Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 86%

 1012073612 Xt7.1-TEgg016d04.3 - 67 ESTs
                                                                       -690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TEgg016d04.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGAGGCTCCGCCCACAGGCTCGCTGTTCCATCATGGCGGATCCCGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTGTTTTCTACAAAATAAACCCGTATTTTGCCAGTAGCACTTAGGGATGTAA
                                                  Xt7.1-CHK-1008224534                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCGCCCACAGGCTCGCTGTTCCATCATGGCGGATCCCGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTGTTTTCTACAAAATAAACCCGTATTTxxCxxxTAGCACTTxxGGxxxxxAAAAACA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        2     2     2     2     3     4     8     9    13    14    19    20    19    21    25    27    25    27    26    27    26    27    26    27    26    27    25    27    25    27    26    28    26    28    26    28    26    28    26    28    26    28    26    28    25    28    26    29    26    29    27    30    28    31    28    31    28    31    28    31    28    31    28    31    28    31    28    31    28    31    28    31    29    32    29    32    29    33    30    34    31    34    31    34    30    33    30    33    30    33    30    33    32    33    30    33    30    33    30    33    30    34    31    34    31    34    31    34    30    33    30    33    30    33    29    31    28    31    27    30    26    29    27    30    27    31    28    31    25    29    23    28    22    27    22    26    20    25    21    25    18    25    19    25    17    22    18    22    17    22    18    21    16    20    21    22    19    20    22    24    22    23    23    24    22    23    22    23    23    24    22    24    24    25    25    26    26    27    26    28    29    30    31    32    31    32    33    34    33    34    33    34    35    36    35    36    35    36    34    35    34    35    33    35    33    34    33    34    33    34    32    33    32    33    32    33    33    33    33    33    33    33    33    33    33    33    33    33    32    32    32    32    32    32    32    32    31    31    30    30    30    30    30    30    30    30    29    29    29    29    29    29    28    28    28    28    28    28    29    29    29    29    29    29    28    28    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    18    18    17    18    16    17     9    17     9    17     5    14     3    10
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---C--------
                                               BLH ATG      33     212                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH MIN      33     151                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH OVR      33      45                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               EST CLI      44      25                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               ORF LNG      33       4                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                                                       PROTEIN --- Dm ---- 5e-028     NP_524437.2 CG6376-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 8e-033     NP_507289.1 transcription factor E2F-like, acts with DPL-1 and LIN-35 Rb to antagonize Rassignaling (39.5 kD) (efl-1) [Caenorhabditis elegans] ---===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Xt ---- 1e-037     AAH84507.1 Hypothetical LOC496522 [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Ci ==== 3e-079     BAE06393.1 transcription factor protein [Ciona intestinalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Sp ==== 3e-092     XP_799123.2 PREDICTED: similar to E2F transcription factor 4 [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dr ---= 1e-140     NP_998597.1 E2F transcription factor 4 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Hs ---- 2e-145     NP_001941.2 E2F transcription factor 4; p107/p130-binding protein [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Mm ---- 3e-146     NP_683754.1 E2F transcription factor 4 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 1e-146     XP_001231948.1 PREDICTED: hypothetical protein [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 0          AAH77333.1 E2f4-prov protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === ?? ==== 0          NP_001086706.1 E2F transcription factor 4, p107/p130-binding [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TEgg016d04.