCAGTCTCTTCATTAATCAGTTTTACCCACGCCCTGGGACCCCAGCTGCTAAAATGGAGCAAGTTCCAGCTCATGTGAAAAAGCAAAGGACCAAGGAGCTGTCCCAACTCTTCCATTCATATAGTCCCTATGATCACAAGATTGGGGAGGAGCAACACGTTTTGGTAACAGAAGAGTCCTTTGATTCCCAGTATTATGTGTCTCATAATCGTTTCTACGAACAGGTTCTTGTCCCTAAGGATCCTGCATTTGTGGGAAAAATGGTTGAAGTGAAAATTTTTGAAGCAGGGAAACATTTTATGAAGGGGCAACCAGTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAAAAGGAGAAGTTTCTGGATTAACGGAGGAGTCAAAGCCACCAAACAACCCCGAATCCCTTCTGCAGACGTCCCGGGAAGGACTACAAACCTTCTTTTTTGTCACTGCTCTGCTGGCTGCTGTCATTGCTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTTTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAGAAAAAAAATTAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       chi Mus1 5g3  in                         CABH8430.5p TACTTTGCTTTATCCAAGTTATCGCCCAAGGAGCAGTTTATGGCAGAGCTTTTGATATAACCTTTTGCTAAAGAGGGGCACTTAAGAAAAAAAAAAGTTTTTTGTTCTCCTTTATGTGGCATTACGTAATGATTTGGGCACAAAAGGGATTTAGGAACAAGAAATAAATGTTAGGTCTTTAATTCTAAAAAAGTTCTGAAATCTGAAAAGTTTTAGGAAGTTTTTATGTTTATCTTGTCTTTTACAAGTTTAAGTGTTTAAGCTCTATGACCACTTTAAAAGGTTTATGGTTCTTATGCTTTTGTATATTTCACAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAAT
  5   1   2       bld 1030 5g                         IMAGE:7027753.5p                                                                                                                                                                                                                                                   GGACATCATTACCCGCGGCCGGAAAGAAGATACGCACGGCGATTCTCTGTGCACACTTCTCCGGAGTCGGCCAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACGAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAAAAAACCATTAAAGGTCCCTCTGTTGAGACTGCTGGGGTCCGAAAAAGGGTTAATGGAAAAACGGTTTGGGGGGGGAACTCGGATTGGGATTTTGCCCAAAGAATTTAGGAAAGAAACCCCACTGGGATAAAAATTCATTTTCCCTTCCAAATACAGGGGTGGTTTTGA
  5   1   2       bld Gas1 5g                          NISC_mq02e04.y1                                                                                                                                                                                                                                                                           GAAGATACGCACGGCGATTCTCTGTGCACACTTCTCCGGAGTCTTGCCAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTGGGGGG
  5   1   2   14  bld Brn3 5g3  in                         CAAK3689.5p .............................................................................................................................................................................................................................................................................AGATACGCACGGCGATTCTCTGTGCACACTTCTCCGGAGTCGGCCAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCA
  5   1   2       bld BrSp 5g3  in                     EC2BBA20BA07.g1                                                                                                                                                                                                                                                                               GGGACGCACGGCGATTCTCTGTGCACACTTCTCCGGAGTCGGCCAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAA
  5   1   2       chi Gas7      in                         XZG56357.5p                                                                                                                                                                                                                                                                                     CACGGCGATTCTCTGTGCACACTTCTCCGGAGTCGGCCAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGCAAAGGTCATCTCCTGTGTGTGTCTTTTATTCTGACATTCGGACAATGGCTTGTTGCTGGNGTCCATGTTCTATCATTATAGACAGTGCTCTGCCCTTTCACGAATGCATGGAAATCGACATGACCAANAGTATCTGCAGGTTGCTGAGTGTTTTGCTTTCCCCTTTGA
  5   1   2   22  bld Tad5 5g                              XZT44043.5p .......................................................................................................................................................................................................................................................................................GGCGATTCTCTGTGCACACTTCTCCGGAGTCGGCCAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTGNGACAGATCTCCCAACGCTCTTATGGGAGCTGGGTGAAAGTATCCCTG
