Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012073631 Xt7.1-CAAQ1790.3.5 - 117 ESTs
                                                                       ...-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAQ1790.3.5              TGTTGTGAGGGGGACGGAGGTCGCCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTCTGACAACGAGAATATCTTGTGTGCCCAATTGCAGTGCTTTCACCTACCATCATTAAGACATCTTGGTCTGCACAGCTGGTATGCAGAAAACTGCTATGAAAAATCATCTTTTCTCTGCAAGAGAAGCCAGACGTGTGTTGATATCAAGGACAACATTGTTGATGAAGGCTACTACTTTACACCTAAGGGAGATGATCCGTGCTTGAGCTGCACATGCCACAATGGTGAGCCAGAAATGTGTGTGGCTGCTCTTTGTGAAAGACCACAAGGCTGTCAGCAGTATCGCAAGGACCCCAAGGAGTGCTGCAAATTTACTTGCCTTGATCCCGATGGAAGCAGCCTATTTGACTCTATGGCCAGTGGTATGCGTTTGATTGTAAGCTGCATCTCCTCTTTCCTTATTCTGTCTCTTCTGCTATTCATGGTTCATCGTCTAAGACAGAGACGCAGGGAACGCATTGAGTCATTAATTGGAGCCAACTTACACCACTTCAATCTTGGCCGCAGAATGCCAGGGTTTGACTATGGACCTGATGGTTTTGGCACAGGTCTGACACCACTTCATCTGTCAGATGATGGAGAGGGTGGGGCATTTCACTTCCATGAGCCACCCCCACCTTATACAGCTTACAAATACTCTGATATCCAACACCCAGATGATCCACCCCCTCCCTATGAAGCATCCATTAGTCCTGATATCATACTGTGCTCAAGTCCAGATCAAGTGAGTCACCAAGCTGCTGTCCTGGGCCAGTTATCAACTGCAAGCAGTAGCAATGCATCAACCCCTCAAACAACAGAAGAGCCCTTGCCCCCAGCAGTGCTATGTCTTGCCCAATCTCAAAGTGACACCACATGCTCTGGGGATGTCAGTAGTTCTTTGCTGGTGGGTGCCCCCCAAATCCCTTCAAAACGAAGCCTTCACTAGTGATACTCAATCTGGACCTTCGCCAAGCAATTGTTCTCTCAACACAGTTGTTTAAAAGAGCTTAAAAATGGCTGCCAGCCATGCTGGATTTTGAGAGCAAAGCAAATCGGCGCACTCTTTGGATGTAGATATGTCCAAGTGAAGGGCAGGAAAATGCTCCTAGAACTCACATTCTTAGTTTAGGGGGATTTGGGGTATTTTTTTTTTCTTGTTAACCCCTTTGCTACCTAAGGTCTCAGCATCATGTTGCAAAGTTCCACCGGCAGCTCAGGTGTTAAGCAGGCTATTAGGCCTTGTCTTGAAATCAGAGCAATCTATCATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCATTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACAGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAAATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGTTGTTTCTGTTTATGGCTGAACTGTGTAAAAAAAATAGATAATTTAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGTAAACAAGGGAGTGACCTTGTTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCGGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGTGGATATTTTTGAACAGAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTAGCTCCAGTGTAATTACTACAAAGCCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTCACCTAAAACCCAAGGGGGCAAGCTCATCTATGGGGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTCTTCTTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222824                    GAGGGGGACGGAGGTCGCCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTCTGACAACGAGAATATCTTGTGTGCCCAATTGCAGTGCTTTCACCTACCATCATTAAGACATCTTGGTCTGCACAGCTGGTATGCAGAAAACTGCTATGAAAAATCATCTTTTCTCTGCAAGAGAAGCCAGACGTGTGTTGATATCAAGGACAACATTGTTGATGAAGGCTACTACTTTACACCTAAGGGAGATGATCCGTGCTTGAGCTGCACATGCCACAATGGTGAGCCAGAAATGTGTGTGGCTGCTCTTTGTGAAAGACCACAAGGCTGTCAGCAGTATCGCAAGGACCCCAAGGAGTGCTGCAAATTTACTTGCCTTGATCCCGATGGAAGCAGCCTATTTGACTCTATGGCCAGTGGTATGCGTTTGATTGTAAGCTGCATCTCCTCTTTCCTTATTCTGTCTCTTCTGCTATTCATGGTTCATCGTCTAAGACAGAGACGCAGGGAACGCATTGAGTCATTAATTGGAGCCAACTTACACCACTTCAATCTTGGCCGCAGAATGCCAGGGTTTGACTATGGACCTGATGGTTTTGGCACAGGTCTGACACCACTTCATCTGTCAGATGATGGAGAGGGTGGGGCATTTCACTTCCATGAGCCACCCCCACCTTATACAGCTTACAAATACTCTGATATCCAACACCCAGATGATCCACCCCCTCCCTATGAAGCATCCATTAGTCCTGATATCATACTGTGCTCAAGTCCAGATCAAGTGAGTCACCAAGCTGCTGTCCTGGGCCAGTTATCAACTGCAAGCAGTAGCAATGCATCAACCCCTCAAACAACAGAAGAGCCCTTGCCCCCAGCAGTGCTATGTCTTGCCCAATCTCAAAGTGACACCACATGCTCTGGGGATGTCAGTAGTTCTTTGCTGGTGxxxxCCCCCCAAATCCCTTCAAAACGAAGCCTTCACTAGTGATACTCAATCTGGACCTTCGCCAAGCAATTGTTCTCTCAACACAGTTGTTTAAAAGAGCTTAAAAATGGCTGCCAGCCATGCTGGATTTTGAGAGCAAAGCAAATCGGCGCACTCTTTGGATGTAGATATGTCCAAGTGAAGGGCAGGAAAATGCTCCTAGAACTCACATTCTTAGTTTAGGGGGATTTGGGGTATTTTTTTTTTCTTGTTAACCCCTTTGCTACCTAAGGTCTCAGCATCATGTTGCAAAGTTCCACCGGCAGCTCAGGTGTTAAGCAGGCTATTAGGCCTTGTCTTGAAATCAGAGCAATCTATCATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCATTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACAGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAAATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGTTGTTTCTGTTTATGGCTGAACTGTGTAAAAAAAATAGATAATTTAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGTAAACAAGGGAGTGACCTTGTTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCGGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGTGGATATTTTTGAACAGAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTAGCTCCAGTGTAATTACTACAAAGCCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTTACCTAAAACCCAAGGGGGCAAGCCCATCTATGGGGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTxxTxxTGTTACTGTGAGAAACATxxxTxxAAxxxCCAAAATTAAACTxxxTxxGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                   3     3     5     5     7     7     8     9    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13     6    11     6    11     6    11     6    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     8    11     8    11     8    11     8    11     8    11     8    11     7    11     7    11     8    12     8    12     8    12     8    12     7    10     7    10     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     8    11     8    12     8    12     9    12     8    11     7    11     6    10     6    11     7    11     9    12     8    11     8    11     7    10     7     9     6     8     7     9     7     9     7     9     7     8     7     8     7     8     7     7     7     7     9     9     8     9     8     9     8     9     7     8     8     