Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 29 Mar 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012073611 Xt7.1-CABH10443.3 - 52 ESTs
                                                                       .0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABH10443.3  GCCGCGCCCCCTTGTAATAATACGCTATTCAGGATTACTCAGCCAGTGCGGTCGCATTGCACAAGGGAATCCCATATAAGCAAACACCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCTACAAAA
                                                  Xt7.1-CHK-1008225553        CCCCCTTGTAATAATACGCTATTCAGGATTACTCAGCCAGTGCGGTCGCATTGCACAAGGGAATCCCATATAAGCAAACACCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCT
                                                      consensus depths       2     2     2     2     2     2     3     3     5     6     9    10    10    12    10    12    12    13    13    14    14    15    16    17    16    17    17    17    17    17    17    18    20    20    20    20    20    20    20    21    20    21    20    21    21    22    23    25    24    25    24    25    25    26    26    27    26    27    27    28    27    28    29    30    31    31    31    31    31    31    32    32    32    34    32    34    32    34    33    35    34    36    37    39    40    42    40    42    40    42    40    42    39    41    41    43    42    44    43    45    42    44    42    44    42    44    42    44    40    42    40    42    39    42    39    40    40    41    39    40    39    40    38    40    39    41    39    40    40    41    38    41    37    41    39    41    38    40    38    40    37    39    38    39    37    38    37    38    36    37    36    37    34    35    34    35    34    35    34    35    28    31    30    31    29    30    28    29    29    29    29    29    18    28    18    28    18    28    18    28    17    28    17    26    16    24    16    24    16    24    16    23    16    23    15    23    11    23     2     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---A--------
                                               BLH ATG      91     421  
                                               BLH MIN      91     105  
                                               BLH MPR      13     105  
                                               BLH OVR      91     633  
                                               CDS MIN      91     105  
                                               ORF LNG      91      33  
                                                                                                                                                                                                                                     PROTEIN --- Sc ---- 3e-012     NP_010558.1 Cytoplasmic glyoxylase-II; Glo2p [Saccharomyces cerevisiae] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                          PREDICTED - Gg ---- 6e-035     XP_424095.2 PREDICTED: similar to HSCO protein, partial [Gallus gallus] ==================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                      PROTEIN --- Ce ---= 2e-068     NP_501684.1 glyoxalase II (26.4 kD) (4K272) [Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                             PREDICTED - Sp ---- 5e-075     XP_790487.2 PREDICTED: similar to Ethe1-prov protein [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                 PROTEIN --- Dm ---- 6e-078     NP_725047.1 CG30022-PA [Drosophila melanogaster] -------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                     PREDICTED - Dr ---- 4e-093     NP_998094.1 hypothetical protein zgc:85680 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                  PROTEIN === Hs ==== 2e-099     NP_055112.2 ETHE1 protein; hepatoma subtracted clone one [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                               PROTEIN --- Mm ---- 5e-101     NP_075643.1 HSCO protein [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                   PREDICTED = Xl ==== 8e-143     AAH41511.1 Similar to RIKEN cDNA 0610025L15 gene [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                   PROTEIN === ?? ==== 8e-143     NP_001079404.1 ETHE1 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                   PROTEIN === Xt ==== 4e-148     AAH75280.1 Ethylmalonic encephalopathy 1 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABH10443.3                                                                              TAA------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------TGATGA------------------------------------------------------TAA---ATG------------------------------------------------------------------------TAATAA---------ATG------------------------ATG------------------------------TGA---------------ATG---------TAATGA---------TAG
                                                                   ORF                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   1           Abd0 FL                     IMAGE:6999567.FL-MGC                                                        CGTTGCACAAGGGAATCCCATATAAGCAAACACCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCTAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg121c03.FL-Sanger                                                             CACAAGGGAATCCCATATAAGCAAACACCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5g                        TEgg122n17.p1kSP6 GGCCGCGCCCCCTTGTAATAATACGCTATTCAGGATTACTCAGCCAGTGCGGTCGCATTGCACAAGGGAATCCCATATAAGCAAACACCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCT
  5   1   2       bld Gas  5g                        TGas111m18.p1kSP6  GCCGCGCCCCCTTGTAATAATACGCTATTCAGGATTACTCAGCCAGTGCGGTCGCATTGCACAAGGGAATCCCATATAAGCAAACACCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACT
  5   1   2   14  bld Brn4 5g3  in                        CAAL19009.5p .................................GATTACTCAGCCAGTGCGGTCGCATTGCACAAGGGAATCCCATATAAGCAAACACCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGAACCCTCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGC
  5   1   2   14  bld Brn4 5g3  in                        CAAL20242.5p ......................................CTCAGCCAGTGCGGTCGCATTGCACAAGGGAATCCCATATAAGCAAACACCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCCAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCAACT
  5   1   2   14  bld Te5  5g3  in                         CAAO9993.5p ......................................CTCAGCCAGTGCGGTCGCATTGCACAAGGGAATCCCATATAAGCAAACACCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAATCTGCCTAAACCCAAACAGATAGATGTTGCTGTTC
  5   1   2       chi In54                            IMAGE:8943676.5p                                             GGTAGATAAGCCGAGGAGGGGGAAATTTTAATTTATTCGTCCCCCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCACTCCCGAAAAGAAAAATGGGCAATTTTCATCCAACCATTAAGCTTCATCATGATTTTGATGCAGAACGAGATGCAAAGAAAATATATAAGGCATGCAAAGGTCTAGGAACAGATGAAAAAGCAATCATAGAGATTCTGGCCAACAGGACTTCAGACCAACGCAAGAATTGAAACAGAAATACAAGACGTTATATGGCAAGGATTTGGAGAGTGTTCTAAAGAGTGAGCTGAGCGGGACTTTGAGAGACAGCATTAGCGCTGTTGGACCGCCCATGTGAATCGATGCCCGCGAGCTCAGGACGCCATGAAGGAGCTGACCACGAGTCTTGTGATACAGATTTTATGTCACTAGGTCAACCAGCAAATAAGCACAAAGAGGCTATAGGAGATGTGACGAATCGAGTCCGAACTAAGAAGGGAACAGGTGGAC
  5   1   2       bld Abd0 FL   in                       IMAGE:6999567                                                        CGTTGCACAAGGGAATCCCATATAAGCAAACACCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTNAACCCTGCTAANNCCTAACAGATAGATGTTGCTGTTCCAGCCNACTTGAAATGC
  5   1   2       bld HeRe 5g3  in                     EC2CAA42CF06.g1                                                        GATTGCACAAGGGAATCCCATATAAGCAAACACCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAATACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCA
  5   1   2   10  bld Te1  5g3  in                        CBWN17073.b1 .......................................................CATTGCACAAGGGAATCCCATATAAGCAAACACCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGT
  5   1   2       bld Egg  FL                        TEgg121c03.p1kSP6                                                             CACAAGGGAATCCCATATAAGCAAACACCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTC
  5   1   2       bld Gas  5g                        TGas037o24.p1kSP6                                                                      ATCCCATATAAGCAAACACCGAGNTGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGNGCATGACTACACAGGTCAGACAGTGTCATCAG
  5   1   2       bld Egg  5g                        TEgg083l11.p1kSP6                                                                       CCATATAAGCAAACACCGAGATGTTGTTCGTATCTCTGAGACAGGCGGCGCTCTCACAATGCAGGAGATACAGCGTCTATGGACTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAGAACACCAAAGAAGCCATTCTGATTGACCCCGTGCTGGAAAAAGCACAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAACAAGCTTCTACCTGGGTGCAAAAGTGTCGTCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACGTACAAGAGGGGGATCTAATCAAGTTTGGGAATATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACATACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGTGGACGGACAGATTTCCAGCAAGGATGCCCCGAGACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACACTGGGCATGACTACAC
  5   1   2       bld Lun1      in                         CABD5053.5p                                                                                        CCGAGATGTTGTTCGTAGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGA
  5   1   2       bld Egg       in                   TEgg012m14.p1kSP6                                                                                                        AGCTCTGAGACAGGCGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACGAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGCATGACTA
  5   1   2       bld Ski1      in                         CABJ4725.5p                                                                                                                      CGGCGCTCTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCCAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCAACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATG
  5   1   2       bld Liv1      in                         CAAR7072.5p                                                                                                                             CTCACAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTAT
  5   1   2       bld BrSp      in                     EC2BBA25DA09.g1                                                                                                                               GGGAGTGCAGGAGATACAGCGCTATGGCTGCCAGCAATGGACTCGTCTTTAGGCAGTTGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCC
  3  -1   2       bld Mus1      in                        CABH10443.3p                                                                                                                                                                                    CGAGAGGCTTGAACAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCCTGCTGATGCCTTCCGGCTATGATC
  5   1   2       bld Tbd1      in                         CBXT9182.b1                                                                                                                                                                                        GGTTTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCT
  5   1   2       bld Hrt1      in                        CAAQ11998.5p                                                                                                                                                                                           TTGAACCAGTCAGTTGTACGTACACCTACCTGCTGGCCGATAAAAACACCAAGGAGGCCATTCTGATTGACCCCGTGCTGGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAG
  5   1   2       bld Neu                            TNeu095o18.p1cSP6                                                                                                                                                                                                                                CCGGGGggtaattctagagctaatacatgccgacgagcgctgacccccaggatgcgtgcatttatcagaccaaaaccaatccggggcccccgcgccccggccgctttggtgactctagataacctcgggccgatcgcacgtccccgtgCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATC
  5   1   2       bld Te5       out                        CAAO6053.5p                                                                                                                                                                                                                                                                          GGAAAAAGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCCAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCAACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGNGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGGGAGATGGTTTCGTTTGCCTTGNTATCGTTCTCACAATGAGCTCATACCTGCTTGATGC
  5   1   2       bld Lun1      in                         CABD4345.5p                                                                                                                                                                                                                                                                                AGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCCAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCAACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGNGAAAGTGGCTAAATGCTCCT
  5   1   2       bld Lun1      in                         CABD4441.5p                                                                                                                                                                                                                                                                                AGCAGAACGAGATGCAAAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCCAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCAACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTTATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGG
  5   1   2       bld Egg                            TEgg140j06.p1kSP6                                                                                                                                                                                                                                                                                    CCGGGGCCCGGGGAACTCATCAAGGACCTGGGGTTCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCT
  5  -1   2       bld Mus1      in                        CABH10443.5p                                                                                                                                                                                                                                                                                                                  GGGTNCAATATGATCTTTGCAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGA
  3   1   2       bld Hrt1      in                        CAAQ11998.3p                                                                                                                                                                                                                                                                                                                                     CAGCCAACACTCACTGCCACGCAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTGTTTTCCAGGCCTCTCGCCCATA
  3   1   2      seed Lun1      in                         CABD5053.3p                                                                                                                                                                                                                                                                                                                                                          CAGACCATATCACTGGCACCGGCGTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCT
  3   1   2       bld Ski1      in                         CABJ4725.3p                                                                                                                                                                                                                                                                                                                                                                                 GTGCTGAAGAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCCAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCAACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGGGAGATGGTTTCGTTTGCCTTGTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACAGAGCCTGCATTGCTGTATATTTTGTAAAGTATTTGTTTTCCAGTAAAATATTGATCCT
  3   1   2       bld Abd0 FL   in                       IMAGE:6999567                                                                                                                                                                                                                                                                                                                                                                                   TGCTGAGAAGCTTCTACCTGGTGGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTGTTTCGCAGTAAAAAAAAT
  3   1   2       bld Liv1      in                         CAAR7072.3p                                                                                                                                                                                                                                                                                                                                                                                         GAAGCTTCTACCTGGGTGCAAAAGTGTCATCTCCAAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCT
  3   1   2       bld TpA                             TTpA033i11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                           AAGGACAGCGGCGCTCGGGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCCAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCAACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGGGAGATGGTTTCGTTTGCCTTGTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACAGAGCCTGCATTGCTGTATATTTTGTAAAGTAATTTGTTTTCCAGTAAAATATTGATC
  3   1   2       bld Brn4 5g3  in                        CAAL20242.3p                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCCAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCAACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGGGAGATGGTTTCGTTTGCCTTGTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACAGAGCCTGCATTGCTGTATATTTTGTAAAGTATTTGTTTTCCAGTAAAATATTGATCCT
  3   1   2       bld Brn4 5g3  in                        CAAL19009.3p                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCGACGTCTACATACAAGAGGGGGATCAAATCAAGTTGGGAAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCCAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCAACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGGGAGATGGTTTCGTTTGCCTTGTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACAGAGCCTGCATTGCTGTATATTTTGTAAAGTATTTGTTTTCCAGTAAAATATTGATCCT
  5   1   2       bld Egg       in                   TEgg006d17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTTTGGGAATTTTGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGC
  3   1   2       bld Tbd1      in                         CBXT9182.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGGTGGAGGCGCGTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCGAAAAAAAAAAAAAAA
  3   1   2       bld Te5  5g3  in                         CAAO9993.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGCGCGTTCCACTCCCGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCCAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCAACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGGGAGATGGTTTCGTTTGCCTTGTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACAGAGCCTGCATTGCTGTATATTTTGTAAAGTATTTGTTTTCCAGTAAAATATTGATCCT
  3  -1   2       bld Liv1      in                         CAAR5306.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAGAGGCTTCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCTACAAAAAA
  5  -1   2       bld Liv1      in                         CAAR5306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCACTCCCGGACACACAGATGGCTGCCTCACCTACGTATTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCTACAAAAAA
  3   1   2       bld BrSp      in                     EC2BBA25DA09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGACACACAGACGGCTGCCTCACCTACGGACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCCAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCAACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGGGAGATGGTTTAGTTTGCCTTGTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTAAAAATTAGCCTGCGCAGAGGTACAGAGCCTGCAT
  3   1   2       bld Lun1      in                         CABD4345.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGATCCCCCGACTCCCTAAAGATGAAGCTGAGTTTGTGAAGTTCA
  3   1   2       bld Lun1      in                         CABD4441.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGAACCCCCGACTCACTAAAGATGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCCAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCAACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGGGAGATGGTTTCGTTTGCCTTGTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACAGAGCCTGCATTGCTGTATATTTTGTAAAGTATTTGTTTTCCAGTAAAATATTGATCC
  3   1   2       bld Te1  5g3  in                        CBWN17073.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACCTTTATCCCAATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTCGCTTGCCTTGTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCTAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg012m14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAGATGCACTCCTCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCCAGTAAAATATTGATCCTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg006d17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCCAGTAAAATATTGATCCTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas0                                 dad46a05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCTGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGNAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCAGACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCCAGTAAAATATTGATCCTAAAAAA
  3   1   2       bld Egg       in                    TEgg071h23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCTAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg071h23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCT
  3   1   2       bld HeRe 5g3  in                     EC2CAA42CF06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACTAAAGATGAAGCAGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCAACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGAATATTTTTGAATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGGGGAGATGGTTTTGCTTGCCTTGTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGC
  5   1   2       bld Egg                            TEgg006g09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCC
  5   1   2       bld Liv1                                 CAAR7330.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld Gas                            TGas006e14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTAAACCTGCCTAAACCTAAACAATAGATGTTGGTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAAGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAACATGAACCAATGTTAGTCCTGTTCTTTCGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTGCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAACCTGCGCAGACGTACGGAGCCTGCATTGCTGGGTATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCTTAAATAAGAAACCATGCAAAAAGCATTTTAAAAATACCCTACGTGAATCTCGTATGTGCCCGGGACTTGGGGGGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)