  5   1   2       bld AbdN 5g                            IMAGE:7022135                                                                                                                                                                                                                                                                                                     GCCACTTCTCCGGAGTCGGCCAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACCGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGGAAGAATTGGGTTGACAGAGCTGCACAGTCCTTTCCAAGATTGGGGGAGGGAGCAACACGTTTTTGGTAACAGAAGAGTCCTTTGAATTCTCAGTATTATGTGGTCTCAAAAATCGTTTTCTACGAAACAGGTTTCTTGTCCCCTTAAGGGATCCCTGCAT
  5   1   2       bld Gas  5g                        TGas004k14.p1kSP6                                                                                                                                                                                                                                                                                                     CACACTTCTCCGGAGTCGGCCAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAAC
  5   1   2       bld Brn1 5g3  in                          CABL520.5p                                                                                                                                                                                                                                                                                                          CTTCTCCGGAGTCGGCCAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACCGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTGNGACAGATCTCCCAACGCTCTTATGGAAGCTG
  5   1   2       bld Gas1 FL   in                    IMAGE:5308174.y1                                                                                                                                                                                                                                                                                                              TCCGGAGTCGGCCAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAAC
  5   1   2   10  bld Ova1 5g3  in                         CABE5357.5p .......................................................................................................................................................................................................................................................................................................................GCCAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACCGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTGGGACAGATCTCCCCACGCTCTTATGGAAGCTGGTTGAAGTTATCCCTGAGGGCGCTATGCTGCGGCTAGGCATGACCAAC
  5   1   2       bld Neu0 5g                            IMAGE:6993890                                                                                                                                                                                                                                                                                                                          CAGGAAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACCGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTTGGGACAAGATCTCCCAACGCTCNTTATGGAAGCTGGGTTGAAAGTTTATCCCTTGAAGGGCCGCCTATG
  5   1   2       bld Gas1 5g                            IMAGE:6987527                                                                                                                                                                                                                                                                                                                             GGAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACCGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATGGTTGACAGAGCTGCACAGTCTTTCCAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAAACACT