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     9     6     8     6     8     5     8     4     7     4     7     4     7     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     7     4     8     4     7     4     7     4     7     4     7     4     8     4     8     4     9     3     8     3     8     3     8     3     8     3     8     3     8     4     8     3     8     3     8     3     8     3     8     3     8     3     7     3     7     3     7     3     6     3     6     3     6     3     6     3     6     3     6     5     7     5     7     5     7     6     7     6     7     6     7     6     7     5     7     6     7     6     8     8    10     8    10     8    10     9    11    10    13    10    12    10    11    11    12    11    12    11    13    12    14    13    16    13    16    12    16    11    15    12    15    13    15    13    16    13    16    12    16    12    16    13    17    14    18    14    18    14    18    13    18    12    17    12    17    11    16    11    16    10    15     9    15     8    14     8    14     8    14     8    14    10    14     9    14     9    14    10    14    10    14    10    14    11    15    12    17    12    17    13    17    14    17    14    17    14    17    12    18    14    18    15    19    15    20    16    20    16    20    16    20    16    19    16    20    15    20    16    20    15    19    15    19    15    19    14    19    14    19    14    19    14    19    14    20    15    22    15    22    14    22     4     8     6     8     5     8     6     9     6     9     7    10     7    10     6    10     6    10     7    11     7    11     7    11     8    12     8    12     8    12     8    12     8    12     8    12     8    11     9    11    10    12     9    12    10    12    10    12    10    12    10    12     9    11     9    11     8    12     8    12     7    12     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     4     8     5     9     6     9     6     9     6     9     6     9     6     9     5     8     6     9     6     9     7    10     7    10     7    10     7    10     7    10     6    10     7    10     6    10     6    10     7    11     9    13    13    17    14    20    12    20    14    23    15    26    15    26    16    30    18    33    20    38    21    38    23    40    23    39    23    39    24    43    25    44    25    44    24    42    25    46    26    47    25    47    26    46    26    45    26    47    25    46    26    47    40    47    37    45    39    45    41    47    40    45    40    46    42    47    38    45    41    46    40    45    42    46    42    47    42    47    42    47    38    46    42    45    43    45    42    45    42    45    43    45    43    45    42    45    43    45    42    45    42    45    43    45    43    45    41    45    42    45    43    45    40    44    40    42    41    42    39    40    38    40    38    39    38    39    38    39    36    38    32    38    18    36    14    35    13    32    13    31    13    30     8    15     3     5     3     3
  5   1   2  SIG                                      Xt7.1-XZG30766.3 CCCGGGGCCTGTTTGTTGTGAGGGGGACGGAGGTCGCCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGGTCCAGGAATAGTTCTGGCAAGACTTCAATCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGANGTTTTCCTGCCTCCCGTGCCTATCTTTGGANACAGCATGTCTGANCACGAGAATAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTC
  5   1   2  SIG                                      Xt7.1-CAAQ1790.3                   TGAGGGGGACGGAGGTCGCCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTCTGACAACGAGAATATCTTGTGTGCCCAATTGCAGTGCTTTCACCTACCATCATTAAGACATCTTGGTCTGCACAGCTGGTATGCAGAAAACTGCTATGAAAAATCATCTTTTCTCTGCAAGAGAAGCCAGACGTGTGTTGATATCAAGGACAACATTGTTGATGAAGGCTACTACTTTACACCTAAGGGAGATGATCCGTGCTTGAGCTGCACATGCCACAATGGTGAGCCAGAAATGTGTGTGGCTGCTCTTTGTGAAAGACCACAAGGCTGTCAGCAGTATCGCAAGGACCCCAAGGAGTGCTGCAAATTTACCTGCCTTGATCCAGATGGAAGCAGCCTATTTGACTCTATGGCCAGTGGTATGCGTTTGATTGTAAGCTGCATCTCCTCTTTCCTTATTCTGTCTCTTCTGCTATTCATGGTTCATCGTCTAAGACAGAGACGCAGGGAACGCATTGAGTCATTAATTGGAGCCAACTTACACCACTTCAATCTTGGCCGCAGAATGCCAGGGTTTGACTATGGACCTGATGGTTTTGGCACAGGTCTGACACCACTTCATCTGTCAGATGATGGAGAGGGTGGGGCATTTTTCACTTCCATGAGCCACCCCCACCTTATACAGCTTACAAATACTCTTATCCAACACCCAGATGATCCACCCCCTCCCTATGAAGCATCCATTAGTCCTGATATCATACTGTGCTCAAGTCCAGATCAAGTGAGTCACCAAGCTGCTGTCCTGGGCCAGTTATCAACTGCAAGCAGTAGCAATGCATCAACCAACCCCTCAAACAACAGAAGAGCCCTTGCCCCCGGCAGTGCTATGTCTTGCCCAATCTCAAAGTGACACCACATGCTCTGGGGATGTCAGTAGTTCTTTGCTGGTGCCCCCCAAATCCCTTCAAAACGAAGCCTTCACTAGTGATACTCAATCTGGACCTTCGCCAAGCAATTGTTCTCTCAACACAGTTGTTTAAAAGAGCTTAAAAATGGCTGCCAGCCATGCTGGATTTTGAGAGCAAAGCAAATCGGCGCACTCTTTGGATGTAGATATGTCCAAGTGAAGGGCAGGAAAATGCTCCTAGAACTCACATTCTTAGTTTAGGGGGATTTGGGGTATTTTTTTTTTCTTGTTAACCCCTTTGCTACCTAAGGTCTCAGCATCATGTTGCAAAGTTCCACCGGCAGCTCAGGTGTTAAGCAGGCTATTAGGCCTTGTCTTGAAATCAGAGCAATCTATCATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCATTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACAGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAAATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGTTGTTTCTGTTTATGGCTGAACTGTGTAAAAAAAATAGATAATTTAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGTAAACAAGGGAGTGACCTTGTTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCGGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGTGGATATTTTTGAACAGAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTAGCTCCAGTGTAATTACTACAAAGCCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTTACCTAAAACCCAAGGGGGCAAGCCCATCTATGGGGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTCTTCTGTTACCTGTGAGAAACATTCATTCAAATGCCAAAATTAAACGTATTCTGAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAR6245.