Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 20 Sep 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 96%

 1012073611 Xt7.1-CABH10443.3 - 52 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths       2     2     2     2     2     2     3     3     5     6     9    10    10    12    10    12    12    13    13    14    14    15    16    17    16    17    17    17    17    17    17    18    20    20    20    20    20    20    20    21    20    21    20    21    21    22    23    25    24    25    24    25    25    26    26    27    26    27    27    28    27    28    29    30    31    31    31    31    31    31    32    32    32    34    32    34    32    34    33    35    34    36    37    39    40    42    40    42    40    42    40    42    39    41    41    43    42    44    43    45    42    44    42    44    42    44    42    44    40    42    40    42    39    42    39    40    40    41    39    40    39    40    38    40    39    41    39    40    40    41    38    41    37    41    39    41    38    40    38    40    37    39    38    39    37    38    37    38    36    37    36    37    34    35    34    35    34    35    34    35    28    31    30    31    29    30    28    29    29    29    29    29    18    28    18    28    18    28    18    28    17    28    17    26    16    24    16    24    16    24    16    23    16    23    15    23    11    23     2     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---A--------
                                               BLH ATG      91     421  
                                               BLH MIN      91     105  
                                               BLH MPR      13     105  
                                               BLH OVR      91     633  
                                               CDS MIN      91     105  
                                               ORF LNG      91      33  
                                                                                                                                                                                                                                     PROTEIN --- Sc ---- 3e-012     NP_010558.1 Cytoplasmic glyoxylase-II; Glo2p [Saccharomyces cerevisiae] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                          PREDICTED - Gg ---- 6e-035     XP_424095.2 PREDICTED: similar to HSCO protein, partial [Gallus gallus] ==================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                      PROTEIN --- Ce ---= 2e-068     NP_501684.1 glyoxalase II (26.4 kD) (4K272) [Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                             PREDICTED - Sp ---- 5e-075     XP_790487.2 PREDICTED: similar to Ethe1-prov protein [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                 PROTEIN --- Dm ---- 6e-078     NP_725047.1 CG30022-PA [Drosophila melanogaster] -------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                     PREDICTED - Dr ---- 4e-093     NP_998094.1 hypothetical protein zgc:85680 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                  PROTEIN === Hs ==== 2e-099     NP_055112.2 ETHE1 protein; hepatoma subtracted clone one [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                               PROTEIN --- Mm ---- 5e-101     NP_075643.1 HSCO protein [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                   PREDICTED = Xl ==== 8e-143     AAH41511.1 Similar to RIKEN cDNA 0610025L15 gene [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                   PROTEIN === ?? ==== 8e-143     NP_001079404.1 ETHE1 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                   PROTEIN === Xt ==== 4e-148     AAH75280.1 Ethylmalonic encephalopathy 1 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABH10443.3                                                                              TAA------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------TGATGA------------------------------------------------------TAA---ATG------------------------------------------------------------------------TAATAA---------ATG------------------------ATG------------------------------TGA---------------ATG---------TAATGA---------TAG
                                                                   ORF                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  3   1   2       bld Lun1      in                         CABD4345.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGACACACAGACGGCTGCCTCACCTACGTACTGAATGATCAGAGCATGGCATTTACTGGAGATGCACTCTTGATCAGAGGCTGCGGACGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCCGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCTTGATCCCCCGACTCCCTAAAGATGAAGCTGAGTTTGTGAAGTTCA
  3   1   2       bld Gas0                                 dad46a05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGACAGATTTCCAGCAGGGTTGCCCCAAAACCCTGTACCACTCTGTGCACACCAAGATATTCTCCTTGCCCGACAGCTGCCTACTGTACCCTGGGCATGACTACACAGGTCAGACAGTGTCATCAGTGNAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCAGACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCCAGTAAAATATTGATCCTAAAAAA
  3   1   2       bld Egg       in                    TEgg071h23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCTAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg071h23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTCAGACAGTGTCATCAGTGGAGGAAGAGAAGCGCCTGAACCCCCGACTCACTAAAGACGAAGCTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCT
  3   1   2       bld HeRe 5g3  in                     EC2CAA42CF06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACTAAAGATGAAGCAGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCAACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGAATATTTTTGAATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGGGGAGATGGTTTTGCTTGCCTTGTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGC
  5   1   2       bld Egg                            TEgg006g09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCC
  5   1   2       bld Liv1                                 CAAR7330.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAGTTTGTGAAGATCATGAATAACTTAAACCTGCCTAAACCTAAACAGATAGATGTTGCTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAGGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAAGATGAACCAATGTTAGTCCTGTTCTTTCGGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTTCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAGCCTGCGCAGAGGTACGGAGCCTGCATTGCTGTATATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld Gas                            TGas006e14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTAAACCTGCCTAAACCTAAACAATAGATGTTGGTGTTCCAGCCAACTTGAAATGCGGAATTCAGGATCCTTGATGACATCACGTTTATCCCGATGACCTCATTCCGACTCGTATAATCAGCCAGTGGCCTTAACAGATGAACGACAATGAACTCGCTGTTTCTAGCATATTTTTGTATGAAGGGAAGGTGGCTAAATGCTCCTTTTGTTTTTAATAACATGAACCAATGTTAGTCCTGTTCTTTCGGGGGAGATGGTTTTGCTTGCCTTTTTATCGTGCTCACAATGAGCTCATACCTGCTTGATGCCTTCCGGCTAATGATCTCCTCGTTAACCTGCGCAGACGTACGGAGCCTGCATTGCTGGGTATTTTGTAAATTATTTGTTTTCCAGTAAAATATTGATCCTTAAATAAGAAACCATGCAAAAAGCATTTTAAAAATACCCTACGTGAATCTCGTATGTGCCCGGGACTTGGGGGGG

In case of problems mail me! (