  3   1   2       chi Gas7      in                         XZG56357.3p                                                                                                                                                                                                                                                                                                                             GAAATGCCTGCTGCCTGTGAGTCTNTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGCAAAGGTCATCTCCTGTGTGTGTCTTTTATTCTGACATTCGGACAATGGCTTGTTGCTGGGGTCCATGTTCTATCATTATAGACAGTGCTCTGCCCTTTCACGAATGCATGGAAATCGACATGACCAAAAGTATCTGCAGGTTGCTGAGTGTTTTGCTTTCCCTTTTGACAGAAAAAATAG
  5   1   2   10  bld Hrt1 5g3  in                         CAAQ9686.5p .............................................................................................................................................................................................................................................................................................................................AAATGCCTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGAC
  5   1   2       bld Brn3      in                         CAAK1793.5p                                                                                                                                                                                                                                                                                                                                    CTGCTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTGGGACAGATCTCCCCACGCTCTTATGGAAGCTGGTTGAAGTTATCCCTGAGGGCGCTATGCTGCGGCTAGGCATGA
  5   1   2       bld Egg                            TEgg119k24.p1kSP6                                                                                                                                                                                                                                                                                                                                       CTGCCTGTGAGTCTTTGCTGGATGACATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAGATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCGTCAATACAGGGTGTTTGAATGCTTGCACATACTGTAA
  5   1   2       bld Liv1                                 CAAR8050.5p                                                                                                                                                                                                                                                                                                                                                                CATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACCGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTGGGACAGATCTCCCAACGCTCTTATGGAAGCTGGGTGAAAGTATCCCTGAGGGCGCTATGCTGCGGCTAGGCATG
  3  -1   2       bld Ovi1      out                       CABI14270.3p                                                                                                                                                                                                                                                                                                                                                                 ATTGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTGGGACAGATCTCCCAACGCTCTTATGGAAGCTGGTTGAAGTTATCCCTGAGGGCGCTATGCTGCGGCTAGGCATGACCAACCCCCCTTATATATTAGAGCACCTGGAGG
  5   1   2       bld Lun1      in                         CABD5382.5p                                                                                                                                                                                                                                                                                                                                                                   TGAAGACATTGTCTCAGCTACAGACCCAAAGCCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACCGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTGGGACAGATCTCCCAACGCTCTTATGGAAGCTGGTTGAAGTTATCCCTGAGGGCGCTATGCTGCGGCTAGGCATGACCAACCCCCCTTATATATTAGAGCACCTGGAGGAGATGGCAAAGATCCTGAATCAT