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATGTATTTCGGGAGGCTGGGCTTTCTGTGGAATAGATTATAGGAAGATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATTTAAGTATGATAAAACAATGTAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACGGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAGATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGGTGTTTCTGTTTATGGCTGAACTGTGTAAAAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGAAAACAAGGGAGTGACCTTGTCTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCAGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGTGGATATTTTTGAGCAGAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTAGCTCCAGTGTAATTGTGTAATTACTACAAAGCCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTTACCTAAAACCCAAGGGGGCAAGCCCATCTATGGGGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                              GGTCCAGGAATAGTTCTGGCAAGACTTCAATCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGAATTTTGCCCAGCCTGTCCGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGGGATGTCAGTAGTTCTTTGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGACCTTGTCTTTGTCTCCCCCAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTGTACTGTGTTTTGCTGAAACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGAAGGTTGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTTAAAATACT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----A--G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------G---T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --G----A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --A---------
                                               BLH ATG     210    1950              
                                               BLH MIN     210     221              
                                               BLH MPR     210     221              
                                               BLH OVR     210      19              
                                               CDS MIN     210     221              
                                               EST CLI      33      11              
                                               ORF LNG     210       2              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 2e-009     NP_727642.1 CG32647-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 5e-022     XP_001199299.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === Dr ==== 0          NP_001002656.1 zgc:91974 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 0          NP_005128.1 integral membrane protein DGCR2 [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 0          NP_034178.2 DiGeorge syndrome protein C [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PREDICTED = Gg ==== 0          XP_415217.2 PREDICTED: similar to DiGeorge syndrome critical region gene 2 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 0          AAH74280.1 MGC84054 protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === ?? ==== 0          NP_001086166.1 MGC84054 protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 0          CAJ82632.1 DiGeorge syndrome critical region gene 2 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAQ1790.3.5                                                           TGA---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------TAAATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTGA------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------TAG---------------------------------------------TAA------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------ATG---------------------------------------------TAA---------------------------------------ATG------TGA------------------------TAA---------------------------------------------------------------TGAATG------------------TGA------------TGA---------------------------ATG------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------ATG------------------------------------TAG---------------------------------------------------------------ATG------------------TGA------------------------------------------------------TAA---TGATAA---------------ATG------------------ATG---------------------------ATG---------------------------------------------------TAG---------------------------------------TAA---------------------------------------------------------TAA---------------------------------------------------------------ATG------------------------TAA------------------TAG---------------TGA------------------ATG---------------------------------------------------------------------------TAG------------------------------------------------------------------------TAA---------------TGA---------------------------------------------------------------------ATG------------------------------------------TAA---------------TGA------TGA---------------------------TAG---------------------------------------TAA---------------------------------------------------------------------ATG------------TAG---------------TAG---TAG---------------------------------------TAG---------------------------------------------------------------------------TAA---------------TAG------------------TGA---------------------------------ATG---------------------------TAATAG---------------------TAATAA------------ATGATG---------------TAA------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------ATGTAG---------------------------------------------ATG---------------------------------TGA---TAA------------------TAG---TGA---------TAG------------------------------ATGTGA---------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2  