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------TGA------------------------------TGA------------------------ATG------------------------------TGA---------------------------------------------------------------------------------------------TGATGA------------------------TAG---------------------------TAA---------------TGA------------------------------------------------------------------------------------------------------TAA---------------TAGTAG---------------------------ATG------------------------------------------------------------------------------------------------------------TGA------ATG------TGA---------------------------------TGA------------------------------------------------TAG---------ATGTAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  0   1   1           HeRe FL                   EC2CAA21BF10.FL-Pollet                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGCAGGTGACCGGAGGCTCCGCCCACAGGCTCGCTGTTCCATCATGGCGGATCCCGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAagaccTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGgccCAGCATTGACTCcACAAAATGATACTGCTGCTAgcCCCAGTTCCTgctATGCCCgacaGTCCTATTTcaaattcagagtcacaagattgcacAactgaccaaaccctcagtatggaaaacaccgcttcctctcgtctttcaagtaTAGaTacatgtcCacttcaGtcTTCAGCCTctttggacAACAGTACCgacttaccaGATCCCTCTACCTCattccagCCaattaAATCAgatctctCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTCTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCaccaTGAACTATTTGTAATTTTTtgtttcTACAaaatgaaccccc
  5   1   1           Gas  FL                     TGas106m05.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGCTGTTCCATCATGGCGGATCCCGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTTGTTTTCTACAAAATAAACCCGTATTTGCCAGTAAAAAAAAAAAAAAAAAA
  5   1   2   12  bld Gas7 PIPE in                         XZG65497.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCAGTTTGAGCAGGTGACCGGAGGCTCCGCCCACAGGCTCGCTGTTCCATCATGGCGGATCCCGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTA
  5   1   2       bld HeRe FL   in                     EC2CAA21BF10.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGCAGGTGACCGGAGGCTCCGCCCACAGGCTCGCTGTTCCATCATGGCGGATCCCGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACC
  5   1   2       chi Ovi1      in                          CABI744.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTATAGACCAGTGAGTGAAGCTCACTTCATGAAAAGTTGTTGAATTTGTTGTAAACCATAAGTGGCAGCCTTACTTGCCCTTCTCTCTCTTTTTTTTCTCCTTTGAAGAGTAGATAAAGGAATAGAAAGATTTAAGAATACAAATATAGGGTGTTGTAGTGGTAATGTATACTTGTGCATTTTTTTCAACACCTATGTCTTTACACTGTTTTATATCATGTATTCTGTCTAATCGTGATATTTTCACTAGGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGGAAACACAGCTTCCTCTCGTCTTTCAAGT
  5   1   2       bld Gas  FL   in                   TGas106m05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTGTTCCATCATGGCGGATCCCGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTT
  5   1   2   10  bld Ovi1 5g3  in                         CABI6655.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGGGCGGATCCCGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCANATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTNCAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCA
  5   1   2       bld Te5       in                        CAAO10426.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGGCGGATCCCGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACANAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAATTCAGAGTCACAAGATTGCANCACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCA
  5   1   2       bld Te5       in                         CAAO3636.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGCGGATCCCGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCCAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACACAGTACCGACTTTACA
  5   1   2       bld Egg                            TEgg129i04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGGATCCCGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGCGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACC
  5   1   2       add Gas       out                  TGas113g14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGGATCCCGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGTATATACATGAGCTCTAGGTTTCTTATAAACACATAATTAAATGTATATGCACGTCCACATGTGCACTCTATTAATTATATTGAGATATCTGGATCTCTCGTGTTTGTTTGTAAATGTGTCGATGTTTCGCACGTTTATACCATATAAATGGGCTGCTATGTTTGCATATGGATTCTATACCAGTATGCCTGTAGCTGAGACATATTGGGTGAATTGTTCAGTGAGGGTTTTGCTAGGTTACGTGCACGATATGTGTAGAACTTGCAGAGTGTCAGTGCTTGATAACTGAGGGCTTGCCCTTCTGAAGATCAGTCAATTTGCGGTTTTCATCGTACGATAATGTATCTCCTGCACATGCCTGCATTGCAACAGTGTGGTAGCCTACTTTCTAAGCTGTTATAGATGCACAGTGTCTATTGCTGGTTTTGTACAGAGGGTTCCTCGACCCCAAAAACTATTTTTGCTTAAGGAAAGAAACCTACTTTTAAGCAAATGTCCAATCATAAACTATTTAAAACGC
  5   1   2       bld Te1                                  CBWN4314.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGATCCCGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCA
  5   1   2       bld Te5                                  CAAO5565.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCANATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTNCAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACACAGTACCGACTTTACAGATCCCTCTACCTCATTCCCAGCCAATTAATCAGATCTCT
  5   1   2       bld Gas7      in                         XZG57726.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTT
  5   1   2       bld Gas7      in                         XZG65861.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGGTCACTTCAGTCTTCAGCCTCTTTGGACAACGTACCGAC
  5   1   2       bld Te1       in                         CBWN1709.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTCATCTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACA
  5   1   2       bld TbA       out                  TTbA035f21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGTATGTTGTTCATGCACGTAAGATTCTTACTGTCTGTTGCATATAAATGTTTTGTAAAGTTTTGCTTGGAGCATTAAATTGTATATTCAGTTGAACTGATACACTTGGAAGAAGTGAAATGCTAGCAACCTACACATGCTTCAAGATTTAACCTGGAAAGAAAAAGTATAAATATTGAACTGTATCAGTAAACAATGCTTTTTTTCATTACTAACAATGATAAAAAATATAGGTTTAGTTGAACATTATTTGCATATCTCCTTTTTATCACACAACCCCATTTATTAGGATTCAGTTTATATTTTCACACATGATTTAATAGCATTGTTATTAGATATTTTGAATATTGATATAGTTAAAGGAcaagtgacttaaatcgcttaccttgtaccctgngctggtgcccctgttaggagaaaacagca
  5   1   2       bld Te5       in                         CAAO3467.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCCGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACANAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCANCAGATTTGGCACACTGACCAANCCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAGTATAGATACATGTCCACTTCAGTCTT
  5   1   2       bld Int1      in                         CAAP8609.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGAGGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTGGGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCATCAGATTGCACAACTGACCAAACCCTCAGTATG
  5   1   2       bld Te1       in                        CBWN17431.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCTTC
  5   1   2       bld Gas       in                   TGas138g04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAG
  5   1   2       bld TpA       in                   TTpA056g04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCACACCAAGCCGGCACGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGCGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACT
  5   1   2       bld TpA                            TTpA052p14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCAGCCGGCACGAAAAAAGCCTTGGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCANCAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGT
  5   1   2       bld Egg       in                   TEgg018m17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACA
  5   1   2       bld Te1                                  CBWN3904.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAAC
  5   1   2       bld TpA                            TTpA016n22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGTATGTTGTTCATGCACGTAAGATTCTTACTGTCTGTTGCATATAAATGTTTTGTAAAGTTTTGCTTGGAGCATTAAATTGTATATTCAGTTGAACTGATACACTTGGAAGAAGTGAAATGCTAGCAACCTACACATGCTTCAAGATTTAACCTGGAAAGAAAAAGTATAAATATTGAACTGTATCAGTAAACAATGCTTTTTTTCATTACTAACAATGATAAAAAATATAGGTTTAGTTGAACATTATTTGCATATCTCCTTTTTATCACACAACCCCATTTATTAGGATTCAGTTTATATTTTCACACATGATTTAATAGCATTGTTATTAGATATTTTGAATATTGATATAGTTAAAGGAcaagtgacttaaatcgcttaccttgtaccctgggctggtgcccctgttaggagaaaacagcaccagcctggggtacctgtccaggagcgcttcctccttcctACTCACGCTGCAGCCAATTGTCCCGGACAAACGCATGCGCCAGTAGAAGTTGAAAGGCTGANCTTCTCTGGTTCAAAGTTTCGGCTTTTCACTCTACTGCCGCATGCACGCGCG
  5   1   2       bld TpA                            TTpA039l09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTTGGGCTACTCACCANNGCAAGTTNNCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAGGGCAGCATTGACTCCCACAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCC
  5   1   2       bld Te1       in                         CBWN4568.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCANATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTT
  5   1   2       bld TpA       in                  TTpA022g10.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTTGGGCTACTCACCAGCAAGTTCGTTTCTCTTTTGCAAGAGGCAGAGGACGGGGTTTTGGACCTCAAGGCGGCAGCTGATACTTTAGCAGTGAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGC
  5   1   2       bld Spl1      in                         CABK3154.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGACAAAAACGCAGAATCTATGACATCACTAATGTTTTAGAAGGAATTGGATTGATTGAGAAGAAATCAAAGAACAGTATTCAGTGGAAGGGGGTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAAC
  5   1   2       bld Gas                            TGas014j09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTAGGCCCTGGGTGTAATACACGGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCC
  5   1   2       bld Egg       in                   TEgg016d04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGAGATTGCTGACAAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATC
  5   1   2       bld Gas7      in                          XZG7066.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGACAACTTATTGACCTGAAGGCAGAACTTGCTGACCTTGAGCAGCGGGAACAGGAACTGGACCAGCAGCGTGTGTGGGTTCAGCAGAGCATAAAAAATGTCACAGATGATGTGCAGAATACTGGGCTAGCATATCTTACTCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCTACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATNATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCCTATTTG
  5   1   2       bld Te1       in                         CBWN2121.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCATATCTTACCCATGAGGATATATGCCGCTGTTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGGCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTC
  5   1   2       bld Ova1      in                         CABE8568.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCGGCACGAGGCCGCTGTTTAGAGGAGACACCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATAC
  5   1   2      seed Ova1      in                        CABE12607.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCCATCGATTCGCCTACTTGCAATTAGAGCCCCATCAGGCACATGTTTAGAAGTGCCAGTTCCAGAGAATACCAATGGGCAGAAGAAGTTTCAGATTCACTTAAAAAGTACAACTGGCCCAATAGAAGTACTTTTGGTTAACAAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCA
  5   1   2       bld Tad5                                 XZT11257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTCTTTTGGTTAACAAGATACATCAAGCTCTCCCCCAGTTGTTGTCCCTGTTCCACCTCCAGAAGACCTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTTATAAGTCCATTACTACATCTG
  5   1   2       bld TbA                            TTbA011f06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCATCCAGGCTCCAGCTACAGTACCCAGTACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTA
  5   1   2       bld Te1                                  CBWN9983.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACACCACAAAGGCCAGCATTGACTCCACAAAATGATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCAC
  3   1   2       bld Te5       in                         CAAO3636.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATACTGCTGCTAGCCCAGTTCCTGCTATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGGAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGT
  5   1   2       chi Tad5      in                          XZT6563.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTaaacctttccagttttttcgtgcaagcgtatggggaaaagtcgtgcggcgtacgacaaaatcgtgcggacgcccaaaaaattcagcgaaaaaacgctctgagcgttcatgcctttgttaatgtgccccttggtgtTGGTATGTAGAATGATGTTGGTTGTATAGGTATAGATTTGTATTAAGATACAGTCTCTCTATATAAATCATATCAGAAGCACTTATGACTGATACCACTGCTGGCCCTGTATGTGGGCACCTGCTTATGCTTGAAAATACTCATGATATTTTTTTTTTTTTTTCAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGA
  3   1   2       bld Te5       out                       CAAO11537.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGCCCGACAGTCCTATTTCAAATTCAGAGTCACAAGATTGCACAACTGACCAAACCCTCAGTATGAAAAACACAGCTTCCTCTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGT
  3   1   2       bld Te1       in                        CBWN17431.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCGTCTTTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA056g04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCAAGTATAGATACATGTCCACTTCAGTCTTCAGCCTCTTTGGACAACAGTACCNGACTTACCCAGATCCCTTCTACTCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTACCCGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                          XZG7066.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGTCTTCAGCCTCTTTGGACAACAGTACCGACTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCG
  3   1   2       bld Te4       out                        CAAN8527.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAACAGTACCGACTTACCAGATCCCTCTACTCATTTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGT
  3   1   2       bld Te5       in                         CAAO3467.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTACCAGATCCCTCTACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTTAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGT
  3   1   2       bld Spl1      in                         CABK3154.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTGTTGGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTGTTTTCTACAAAATAAACCCGTATTTGCCAGTAGCACTTTAGGGATGTAAAAAAAAAAAG
  3   1   2       bld Te1       in                         CBWN2121.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTCATTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg016d04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCCAGCCAATTAAATCAGATCTCTCAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTGTTTTCTACAAAATAAACCCGTATTGCCAGTAGCACTTTAGGGATGAAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Int1      in                         CAAP8609.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGATGTACTGGAATTACCCAAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACAT
  3   1   2       bld Ovi1 5g3  in                         CABI6655.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTGTTTTCTACAAAATAAACCCGTATTTGCCAGT