  5   1   2       bld Int1      in                         CAAP9072.5p                                                                                                                                                                                                                                                                                                                                                                                                  CCTCATGATCGCCAAAATGCAAGACAAAACATAGTACCCAGAGCACGGAAAAGAAATAAAAACAAAATTCAAGAGGAAGAACCCCCTGCTGATAGCACAATACCTGGCACTCAGAAGATCTGGATCCGTACATGGGGCTGCTCACATAACAACTCCGATGGTGAATATATGGCGGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACCGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTGGGACAGATCT
  5   1   2       bld BrSp      in                     EC2BBA19DB01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAATGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp      in                     EC2BBA19DB01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGACAACTGGCTGCATATGGCTACAGCATAACTGAGCAGCCTGAGCAAGCAGATTTGTGGCTACTGAACAGTTGCACTGTGAAGAGTCCAGCTGAGGACCACTTCAGGAACTCCATTAAGAAAGCTCAAGAAGCAAACAAAAAAGTTGTACTGTCTGGATGTGTACCACAAGCGCAACCACGTCAAGAGTACATGAAAAGGACTGAGTATTCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAG
  5   1   2       bld Gas7                                 XZG29362.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGATGTGTACCTCAAGCGCAACCACGTCAAGAGTACATGAAAGGACTGAGTATCATAGGGGTGCAGCAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGGTCACTCTGTGAGACTGCTGGGTCAGAAAAAGGATAATGGAAAACGGTTGGGGGGAGCTCGATTGGATTTGCCAAAGATTAGGAAGAACCCACTGATAGAAATCATTTCCATCAATACAGGGTGTTTGAATGCTTGCACATACTGTAAAACAAAGCACGCAAGAGGAGAACTTGCTAGTTACCCAGTGGAAGAATTGGTTGACAGAGCTGCACAGTCTTTCCAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTGGGACAGATCTCCCAACGCTCTTATGGAAGCTGGTTGAAGTTATCCCTGAGGGCGCTATGCTGCGGCTAGGCATGACCAACCCCCCTTATATATTAGAGCACCTGGAGGAGATGGCAAAGATCCTGAATCATCCAAGAGTGTATGCGTTCCTGCACATCCCTGTACAATCTGCCTCAGACAGTGTGCTCATGGACATGAAGAGAGAATACTGTATTGCAGACTTCAAAAGA
  5   1   2       bld Gas       in                   TGas121c10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAATAGATCGTGTGGTTGAAGTTGTAGAAGAAACAATTAAAGAGGGTGTCTGTGAGATCTGGCTGACCAGCGAAGACACTGGAGCTTATGGCAGAGACATTGGGACAGATCTCCCAACGCTCTTATGGAAGCTGGTTGAAGTTATCCCTGAGGGCGCTATGCTGCGGCTAGGCATGACCAACCCCCCTTATATATTAGAGCACCTGGAGGAGATGGCAAAGATCCTGAATCATCCAAGAGTGTATGCGTTCCTGCACATCCCTGTACAATCTGCCTCAGACAGTGTGCTCATGGACATGAAGAGAGAATACTGTATTGCAGACTTCAAAAGAGTGGTGGATTTTCTTAAAGAGAGAGTGCCCGGAATAACAATCGCTACGGACATCATTTGTGGCTTTCCAGGAGAGACAGATGAGGATTTTAAGGAGACATTAAAATTGGTTGAGGAGTACAAATTCCCCAGTCTCTTCATTAATCAGTTTTACCCACGCCCTGGACCCCAGCTGCTAAAATGGAGCAAGTTCCAGCTCATGTGAAAAAGCAAAGGA
  5   1   2       bld Gas1      in                     NISC_mq07e02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGATCTTATGGCAGAGACATTGGGACAGATCTCCCAACGCTCTTATGGAAGCTGGTTGAAGTTATCCCTGAGGGCGCTATGCTGCGGCTAGGCATGACCAACCCCCCTTATATATTAGAGCACCTGGAGGAGATGGCAAAGATCCTGAATCATCCAAGAGTGTATGCGTTCCTGCACATCCCTGTACAATCTGCCTCAGACAGTGTGCTCATGGACATGAAGAGAGAATACTGTATTGCAGACTTCAAAAGAGTGGTGGATTTTCTTAAAGAGAGAGTGCCCGGAATAACAATCGCTACGGACATCATTTGTGGCTTTCCAGGAGAGACAGATGAGGATTTTAAGGAGACATTAAAATTGGTTGAGGAGTACAAATTCCCCAGTCTCTTCATTAATCAGTTTTACCCACGCCCTGGGACCCCAGCTGCTAAAATGGAGCAAGTTCCAGCTCATGTGAAAAAGCAAAGGACCAAGGAGCTGTCCCAACTCTTCCATTCATATAGTCCCTATGATCACAAGATTGGGGAGGAGCAACACGTTTTGGTAACAGAAGAGTCCTTTGATTCCCAGTATTATGTGTCTCATAATCGTTTCTACGAACAGGTTC