SIG                                      Xt7.1-XZG30766.3 CCCGGGGCCTGTTTGTTGTGAGGGGGACGGAGGTCGCCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGGTCCAGGAATAGTTCTGGCAAGACTTCAATCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGANGTTTTCCTGCCTCCCGTGCCTATCTTTGGANACAGCATGTCTGANCACGAGAATAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTC
                                                  Xt7.1-CHK-1008277068       GCCTGTTTGTTGTGAGGGGGACGGAGGTCGCCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGGTCCAGGAATAGTTCTGGCAAGACTTCAATCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGANGTTTTCCTGCCTCCCGTGCCTATCTTTGGANACAGCATGTCTGANCACGAGAATATCTTGTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAG
  5   1   2       ext Egg0 5g                              dad72h07.y1 CCCGGGGCCTGTTTGTTGTGAGGGGGACGGAGGTCGCCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGGTGGGGGGGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGGTCCAGGAATAGTTCTGGCAAGACTTCAATCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTTGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTACCAGTTTTTTAGGAAAATGCCCATTAGGGTGG
  5   1   2   12  ext Gas7 5g3  in                         XZG30766.5p .GAGCGGCCTGTTTGTTGTGAGGGGGACGGAGGTCGCCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGGTCCAGGAATAGTTCTGGCAAGACTTCAATCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTG
  5   1   4   14 seed Brn3 5g3  in                         CAAK1530.5p ......................GGGGACGGAGGTCGCCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGGTCCAGGAATAGTTCTGGCAAGACTTCAATCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAG
  5   1   2       ext HdA  5g                        THdA042l03.p1kSP6                                                         ACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGGTCCAGGAATAGTTCTGGCAAGACTTCAATCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGANGTTTTCCTGCCTCCCGTGCCTATCTTTGGANACAGCATGTCTGANCACGAGAATATCTTGTGTGC
  3   1   4      seed Brn3 5g3  in                         CAAK1530.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATTTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGT
  3   1   2       ext Gas7 5g3  in                         XZG30766.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGGATTTTACTTNTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTTTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAAAAGG
  5   1   2  SIG                                      Xt7.1-CAAQ1790.3                   TGAGGGGGACGGAGGTCGCCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTCTGACAACGAGAATATCTTGTGTGCCCAATTGCAGTGCTTTCACCTACCATCATTAAGACATCTTGGTCTGCACAGCTGGTATGCAGAAAACTGCTATGAAAAATCATCTTTTCTCTGCAAGAGAAGCCAGACGTGTGTTGATATCAAGGACAACATTGTTGATGAAGGCTACTACTTTACACCTAAGGGAGATGATCCGTGCTTGAGCTGCACATGCCACAATGGTGAGCCAGAAATGTGTGTGGCTGCTCTTTGTGAAAGACCACAAGGCTGTCAGCAGTATCGCAAGGACCCCAAGGAGTGCTGCAAATTTACCTGCCTTGATCCAGATGGAAGCAGCCTATTTGACTCTATGGCCAGTGGTATGCGTTTGATTGTAAGCTGCATCTCCTCTTTCCTTATTCTGTCTCTTCTGCTATTCATGGTTCATCGTCTAAGACAGAGACGCAGGGAACGCATTGAGTCATTAATTGGAGCCAACTTACACCACTTCAATCTTGGCCGCAGAATGCCAGGGTTTGACTATGGACCTGATGGTTTTGGCACAGGTCTGACACCACTTCATCTGTCAGATGATGGAGAGGGTGGGGCATTTTTCACTTCCATGAGCCACCCCCACCTTATACAGCTTACAAATACTCTTATCCAACACCCAGATGATCCACCCCCTCCCTATGAAGCATCCATTAGTCCTGATATCATACTGTGCTCAAGTCCAGATCAAGTGAGTCACCAAGCTGCTGTCCTGGGCCAGTTATCAACTGCAAGCAGTAGCAATGCATCAACCAACCCCTCAAACAACAGAAGAGCCCTTGCCCCCGGCAGTGCTATGTCTTGCCCAATCTCAAAGTGACACCACATGCTCTGGGGATGTCAGTAGTTCTTTGCTGGTGCCCCCCAAATCCCTTCAAAACGAAGCCTTCACTAGTGATACTCAATCTGGACCTTCGCCAAGCAATTGTTCTCTCAACACAGTTGTTTAAAAGAGCTTAAAAATGGCTGCCAGCCATGCTGGATTTTGAGAGCAAAGCAAATCGGCGCACTCTTTGGATGTAGATATGTCCAAGTGAAGGGCAGGAAAATGCTCCTAGAACTCACATTCTTAGTTTAGGGGGATTTGGGGTATTTTTTTTTTCTTGTTAACCCCTTTGCTACCTAAGGTCTCAGCATCATGTTGCAAAGTTCCACCGGCAGCTCAGGTGTTAAGCAGGCTATTAGGCCTTGTCTTGAAATCAGAGCAATCTATCATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCATTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACAGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAAATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGTTGTTTCTGTTTATGGCTGAACTGTGTAAAAAAAATAGATAATTTAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGTAAACAAGGGAGTGACCTTGTTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCGGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGTGGATATTTTTGAACAGAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTAGCTCCAGTGTAATTACTACAAAGCCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTTACCTAAAACCCAAGGGGGCAAGCCCATCTATGGGGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTCTTCTGTTACCTGTGAGAAACATTCATTCAAATGCCAAAATTAAACGTATTCTGAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008277070                         GGACGGAGGTCGCCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTCTGACAACGAGAATATCTTGTGTGCCCAATTGCAGTGCTTTCACCTACCATCATTAAGACATCTTGGTCTGCACAGCTGGTATGCAGAAAACTGCTATGAAAAATCATCTTTTCTCTGCAAGAGAAGCCAGACGTGTGTTGATATCAAGGACAACATTGTTGATGAAGGCTACTACTTTACACCTAAGGGAGATGATCCGTGCTTGAGCTGCACATGCCACAATGGTGAGCCAGAAATGTGTGTGGCTGCTCTTTGTGAAAGACCACAAGGCTGTCAGCAGTATCGCAAGGACCCCAAGGAGTGCTGCAAATTTACCTGCCTTGATCCAGATGGAAGCAGCCTATTTGACTCTATGGCCAGTGGTATGCGTTTGATTGTAAGCTGCATCTCCTCTTTCCTTATTCTGTCTCTTCTGCTATTCATGGTTCATCGTCTAAGACAGAGACGCAGGGAACGCATTGAGTCATTAATTGGAGCCAACTTACACCACTTCAATCTTGGCCGCAGAATGCCAGGGTTTGACTATGGACCTGATGGTTTTGGCACAGGTCTGACACCACTTCATCTGTCAGATGATGGAGAGGGTGGGGCATTTxxCxxTTCCATGAGCCACCCCCACCTTATACAGCTTACAAAxxCTxxTATCCAACACCCAGATGATCCACCCCCTCCCTATGAAGCATCCATTAGTCCTGATATCATACTGTGCTCAAGTCCAGATCAAGTGAGTCACCAAGCTGCTGTCCTGGGCCAGTTATCAACTGCAAGCAGTAGCAATGCATCAACCxxxCxCTCAAACAACAGAAGAGCCCTTGCCCCCGGCAGTGCTATGTCTTGCCCAATCTCAAAGTGACACCACATGCTCTGGGGATGTCAGTAGTTCTTTGCTGGTGCCCCCCAAATCCCTTCAAAACGAAGCCTTCACTAGTGATACTCAATCTGGACCTTCGCCAAGCAATTGTTCTCTCAACACAGTTGTTTAAAAGAGCTTAAAAATGGCTGCCAGCCATGCTGGATTTTGAGAGCAAAGCAAATCGGCGCACTCTTTGGATGTAGATATGTCCAAGTGAAGGGCAGGAAAATGCTCCTAGAACTCACATTCTTAGTTTAGGGGGATTTGGGGTATTTTTTTTTTCTTGTTAACCCCTTTGCTACCTAAGGTCTCAGCATCATGTTGCAAAGTTCCACCGGCAGCTCAGGTGTTAAGCAGGCTATTAGGCCTTGTCTTGAAATCAGAGCAATCTATCATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCATTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACAGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAAATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGTTGTTTCTGTTTATGGCTGAACTGTGTAAAAAAAATAGATAATTTAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGTAAACAAGGGAGTGACCTTGTTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCGGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGTGGATATTTTTGAACAGAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTAGCTCCAGTGTAATTACTACAAAGCCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTTACCTAAAACCCAAGGGGGCAAGCCCATCTATGGGGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTxxTxxxxTxxCTGTGAGAAACATTCATTCAAATGCCAAAATTAAACxxxxTxxxxAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Neu  FL                     TNeu062c19.FL-Sanger                                                    CGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTCTGACAACGAGAATATCTTGTGTGCCCAATTGCAGTGCTTTCACCTACCATCATTAAGACATCTTGGTCTGCACAGCTGGTATGCAGAAAACTGCTATGAAAAATCATCTTTTCTCTGCAAGAGAAGCCAGACGTGTGTTGATATCAAGGACAACATTGTTGATGAAGGCTACTACTTTACACCTAAGGGAGATGATCCGTGCTTGAGCTGCACATGCCACAATGGTGAGCCAGAAATGTGTGTGGCTGCTCTTTGTGAAAGACCACAAGGCTGTCAGCAGTATCGCAAGGACCCCAAGGAGTGCTGCAAATTTACTTGCCTTGATCCCGATGGAAGCAGCCTATTTGACTCTATGGCCAGTGGTATGCGTTTGATTGTAAGCTGCATCTCCTCTTTCCTTATTCTGTCTCTTCTGCTATTCATGGTTCATCGTCTAAGACAGAGACGCAGGGAACGCATTGAGTCATTAATTGGAGCCAACTTACACCACTTCAATCTTGGCCGCAGAATGCCAGGGTTTGACTATGGACCTGATGGTTTTGGCACAGGTCTGACACCACTTCATCTGTCAGATGATGGAGAGGGTGGGGCATTTCACTTCCATGAGCCACCCCCACCTTATACAGCTTACAAATACTCTGATATCCAACACCCAGATGATCCACCCCCTCCCTATGAAGCATCCATTAGTCCTGATATCATACTGTGCTCAAGTCCAGATCAAGTGAGTCACCAAGCTGCTGTCCTGGGCCAGTTATCAACTGCAAGCAGTAGCAATGCATCAACCCCTCAAACAACAGAAGAGCCCTTGCCCCCGGCAGTGCTATGTCTTGCCCAATCTCAAAGTGACACCACATGCTCTGGGGATGTCAGTAGTTCTTTGCTGGTGCCCCCCAAATCCCTTCAAAACGAAGCCTTCACTAGTGATACTCAATCTGGACCTTCGCCAAGCAATTGTTCTCTCAACACAGTTGTTTAAAAGAGCTTAAAAATGGCTGCCAGCCATGCTGGATTTTGAGAGCAAAGCAAATCGGCGCACTCTTTGGATGTAGATATGTCCAAGTGAAGGGCAGGAAAATGCTCCTAGAACTCACATTCTTAGTTTAGGGGGATTTGGGGTATTTTTTTTTTCTTGTTAACCCCTTTGCTACCTAAGGTCTCAGCATCATGTTGCAAAGTTCCACCGGCAGCTCAGGTGTTAAGCAGGCTATTAGGCCTTGTCTTGAAATCAGAGCAATCTATCATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCATTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAAAAAA
  5   1   2   14  ext Te4  5g3  in                         CAAN1194.5p .....GGCCTGTTTGTTGTGAGGGGGACGGAGGTCGCCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCACGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGG
  5   1   4   14 seed Te3  5g3  in                        CAAM10328.5p ..................TGAGGGGGACGGAGGTCGCCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGC
  5   1   3   14   nb Brn3 5g3  in                         CAAK5614.5p ...........................CGGAGGTCGCCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGANATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGG
  5   1   0       chi Gas8      in                          st78k10.5p                                     CCATCTTGTTCCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGGTGAGTTGAGAAATGCGTGGCCTCCTTAGTGCTGCTGGCGGGGGGCATTAGTGCCCAGAGGCAGAATTGTAGTGTCAAGCCCAGCCTGCGAGCTGCCTAGCTATTGTAGAACTACAGCATTCAGTAGGCACGACAGACTGACTGATAGCAATAAGAAATCATAATAAGCAGGTTGGGTTAGTTTAGGGGATCTCATAGGGTAGGCATGAAAGGGTGTGTCAGAGTGCCCCCAGCTCTCGCATAATGCTGCGGCTTGCTGACTGTGGCTGAAGCTTCTCCCCAGAGGCCCGACATTCAGTTCAATCTGTTAGAACTGTGCTTTTAATTGTGATTTGTGTTTGCACTTTGCTACAAGACCCTTTGGGAGGCGGGGACAGAAGCCAAATTCGTATTGGCTAGGTTCCAGTTGTCAAACTCTGTTTAATGTAACTTTGTTTCCACTTCACTATACATGTTTGTA
  5   1   2   14  ext Brn3 5g3  in                         CAAK9188.5p ..............................................CCCGGCGCTAACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTCTGACAACGA
  5   1   3        nb Neu  FL   in                   TNeu062c19.p1cSP6                                                 GCTAACTGAGTCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAAGGGCAGTTCGCTTGCCACAAGTGGTACCATACAAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATAATGGAAAAAAAAGTGTGGACACACGGTTTAACAAAAGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAAGAACAGCAAGCTGCTATAAGGTATATTCAT