  3   1   2       bld Gas       in                    TGas138g04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTTGTTTTCTACAAAAATAAACCCCGTATTTGCCAGTAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA022g10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATGTACTGGAATTACCCAAAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTGTTTTCTACAAAATAAACCCGTATTGCCAGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe FL   in                     EC2CAA21BF10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGATATATCTGATTTATTTGATCAAACAAAAGAATGCATCACTTCAGACTTGTTGGAAGAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTCTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACCATGAACTATTTG
  3   1   2       bld Ovi1      in                          CABI744.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAATGCATCACTTCAGACTTGTNGGAAGAATTAATGTCCTCGGAAGTTTNTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTCCTTTGTAATTTTTGTTTTCTACAAAATAAACCCGTATTTGCCAGTAGCACTTTAGGGAAGTAAAAACAAAGCCTCTCCCC
  3   1   2       bld Te1       in                         CBWN1709.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAATTAATGTCCTCGGAAGTTTTTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE8568.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTCCTCGGAAGTTTNTGCTCCTCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTGTTTTCTACAAAATAAACCCGTATTTGCCAGTAGCACTTTAGGGATGT
  3   1   2       bld Gas7      in                         XZG57726.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGCTCAGACTTTCTCCTCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTTGTTTTCTACAAAATAAACCCGTATTTGCCAGTAAAAAAAAAAAGAAAG
  3   1   2       bld Te5       in                        CAAO10426.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTCAGACTTTCTCCTCCTCCTGGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTGTTTTCTACAAAATAAACCCGTATTTGCCAGT
  3   1   2       bld Gas7 PIPE in                         XZG65497.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTTGTTTTCTACAAAATAAACCCGTATTTGCCAGTAGCACTTTAGGGAGGTAAAACC
  3   1   2       bld Ova1      in                        CABE12607.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCCTGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTGTTTTCTACAAAATAAACCCGTATTTGCCAGTAGCACTTTAGGGATGTAAAAAC
  3   1   2       bld Gas  FL   in                    TGas106m05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTTGTTTTCTACAAAATAAACCCGTATTGCCAGAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                          XZT6563.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTTGTTTTCTACAAAATAAACCCGTATTGCCAG
  3   1   2       bld Gas7      in                         XZG65861.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGAAAAGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTTTGATTTTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTGTTTTCTACAAAATAAACCCGTATTTGCCAGTAGCACTTTAGGGATGTAAAACC
  3   1   2       bld HeRe                             EC2CAA25DF10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTGAAGGAGTTTGTGACCTCTTTGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTCTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGC
  3   1   2       bld Egg       in                    TEgg018m17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TACCCATCAACCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAGGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCATAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGAAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTGTTTTCTACAAAATAAACCCGTATTTGCCAGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te1       in                         CBWN4568.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTCTGATATTTTGAACTCGGCTTTGGGCCTTATTTGTGAATAAGAACTTTTTTGTTGTCTTTTATGAAGAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACGGAAACCATACCAGAGACATTGCAGTGCAAAAAGACACTTAACTCCTCTCACTGTGAGAATCCGCTCATAACTTTTCCATCCCTGTGATGAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCTGTATTGATCCAGCTTTATTAAGTCCATTACTACATCTGACAGAAGCTTTTCACAAATTTCAAGCACTTAACATTTTTGCTGCAGTACATAATATTTGGATTTTTGGCTGAGTGTGCCTCAGTATTTGGGCTTAGAAGTTCTTAAGTCTGTCCAATAATATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTTGTTTTCTACAAAATAAACCCGTATTTGCCAGTAGCACTTTAGGGATGTAAAAACAAAAAAAAAAAAAAA
  3   1   2       bld Thy1                                CBST6240.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATAGTAGGTGTGCAGTACCATCCTCCATAAACAAATGGTTTTCCATGCAGTAACCGTAAAAAATAAGCTTGGTTGTCTTTTATTATGCTCTGACCTCACTCACTGCCAAATCGCTGCCAGTCACTGTCTAGCTAATTTACCTAAATGAAAGAAGATGTTGATATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTTGTTTTCTACAAAATAAACCCGTATTTGCCAGTAGCACTTTAGGGATGTAAAAACAAACACCCAGAGCAGCTGTGTGACTTTGTTGGGGTGAAAGTGGTGAGATTCAATACAAAAGCTGTGCAGTCCATTTTAGTCCAAATGATACACAATGATTGCTGGCACTGGAGTTGTATGGAATTGAATTATATTATAAACTTGTGCTTTAGAAAGAATATTATAGTGTAAAGAGTTACCTATTTATAGTCACTTCTATGACCGAATATACGTTAAGATTGGCATTTTCCTTTGCACATAGCTTTCATATATTTGTCATATGTTAGGTGACATGGTACCATGGAGATATGTTGTTTCTCCCAGACAGAGATCTCCTTGTTTTTAATACCAGTGCTGCTCCACCTGGATCTCGGTCCAACTTTAAGTAGAATATTAGGACTTAGTCTATGTTGATTTAAATTGATTTTATTTAATATACTGCAAATATATAATATATATAATGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)