  5   1   2       bld Tad5      in                         XZT35602.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATCTCCCACGCTCTTATGGAAGCTGGTTGAAGTTATCCCTGAGGGCGCTATGCTGCGGCTAGGCATGACCAACCCCCCTTATATATTAGAGCACCTGGAGGAGATGGCAAAGATCCTGAATCATCCAAGAGTGTATGCGTTCCTGCACATCCCTGTACAATCTGCCTCAGACAGTGTGCTCATGGACATGAAGAGAGAATACTGTATTGCAGACTTCAAAAGAGTGGTGGATTTTCTTAAAGAGAGAGTGCCCGGAATAACAATCGCTACGGACATCATTTGTGGCTTTCCAGGAGAGACAGATGAGGATTTTAAGGAGACATTAAAATTGGTTGAGGAGTACAAATTCCCCAGTCTCTTCATTAATCAGTTTTACCCACGCCCTGGGACCCCAGCTGCTAAAATGGAGCAAGTTCCAGCTCATGTGAAAAAGCAAAGGACCAAGGAGCTGTCCCAACTCTTCCATTCATACAGTCCCTATGATCACAAGATTGGGGAGGAGCAACACGTTTTGGTAACAGAAGAGTCCTTTGATTCCCAGTATTATGTGTCTCATAATCGTTTCTACGAACAGGTTCTTGTCCCTAAGGATCCTGCATTTGTGGGAAAAATGGTTGAAGTGAAAATTTTTGAAGCAGGGAAACATTTTATGAAGGGGCAACCAGTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAAAAGGAGAAGTTTCCGGATTAACGGAGGAGTCAAAGCCACCAAACA
  5   1   2       bld Gas                            TGas040m11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTATCCCTGAGGGCGCTATGCTGCGGCTAGGCATGACCAACCCCCCTTATATATTAGAGCACCTGGAGGAGATGGCAAAGATCCTGAATCATCCAAGAGTGTATGCGTTCCTGCACATCCCTGTACAATCTGCCTCAGACAGTGTGCTCATGGACATGAAGAGAGAATACTGTATTGCAGACTTCAAAAGAGTGGTGGATTTTCTTAAAGAGAGAGTGC
  5   1   2       bld Gas1                               IMAGE:6988014                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCCTCAGACAGTGTGCTCATGGACATGAAGAGAGAATACTGTATTGCAGACTTCAAAAGAGTGGTGGATTTTCTTAAAGAGAGAGTGCCCGGAATAACAATCGCTACGGACATCATTTGTGGCTTTCCAGGAGAGACAGATGAGGATTTTAAGGAGACATTAAAATTGGTTGAGGAGTACAAATTCCCCAGTCTCTTCATTAATCAGTTTTACCCACGCCCTGGGACCCCAGCTGCTAAAATGGAGCAAGTTCCAGCTCATGTGAAAAAGCAAAGGACCAAGGAGCTGTCCCAACTCTTCCATTCATATAGTCCCTATGATCACAAGATTGGGGAGGAGCAACACGTTTTGGTAACAGAAGAGTCCTTTGATTCTCAGTATTATGTGTCTCATAATCGTTTCTACGAACAGGTTCTTGTCCCTAAGGATCCTGCATTTGTGGGAAAAATGGTTGAAGTGAAAATTTTTGAAGCAGGGAAACATTTTATGAAGGGGCAACCAGTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAAAAGGAGAAGTTTCCGGATTAACGGAGGAGTCAAAGCCCCCAAACAACCCCGGAATCCCTTCTGCAGAACGTCTCCGGGGAAGGAATTCCAACCCTTTCTTTTTTTGTCCACTGCCCCTGCCTGGGCTGCATGTCATTTGCCTTTTTGGTTGGGAATAAAAAATTGCTTTTTAAAAAACCAATTTGGTTTTAAGGGGCAAGCCTGGGGAAAAAATTTCTTAAGCATTTTTTTAAGCGCCCCCCTTTTTTTAATGCATTTCTCCAATTTACGATTAGGGGTGGAAAACATTTCTGGCCCCCCTTATTTAACTTTACCCCCCCCCTTTTAAAATTGGGCTTATATAAAGTCCTCCTTCGCGGAAACATATACTCCGGAATGGTTTAAAGCAAAGGGGTTCTTTTATTTTTAAAACCCCCTCCCAGTTGGATAAAGTCCCCCCCGGTTAAAGAATATAATTTACACCTGCCACAAAGTACTGCCTGGATTTTGACCCCCCATCCCTCCCCATTTTTCTTTTTTCAAAGTAGGGGGAGGTCTACGCGCGCCTTTAGTTT
  5   1   2       chi Gas1                               IMAGE:6987991                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCTCAGACAGTGTGCTTTTCCGAATGAAGAGAGAATACTGTATTGCAGACTTCAAAAGAGTGGTGGATTTTCTTAAAGAGAGAGTGCCCGGAATAACAATCGCTACGGACATCATTTGTGGCTTTCCAGGAGAGACAGATGAGGATTTTAAGGAGACATTAAAATTGGTTGAGGAGTACAAATTCCCCAGTCTCTTCATTAATCAGTTTTACCCACGCCCTGGGACCCCAGCTGCTAAAATGGAGCAAGTTCCAGCTCATGTGAAAAAGCAAAGGACCAAGGAGCTGTCCCAACTCTTCCATTCATATAGTCCCTATGATCACAAGATTGGGGAGGAGCAACACGTTTTGGTAACAGAAGAGTCCTTTGATTCTCAGTATTATGTGTCTCATAATCGTTTCTACGAACAGGTTCTTGTCCCTAAGGATCCTGCATTTGTGGGAAAAATGGTTGAAGTGAAAATTTTTGAAGCAGGGAAACATTTTATGAAGGGGCAACCAGTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAAAAGGAGAAGTTTCCGGATTAACGGAGGAGTCAAAGCCACCAAACAACCCCGAATCCCTTCTGCAGACGTCCCGGGAAGGACTACAAACCTTCTTTTTTTGTCACTGCTCTGCTGGCTGCTGTCATTGCTTTTTGTTGGAATAAAATTGCTTTAAAACAATTGTTTAGGGAACCTGGAAAAAATCTAGGCATTTTAGCCCACTTTTTTAGTCATTTTCAATTTGAATTAGGGGTGAAACTTTCTGCCCCTTTATTACTTTACCACCCATTTTAATTGGGGCTTTTAAAGTCCCCCTTGGGGGAAAATTCACCCCAGAAGGTTTAAAAAAAGGTGGTTTTTTTTTTTTAATCCCTTTCCAGGTTGGAAAAACCCCCCCTCCGGTAAAAAGATTAAGTTAAACCTTGTCCAAGTGCCGCTCCGCTCGTTTTGCTTCTCNAATTTCTCCTCCCTTTTC
  5   1   2       bld Spl2      in                       CBSS10512.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCGCCCACGCATCCGAATTTTCTTAAAGAGAGAGTGCCCGGAATAACAATCGCTACGGACATCATTTGTGGCTTTCCAGGAGAGACAGATGAGGATTTTAAGGAGACATTAAAATTGGTTGAGGAGTACAAATTCCCCAGTCTCTTCATTAATCAGTTTTACCCACGCCCTGGGACCCCAGCTGCTAAAATGGAGCAAGTTCCAGCTCATGTGAAAAAGCAAAGGACCAAGGAGCTGTCCCAACTCTTCCATTCATATAGTCCCTATGATCACAAGATTGGGGAGGAGCAACACGTTTTGGTAACAGAAGAGTCCTTTGATTCCCAGTATTATGTGTCTCATAATCGTTTCTACGAACAGGTTCTTGTCCCTAAGGATCCTGTATTTGTGGGAAAAATGGTTGAAGTGAAAATTTTTGAAGCAGGGAAACATTTTATGAAGGGGCAACCAGTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAAAAGGAGAAGTTTCCGGATTAACGGAGGAGTCAAAGCCACCAAACAACCCCGAATCCCTTCTGCAGACGTCCCGGGAAGGACTACAAACCTTCTTTTTTGTCACTGCTCTGCTGGCTGCTGTCATTGCTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGT
  5   1   2       bld Tad5      in                          XZT1190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGATTTTCTTAAGAGAGAGTGCCCGGAATAACAATCGCTACGGACATCATTTGTGGCTTTCCAGGAGAGACAGATGAGGATTTTAAGGAGACATTAAAATTGGTCGAGGAGTACAAATTCCCCAGTCTCTTCATTAATCAGTTTTACCCACGCCCTGGGACCCCAGCTGCTAAAATGGAGCAAGTTCCAGCTCATGTGAAAAAGCAAAGGACCAAGGAGCTGTCCCAACTCTTCCATTCATACAGTCCCTATGATCACAAGATTGGGGAGGAGCAACACGTTTTGGTAACAGAAGAGTCCTTTGATTCCCAGTATTATGTGTCTCATAATCGTTTCTACGAACAGGTTCTTGTCCCTAAGGATCCTGTATTTGTGGGAAAAATGGTTGAAGTGAAAATTTTTGAAGCAGGGAAACATTTTATGAAGGGGCAACCAGTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAAAAGGAGAAGTTTCCGGATTAACGGAGGAGTCAAAGCCACCAAACAACCCCGAATCCCTTCTGCAGACGTCCCGGGAAGGACTACAAACCTTCTTTTTTGTCACTGCTCTGCTGGCTGCTGTCATTGCTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTTATACTTACCACCCATTTAATGGCTTTTAAGTCTCT
  5   1   2       bld Eye                                  CCAX3712.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATCATTTGTGGCTTTCCAGGAGAGACAGATGAGGATTTTAAGGAGACATTAAAATTGGTTGAGGAGTACAAATTCCCCAGTCTCTTCATTAATCAGTTTTACCCACGCCCTGGGACCCCAGCTGCTAAAATGGAGCAAGTTCCAGCTCATGTGAAAAAGCAAAGGACCAAGGAGCTGTCCCAACTCTTCCATTCATACAGTCCCTATGATCACAAG
  5   1   2       bld Hrt1      in                        CAAQ11038.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGTTCCAGCTCATGTGAAAAAGCAAAGGACCAAGGAGCTGTCCCAACTCTTCCATTCATATAGTCCCTATGATCACAAGATTGGGGAGGAGCAACACGTTTTGGTAACAGAAGAGTCCTTTGATTCTCAGTATTATGTGTCTCATAATCGTTTCTACGAACAGGTTCTTGTCCCTAAGGATCCTGCATTTGTGGGAAAAATGGTTGAAGTGAAAATTTTTGAAGCAGGGAAACATTTTATGAAGGGGCAACCAGTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAAAAGGAGAAGTTTCCGGATTAACGGAGGAGTCAAAGCCACCAAACAACCCCGAATCCCTTCTGCAGACGTCCCGGGAAGGACTACAAACCTTCTTTTTTGTCACTGCTCTGCTGGCTGCTGTCATTGCTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTTATAATAGCATGCCGCCAAATAAAATGTAAAAAGTA
  5   1   2       bld Gas7      in                         XZG63274.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAGTCCCTATGATCACAAGATTGGGGAGGAGCAACACNGTTTTGGTAACAGAAGAGTCCTTTGATTCCCAGTATTATGTGTCTCATAATCGTTTCTACGAACAGGTTCTTGTCCCTAAGGATCCTGTATTTGTGGGAAAAATGGTTGAAGTGAAAATTTTTGAAGCAGGGAAACATTTTATGAAGGGGCAACCAGTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAAAAGGAGAAGTTTCCGGATTAACGGAGGAGTCAAAGCCACCAAACAACCCCGAATCCCTTCTGCAGACGTCCCGGGAAGGACTACAAACCTTCTTTTTTGTCACTGCTCTGCTGGCTGCTGTCATTGCTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATT
  5   1   2       bld TbA       in                   TTbA052n13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGGGGAGGAGCAACACATTTTGGTAACAGAAGAGTCCTTTGATTCCCAGTATTATGTGTCTCATAATCGTTTCGTACTAACAGCGTTCTTGTCCCTAACGATCCTGCATTTGTGGGAAAAATGGTTGAAGTGAAAATTTTTGAAGCATGGAAACATTTTATGAATGGGCAACCACTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAGAACGAGAAGTTTCCGGATTAACGGAGGATTCAAAGCCACCAAGCAACCCCTAATCCCTTCTGCAGACGTCCCGGGAATGACTACAAACCTTCTTTTTTGTCACTGCTCTGCTGGCTGCTGTCATTGCTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTG
  5   1   2       bld Mus1      in                          CABH588.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAACACNGTTTTGGTAACAGAAGAGTCCTTTGATTCCCAGTATTATGTGTCTCATAATCGTTTCTACGAACAGGTTCTTGTCCCTAAGGATCCTGCATTTGTGGGAAAAATGGTTGAAGTGAAAATTTTTGAAGCAGGGAAACATTTTATGAAGGGGCAACCAGTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAAAAGGAGAAGTTTCCGGATTAACGGAGGAGTCAAAGCCACCAAACAACCCCGAATCCCTTCTGCAGACGTCCCGGGAAGGACTACAAACCTTCTTTTTTGTCACTGCTCTGCTGGCTGCTGTCATTGCTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAAATAAATGT
  5   1   2       bld Gas                            TGas112n22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGGGGGTTGAAGTGAAAATTTTTGAAGCAGGGAAACATTTTATGAAGGGGCAACCAGTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAAAAGGAGAAGTTTCTGGATTAACGGAGGAGTCAAAGCCACCAAACAACCCCGAATCCCTTCTGCAGACGTCCCGGGAAGGACTACAAACCTTCTTTTTTGTCACTGCTCTGCTGGCTGCTGTCATTGCTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGT
  5   1   2       bld Tad5      in                         XZT65296.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGACGCGTGGGTTTTATGAAGGGGCAACCAGTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAAAAGGAGAAGTTTCCGGATTAACGGAGGAGTCAAAGCCACCAAACAACCCCGAATCCCTTCTGCAGACGTCCCGGGAAGGACTACAAACCTTCTTTTTTGTCACTGCTCTGCTGGCTGCTGTCATTGCTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTCATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATT
  5   1   2       bld Tbd1      in                        CBXT12338.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAACCAGTTCAAGATTCTTACATTTATACTCCATCCATTACTAAGCCTCTAGCAAAAGGAGAAGTTTCCGGATTAACGGAGGAGTCAAAGCCACCAAACAACCCCGAATCCCTTCTGCAGACGTCCCGGGAAGGACTACAAACCTTCTTTTTTGTCACTGCTCTGCTGGCTGCTGTCATTGCTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACT
  5   1   2       bld Egg       in                   TEgg006i03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCATCGATTCTATTTCCCCGGGTTCCGGATTAACGGAGGAGTCAAAGCCACCAAACAACCCCGAATCCCTTCTGCAGACGTCCCGGGAAGGACTACAAACCTTCTTTTTTGTCACTGCTCTGCTGGCTGCTGTCATTGCTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCA
  3   1   2       bld Gas                             TGas091i03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGGCTGCTGTCATTGCTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACGGAGATGCATTATTAAACATTATTACACGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn1 5g3  in                          CABL520.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGGCTGCTGTCATNGCTTTTGTTGAATAAAATGCTTTAAAAAACAATTGTTAGGGGAAGCTGGAAAATTTCTAGCATTTTAGCCCACTTNTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAGAAAAAAAAAA
  3   1   2      seed Ova1 5g3  in                         CABE5357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGTCATTGCTTTTGTTGGAATAAAATTGCTTAAAAAACAATTGTTTAGGGAAGCTGAAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAG
  3   1   2       bld Tad5      in                         XZT65296.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCATGCTTTTTGTTGGAATAAAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGAAAAAATTCTAGCATTTTAGCCCACTTNTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTCATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTG
  3   1   2       bld Gas       in                   TGas121c10.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATTGCTTTAAAAACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTTTTTTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTTTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTTTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTTTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTGCCCTGGGaaaaaaaaaaaaaaaaaaaaaagaaaaaaaaaaaaaaaaaa
  3   1   2       bld Mus1      in                          CABH588.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCNTTAAAAACANTGTTAGGGAAAGCTGGAANAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAGAAAAAA
  3   1   2       bld Hrt1      in                        CAAQ11038.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAATTGTTTAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTNTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAGAAAAAA
  3   1   2       bld Gas7      in                         XZG63274.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGGGAAGCTGGAAAAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCNCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAAAAAAAAAAACAAAAAATAAAAAAAAAT
  3   1   2       bld BrSp 5g3  in                     EC2BBA20BA07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATTCTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTAGATGAGAACAAGATGC
  3   1   2       bld Lun1      in                         CABD5382.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTAGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAGAAAAAAAAAAAA
  3   1   2       bld Hrt1 5g3  in                         CAAQ9686.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAG
  3   1   2       bld Mus1 5g3  in                         CABH8430.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCATTTTAGCCCACTTTTTAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTG
  3   1   2       bld Tad5                                 XZT32558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAG
  3   1   2       bld Tad5      in                         XZT35602.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTG
  3   1   2       bld Tbd1      in                        CBXT12338.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGTCATTTCAATTTGATTAGTGTGAAACTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTTTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAAAAAAAAAAAAAAA
  3   1   2       bld Brn3      in                         CAAK1793.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTTTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGGG
  3   1   2       bld Brn3 5g3  in                         CAAK3689.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGCCCATTATTACTTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAG
  3   1   2       bld Int1      in                         CAAP9072.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGCCCATTATTACTTACCCCCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCATCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGA
  5   1   2       bld Gas                            TGas112o12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTACCACCATTTAATTGGCTTTTAAGTCTCTTGGGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTT
  3   1   2       bld Tad5      in                          XZT1190.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTTTAAGTCTCTTGGGAATATACCAGGATGTAAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTA
  3   1   2       chi TbA       in                    TTbA052n13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAATATACCCAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTTTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTTTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAGACTCATTGTTGGCTCTTGCGAGTTTTATTTTTAGCCAATCTGTTAAGGCTGGTGCTATTGTCATGGACATGAAAAGCTCAATAAAAGTTAAGGATAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Spl2      in                       CBSS10512.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGATGTTAAAGATGTGTTTTTTTTTAATCCTTCAGTTGATAGTCCCTCTGTAAGAGTAAGTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAGACCC
  3   1   2       bld Egg       in                    TEgg006i03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTAACCTGCAATGCTGCTGCGTTGCTCGATTCTCCACTTCTTTTTCATATTGTGATCTTCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAGAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas1 FL   in                    IMAGE:5308174.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGCCTTAGTTCTGTACATGTGATACTTGTAAATACAAGCGTCAGTGCCAGATGCTGTGACCTGGCTTCATCCTGATGAAGGAAACACAGGGGGAAAGGTCACGTTTATTAATAGCATGCCGCCAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAGAAAAAAGGTTAAAAAAAAAAAACAAAAAAAAAAAAAG
  3   1   2       bld Gas1      in                     NISC_mq07e02.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAATAAAATGTAAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTTTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTTTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTTTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTTCCCTGGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  5   1   2       bld Neu                            TNeu084g14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAAAGTATTTTTTTTTCCTTTTGTTACTATCCATGTGAGCAGTCATACTGATAAATTCTTTCCAGCCAAGTGAGAAAAGAAGGGATATGTTTCCAATCAAAAAGCAGAAAAGTCAAATACTGATTAATTTCTTCTCATCTAAATGTGGCATCTCCAGTTTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGG
  5   1   2       bld Tad5                                  XZT6967.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGTGCATGAGTCGCTCCTCACTGTGTCTGACTGCTCCATATACAGGTCAATTTGATTGGATAATTGTGCACCATTTCACTTTAGGTAAGCAGTGATGTGCACTCTTGTTTCCTGTAGATAATTAAAGTCTGCCGACCGCAACCGGTGATGTGCGTGTGTGTGTTTTGAAAATGCATTAAGTTATTCTGAAACATTGTTCACATTTTTTTTTTGCCTTACTGGGATATTTGCTTTTATTGAGATGAGAACAAGATGCATTATTAAACATTATTTACACTGAGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)