  5   1   2   14  add Brn3 5g3  in                         CAAK1428.5p .......................................................AACTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGNGAAGTAGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTCTGACAA
  5   1   3   14   nb Te4  5g3  in                         CAAN2684.5p .........................................................CTGAGGCTGGGTGCCTACCGGTACCGAAAATCCAGTGTCGAAGCATGTCCCTGGAGACCTAATACTTGCATTATTTGTAAAGAGCGTTCCGTACCTCGCCCAGTTTTTCACCTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTCGCTTGCCACAGTGGTACCATACAGTGTATACCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGTCTGGAGACCAGCGAACGTATCATGGAAAAGAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCGGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGG
  3   1   0       chi Gas8      in                          st78k10.3p                                                                                                                                                    TACCTCGCCCAGTTTTTCACCTTCCCCGGCAAGTGCCCGGTTTTCGCGGCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTCTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGGTGAGTTGAGAAATGCGTGGCCTCCTTAGTGCTGCTGGCGGGGGGCATTAGTGCCCAGAGGCAGAATTGTAGTGTCAAGCCCAGCCTGCGAGCTGCCTAGCTATTGTAGAACTACAGCATTCAGTAGGCACGACAGACTGACTGATAGCAATAAGAAATCATAATAAGCAGGTTGGGTTAGTTTAGGGGATCTCATAGGGTAGGCATGAAAGGGTGTGTCAGAGTGCCCCCAGCTCTCGCATAATGCTGCGGCTTGCTGACTGTGGCTGAAGCTTCTCCCCAGAGGCCCGACATTCAGTTCAATCTGTTAGAACTGTGCTTTTAATTGTGATTTGTGTTTGCACTTTGCTACAAGACCCTTTGGGAGGCGGGGACAGAAGCCAAATTCGTATTGGCTAGGTTCCAGTTGTCAAACTCTGTTTAATGTAACTTTGTTTCCACTTCACTATACATGTTTGTATAACGCCAATTTATATCTCGCACCAATGGAACAATACATGCTTCAAAACACAAAAGCATT
  5   1   0       chi Gas                            TGas035l21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCCCGGGATACATGGGTACAATTCTGCATTACGCTACATGGTACGTTCTGCATTACGTTACTTGGTACGTTCTGCGCTACACGGTACGTTCTGCATTACGCTACATGGTACAATACTGCATTACGTAACTTGGTACTTTCTACGTAACGCTACATGGTACAATGTGTATTACTTAACATAAAACACTGTGGAGGTTATGGAAACATGTTACATAGCAAATGAGATGTCTGGCAACCTTTACTACTGACCATACAGCTGAAATCTATATTGGCCCATGAGTGGGACATGGCAGAGACGCCATATGGAACGAAGGATCATCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTCTGACAACGAGAATATCTTGTGTGCCCAATTGCAGTGCTTTCACCTACCATCATTAAGACATCTTGGTCTGCACAGCTGGTATGCAGAAAACTGCTATGAAAAATCATCTTTTCTCTGCAAGAGAAGCCAGACGTGTGTTGATATCAAGGACAACATTGTTGATGAAAGCTACTACTTTACACC
  5   1   3        nb Gas                            TGas035k22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAAAANAGAGTGTGGACACACGGTTTAACAGAGGCCGGAGTGGGGAAACCCCTCGATTCCATACAGTGAATTTTGCCCAGCCTGTCCGTTTTAGCAGTTTTCTAGGAAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTCTGACAACGAGAATATCTTGTGTGCCCAATTGCAGTGCTTTCACCTACCATCATTAAGACATCTTGGTCTGCACAGCTGGTATGCAGAAAACTGCTATGAAAAATCATCTTTTCTCTGCAAGAGAAGCCAGACGTGTGTTGATATCAAGGACAACATTGTTGATGAAGGCTACTACTTTACACCTAAGGGAGATGATCCGTGCTTGAGCTGCACATGCCACAATGGTGAGCCAGAAATGTGTGTGGCTGC
  5   1   2       ext Brn3      in                         CAAK4304.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAATGCCCATCAGGATGGCATCACTATGAAGGAACAGCAAGCTGCTATAAGGTATATTCATCAGGAGAAAATTACTGGGATGCTGTACAAACATGTCAGAAGGTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATTTATTTTGGCCCAGGAGTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTAGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTCTGACAACGAGAATATCTTGTGTGCCCAATTGCAGTGCTTTCACCTACCATCATTAAGACATCTTGGTCTGCACAGCTGGTATGCAGAAAACTGCTATGAAAAATCATCTTTTCTCTGCAAGAGAAGCCAGACGTGTGTTGATATCAAGGACAACATTGTTGATGAAGGCTACTACTTTACACCTAAGGGAGATGATCCGTGCTTGAGCTGCACATGCCACAATGGTGAGCCAGAAATGTGTGTGGCTGCTCTTTGTGAAAGACCACAAGGCTGTCAGCAGTATCGCAAGGACCCCAAGGAGTGCTGCAAATTTACTTGCCTTGATCCCGATGGAAGCAGCCTATTTGACTCTATGGCCAGTGGTATGCGTTTGATTGTAAGCTGCATCTCCCTCTTCCTTAT
  5   1   2       ext Spl1      in                         CABK9963.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTACTGGGATGCTGTACAAACATGCTCAGAAGGCTAAATGGATCTCTGGCAACCTTCACTACTGACCAGGAGCTGAAATATCTATTTTGGCCCTAGGAGCTGGGACATGGAGGAGAGGCCATATGGAAGGAAGGATCAGCGGAGATTGTGGGTTGGATACCACTGTTGCTTATTACCAGCCGGAACCATTCTATGGAGGGTCATTGAGAAGTAGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTCTGACAACGAGAATATCTAGTGTGCCCAATTGCAGTGCATTCACCTACCGTCACTCACACGTCTTGGACTGCACAGCTGGTTATGC
  3   1   2       add HdA       out                  THdA025l22.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGTTTGACATATATGGTCTAAAATTTCAAATGCTTAATTCGGTATTCTGTACATTTAGAAGAATAAGCAATATATTCAATAGTTGTGTTTACTGTTATTGTATAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTTTGACAACGAGAATATCTTGTGTGCCCAATTGCAGTGCTTTCACCTACCATCATTAAGACATCTTGGTCTGCACAGCTGGTATGCAGAAAACTGCTATGAAAAATCATCTTTTCTCTGCAAGAGAAGTAAGTTAGAAGTCTGGTACCAGCAATGTGTCATGAAGTAATAGCAACTTGTGCTATATTCTTTATCTTATAGGTCATCGGTTTTTTTTTCCTGACTACAATAAGGATTTTACACTGGTTTGCTGGAGCTCAATAATATATTTTTTTAGTATTCTGTAATGTAAGAAGTGTTTTAAGCATGTCAAGCCTGGTGCAGGAACCAGGATGCAGCCTAACTTAAATAAGGGTGTATTAAAAA
  5   1   2       add TpA       in                  TTpA018m17.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCGCTGGAGGTGGCAGGGGGAAGTAGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTCTGACAACGAGAATATCTTGTGTGCCCAATTGCAGTGCTTTCACCTACCATCATTAAGACATCTTGGTCTGCACAGCTGGTATGCAGAAAACTGCTATGAAAAATCATCTTTTCTCTGCAAGAGAAGCCAGACGTGTGTTGATATCAAGGACAACATTGTTGATGAAGGCTACTACTTTACACCTAAGGGAGATGATCCGTGCTTGAGCTGCACATGCCACAATGGTGAGCCAGAAATGTGTGTGGCTGCTCTTTGTGAAAGACCACAAGGCTGTCAGCAGTATCGCAAGGACCCCAAGGAGTGCTGCAAATTTACTTGCCTTGATCCCGATGGAAGCAGCCTATTTGACTCTATGGCCAGTGGTATGCGTTTGATTGTAAGCTGCATCTCCTCTTTCCTTATTCTGTCTCTTCTGCTATTCATGGTTCATCGTCTAAGACAGAGACGCAGGGAACGCATTGAGTCATTAATTGGAGCCAACTTACACCACTTCAATCTTGGCCGCAGAATGCCAGGGTTTGACTATGGACCTGATGGTTTTGGCACAGGTCTGACACCACTTCATCTGTCAATGATGAGAAAGGGGGGGGGGGCATTTCACTTTCCATGAAGCCACCCCCACCTTATACAGCTTACAAATACTCTGATATCCAACACCCAGATGATCCACCCCCTCCCTATGAAGCATCCATTAGTCCTGATATCATACTGTGCTCAAGTCCAGAATCAAGTGAGTCACCAAGCTGCTGTCCTGNGCCAGTTATCAACTGCAAGCAGTAGCAATGCATCAACCCCTCAAACAAC
  5   1   2       ext BrSp      in                     EC2BBA34CG02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCATACAAAGGATCTGCTGAGGTTTTCCTGCCTCCCGTGCCTATCTTTGGAACAGCAATGTCTGACAACGAGAATATCTTGTGTGCCCAATTGCAGTGCTTTCACCTACCATCATTAAGACATCTTGGTCTGCACAGCTGGTATGCAGAAAACTGCTATGAAAAATCATCTTTTCTCTGCAAGAGAAGCCAGACATGTGTTGATATCAAGGACAACATTGTTGATGAAGGCTACTACTTTACACCTAAGGGAGATGATCCGTGCTTGAGCTGCACATGCCACAATGGTGAGCCAGAAATGTGTGTGGCTGCTCTTTGTGAAAGACCACAAGGCTGTCAGCAGTATCGCAAGGACCCCAAGGAGTGCTGCAAATTTACCTGCCTTGATCCAGATGGAAGCAGCCTATTTGACTCTATGGCCAGTGGTATGCGTTTGATTGTAAGCTGCATCTCCTCTTTCCTTATTCTGTCTCTTCTGCTATTCATGGTTCATCGTCTAAGACAGAGACGCAGGGAACGCATTGAGTCATTAATTGGAGCCAACTTACACCACTTCAATCTTGGCCGCAGAATGCCAGGGTTTGACTATGGACCTGATGGTTTTGGCACAGGTCTGACACCACTTCATCTGTCAGATGATGGAGAGGGTGGGGCATTTCACTTC
  5   1   2       ext Gas                            TGas031i24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAACGAGNATATCTTGTGTGCCCAATTGCAGTGCTTTCACCTACCATCATTAAGACATCTTGGTCTGCACAGCTGGTATGCAGAAAACTGCTATGAAAAATCATCTTTTCTCTGCAAGAGAAGCCAGACGTGTGTTGATATCAAGGACAACATTGTTGATGAAGGCTACTACTTTACACCTAAGGGAGATGATCCGTGCTTGAGCTGCACATGCCACAATGGTGAGCCAGAAATGTGTGTGGCTGCTCTTTGTGAAAGACCACAAGGCTGTCAGCAGTATCGCAAGGACCCCAAGGAGTGCTGCAAATTTACCTGCCTTGATCCAGATGGAAGCAGCCTATTTGACTCTATGGCCAGTGGTATGCGTTTGATTGTAAGCTGCATCTCCTCTTTCCTTATTCTGTCTCTTCTGCTATTCATGGTTCATCGTCTAAGACAGAGACGCAGGGAACGCATTGAGTCATTAATTGGAGCCAACTTACACCACTTCAATCTTGGCCGCAGAATGCCAGGGTTTGACTATGGACCTGATGGTTTTGGCACAGGTCTGACACCACTTCATCTGTCAGATGATGGAGAGGGGTGGGGGCATTTCACTTCCATGAGCCACCCCCACCTTATACAGCTTACAAATACTCT
  5   1   2       add Gas                            TGas042g15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATCTTTTCTCTGCAGAAGAAGCCAGACGTGTGTTGATATCAAGGACAACATTGTTGATGAAGGCTACTACTTTACACCTAAGGGAGATGATCCGTGCTTGAGCTGCACATGCCACAATGGTGAGCCAGAAATGTGTGTGGCTGCTCTTTGTGAAAGACCACAAGGCTGTCAGCAGTATCGCAAGGACCCCAAGGAGTGCTGCAAATTTACTTGCCTTGATCCCGATGGAAGCAGCCTATTTGACTCTATGGCCAGTGGTATGCGTTTGATTGTAAGCTGCATCTCCTCTTTCCTCATTCTGTCTCTTCTGCTATTCATGGTTCATCGTCTAAGACAGAGACGCAGGGAACGCATTGAGTCATTAATTGGAGCCAACTTACACCACTTCAATCTTGGCCGCAGAATGCCAGGGTTTGACTATGGACCTGATGGTTTTGGCACAGGTCTGACACCACTTCATCTGTCAGATGATGGAGAGGGTGGGGCATTTCACTTCCATGAGCCACCCCCACCTTATACAGCTTACAAATACTCTGATATCCAACACCCAGATGATCCACCCCCTCCCTATGAAGCATCCATTAGTCCTGATATCATACTGTGCTCAAGTCCAGATCAAGTGAGTCACCAAGCTGCTGTCCTGGGCCAGTTATCAACTGCAAGCAGTAGCAATGCATCAACCCCTCAAACAACAGAAGAGCCCTTGCCCCCGGCAGTGCTATGTCTTGCCCAATCTCAAAGTGACACCACATGCTCTGGGGATGTCAGTAGTTCTTTGC
  5   1   2       ext Gas       in                   TGas130i04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCTTTTCTCTGCAAGAGAAGCCAGACGTGTGTTGATATCAAGGACAACATTGTTGATGAAGGCTACTACTTTACACCTAAGGGAGATGATCCGTGCTTGAGCTGCACATGCCACAATGGTGAGCCAGAAATGTGTGTGGCTGCTCTTTGTGAAAGACCACAAGGCTGTCAGCAGTATCGCAAGGACCCCAAGGAGTGCTGCAAATTTACTTGCCTTGATCCCGATGGAAGCAGCCTATTTGACTCTATGGCCAGTGGTATGCGTTTGATTGTAAGCTGCATCTCCTCTTTCCTCATTCTGTCTCTTCTGCTATTCATGGTTCATCGTCTAAGACAGAGACGCAGGGAACGCATTGAGTCATTAATTGGAGCCAACTTACACCACTTCAATCTTGGCCGCAGAATGCCAGGGTTTGACTATGGACCTGATGGTTTTGGCACAGGTCTGACACCACTTCATCTGTC
  5   1   2       add Tbd0      in                       IMAGE:6978072                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAATGTGTGTGGCTGCTCTTTGTGAAAGACCACAAGGCTGTCAGCAGTATCGCAAGGACCCCAAGGAGTGCTGCAAATTTACCTGCCTTGATCCAGATGGAAGCAGCCTATTTGACTCTATGGCCAGTGGTATGCGTTTGATTGTAAGCTGCATCTCCTCTTTCCTTATTCTGTCTCTTCTGCTATTCATGGTTCATCGTCTAAGACAGAGACGCAGGGAACGCATTGAGTCATTAATTGGAGCCAACTTACACCACTTCAATCTTGGCCGCAGAATGCCAGGGTTTGACTATGGACCTGATGGTTTTGGCACAGGTCTGACACCACTTCATCTGTCAGATGATGGAGAGGGTGGGGCATTTCACTTCCATGAGCCACCCCCACCTTATACAGCTTACAAATACTCTGATATCCAACACCCAGATGATCCACCCCCTCCCTATGAAGCATCCATTAGTCCTGATATCATACTGTGCTCAAGTCCAGATCAAGTGAGTCACCAAGCTGCTGTCCTGGGCCAGTTATCAACTGCAAGCAGTAGCAATGCATCAACCCCTCAAACAACAGAAGAGCCCTTGCCCCCAGCAGTGCTATGTCTTGCCCAATCTCAAAGTGACACCACATGCTCTGGGGATGTCAGTAGTTCTTTGCTGGTGCCCCCCCAAATCCCTTCAAAACGAAGCCCTTCACTAGTGAATACTCAATCTGGACCTTCGCCCAAACAATTGTTTCTCTTAACACAGTTGTTTTAAAAAGAGCTTAAAAAATGGCCTGCCAGCCCAATGGCTGGATTTTT
  5   1   2       add Egg                            TEgg134b24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATTGAGTCATTAATTGGAGCCAACTTACACCACTTCAATCTTGGCCGCAGAATGCCAGGGTTTGACTATGGACCTGATGGTTTTGGCACAGGTCTGACACCACTTCATCTGTCAGATGATGGAGAGGGTGGGGCATTTCACTTCCATGAGCCACCCCCACCTTATACAGCTTACAAATACTCTGATATCCAACACCCAGATGATCCACCCCCTCCCTATGAAGCATCCATTAGTCCTGATATCATACTGTGCTCAAGTCCAGATCAAGTGAGTCACCAAGCTGCTGTCCTGGGCCAGTTATCAACTGCAAGCAGTAGCAATGCATCAACCCCTCAAACAACAGAAGAGCCCTTGCCCCCGGCAGTGCTATGTCTTGCCCAATCTCAAAGTGACACCACATGCTCTGGGGATGTCAGTAGTTCTTTGCTGGTGCCCCCCAAATCCCTTCAAAACGAAGCCTTCACTAGTGATACTCAATCTGGACCTTCGCCAAGCAATTGTTCTCTCAACACAGTTGTTTAAAAGAGCTTAAAAATGGCTGCCAGCCATGCTGGATTTTGAGAGCAAAGCAAATCGGCGCACTCTTTGGATGTAGATATGT
  3  -1   2       ext Spl1                                 CABK1406.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACCACTTCAATCTTGGCCGCAGAATGCCAGGGTTTGACTATGGACCTGATGGTTTTGGCACAGGTCTGACACCACTTCATCTGTCAGATGATGGAGAGGGTGGGGCATTTCACTTCCATGAGCCACCCCCACCTTATACAGCTTACAAATACTCTGATATCCAACACCCAGATGATCCACCCCCTCCCTATGAAGCATCCATTAGTCCTGATATCATACTGTGCTCAAGTCCAGATCAAGTGAGTCACCAAGCTGCTGTCCTGGGCCAGTTATCAACTGCAAGCAGTAGCAATGCATCAACCCCTCAAACAACAGAAGAGCCCTTGCCCCCAGCAGTGCTATGTCTTGCCCAATCTCAAAGTGACACCACATGCTCTGGGGATGTCAGTAGTTCTTTGCTGGTGCCCCCCAAATCCCTTCAAAACGAAGCCTTCACTAGTGATACTCAATCTGGACCTTCGCCAAGCAATTGTTCTCTCAACACAGTTGTTTAAAAGAGCTTAAAAATGGCTGCCAGCCATGCTGGATTTTGAGAGCAAAGCAAATCGGCGCACTCTTTGGATGTAGATATGTCCAAGTGAAGGGCAGGAAAATGCTCCTAGAACTCACATTCTTAGTTTAGGGGGATTTGGGGTATTTTTTTTTTTTTTCTTGTTAACCCCTTTGCTACCTAAGGTCTCAGCATCATGTTGAAAAGTTCCACCGGCAGCTCAGGTGTTAAGCAGGCTATTAGGCCTTGTCTTGAAATCAGAGCAATCTATCATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCATTCCCCCATAAGAGTGTTATTTTGTGTC
  5   1   3        nb AbdN                               IMAGE:6998600                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTCTGACACCACTTCATCTGTCAGATGATGGAGAGGGTGGGGCATTTCACTTCCATGAGCCACCCCCACCTTATACAGCTTACAAATACTCTGATATCCAACACCCAGATGATCCACCCCCTCCCTATGAAGCATCCATTAGTCCTGATATCATACTGTGCTCAAGTCCAGATCAAGTGAGTCACCAAGCTGCTGTCCTGGGCCAGTTATCAACTGCAAGCAGTAGCAATGCATCAACCCCTCAAACAACAGAAGAGCCCTTGCCCCCGGCAGTGCTATGTCTTGCCCAATCTCAAAGTGACACCACATGCTCTGGGGATGTCAGTAGTTCTTTGCTGGTGCCCCCCAAATCCCTTCAAAACGAAGCCTTCACTAGTGATACTCAATCTGGACCTTCGCCAAGCAATTGTTCTCTCAACACAGTTGTTTAAAAGAGCTTAAAAATGGCTGCCAGCCATGCTGGATTTTGAGAGCAAAGCAAATCGGCGCACTCTTTGGATGTAGATATGTCCAAGTGAAGGGCAGGAAAATGCTCCTAGAACTCATATTCTTAGTTTAGGGGGATTTGGGGTATTTTTTTTTTCTTGTTAACCCCTTTGCTACCTAAGGTCTCAGCATCATGTTGCAAAGTTCCACCGGCAGCTCAGGTGTTAAGCAGGCTATTACGCCTTGTCTTGAATCAGAGCAATCTATCATGTAGATATTACATTATCAAAGCTGCACTTTCTTCATTCCCCATAAGAGTGTTATTTGTGTCAGGAGAGTGAGAGTACATCTGN
  5   1   3        nb Brn4      in                         CAAL5649.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAACTGCAAGCAGTAGCAATGCATCAACCCCTCAAACAACAGAAGAGCCCTTGCCCCCGGCAGTGCTATGTCTTGCCCAATCTCAAAGTGACACCACATGCTCTGGGGATGTCAGTAGTTCTTTGCTGGTGCCCCCCAAATCCCTTCAAAACGAAGCCTTCACTAGTGATACTCAATCTGGACCTTCGCCAAGCAATTGTTCTCTCAACACAGTTGTTTAAAAGAGCTTAAAAATGGCTGCCAGCCATGCTGGATTTTGAGAGCAAAGCAAATCGGCGCACTCTTTGGATGTAGATATGTCCAAGTGAAGGGCAGGAAAATGCTCCTAGAACTCACATTCTTAGTTTAGGGGGATTTGGGGTATTTTTTTTTTCTTGTTAACCCCTTTGCTACCTAAGGTCTCAGCATCATGTTGCAAAGTTCCACCGGCAGCTCAGGTGTTAAGCAGGCTATTAGGCCTTGTCTTGAAATCAGAGCAATCTATCATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCATTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGNGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAAACATG
  5   1   3        nb Neu       in                   TNeu123e21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATGCATCAATCCCCTCAAACAACAGAAGAGCCCTTGCCCCCGGCAGTGCTATGTCTTGCCCAATCTCAAAGTGACACCACATGCTCTGGGGATGTCAGTAGTTCTTTGCTGGTGCCCCCCAAATCCCTTCAAAACGAAGCCTTCACTAGTGATACTCAATCTGGACCTTCGCCAAGCAATTGTTCTCTCAACACAGGGGTGTAAAAGAGCTTAAAAATGGCTGCCAGCCATGCTGGATTTTGAGAGCAAAGCAAATCGGCGCACTCTTTGGATGTAGATATGTCCAAGTGAAGGGCAGGAAAATGCTCCTAGAACTCACATTCTTATTTTAAGGGGATTTGGGGTATTTTTTTTTTCTTGTTAACCCCTTTGCTACCTAAAGTCTCAGCATCATGTTGCAAAGTTCCACCGGCAGCTCATGTGTTAAGCAAGCTATTAAGCCTTGTCTTGAAATCAAGCAATCTATCATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCATTCCCCCA
  5   1   3        nb Tad5                                 XZT53515.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCCAATCTCAAAGTGACACCACATGCTCTGGGGATGTCAGTAGTTCTTTGCTGGTGCCCCCCAAATCCCTTCAAAACGAAGCCTTCACTAGTGATACTCAATCTGGACCTTCGCCAAGCAATTGTTCTCTCAACACAGTTGTTTAAAAGAGCTTAAAAATGGCTGCCAGCCATGCTGGATTTTGAGAGCAAAGCAAATCGGCGCACTCTTTGGATGTAGATATGTCCAAGTGAAGGGCAGGAAAATGCTCCTAGAACTCACATTCTTAGTTTAGGGGGATTTGGGGTATTTTTTTTTTCTTGTTAACCCCTTTGCTACCTAGAGGTCACAGCATCATGTTGCAAAGTTCCACCGGCAGCTCAGGTGTTAAGCAGGCTATTACGCCTTGCCTTGAAATCAGAGCAATCTATCATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCAATCCCCCATAAGAGTGTTATTTTGTGTCTCAGAGAGTGAGAAGAACACTCTGTAACTCACCTCTGCATTTTTATATACCATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCACTACTCATGCAGGATCCTTAAGCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTACGGACATACGGAATTATCTCATTCATTGGGGGAAATGGACAGATATGGCTGCTTTCTGACCTCTGGCAGACTCGAATGAAACTCTACA
  5   1   3        nb Gas                            TGas004j19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCTGGGGATGTCAGTAGTTCTTTGCTGGTGCCCCCCAAATCCCTTCAAAACGAAGCCTTCACTAGTGATACTCAATCTGGACCTTCGCCAAGCAATTGTTCTCTCAACACAGTTGTTTAAAAGAGCTTAAAAATGGCTGCCAGCCATGCTGGATTTTGAGAGCAAAGCAAATCGGCGCACTCTTTGGATGTAGATATGTCCAAGTGAAGGGCAGGAAAATGCTCCTAGAACTCACATTCTTAGTTTAGGGGGATTTGGGGTATTTTTTTTTTGTTGTTAACCCCTTTGCTACCTAAGGTCTCAGCATCATGTTGCAAAGTTCCACCGGCAGCTCAGGTGTTAAGCAGGCTATTAGGCCTTGTCTTGAAATCAGAGCAATCTATCATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCATTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCT
  5   1   2       ext Neu       in                   TNeu101a10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTTTTTTGTTGTTAACCCCTTTGCTACCTAAGGTCTCAGCATCATGTTGCAAAGTTCCACCGGCAGCTCAGGTGTTAAGCAGGCTATTAGGCCTTGTCTTGAAATCAGAGCAATCTATCATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCATTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGT
  3   1   3        nb Neu       in                    TNeu123e21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATCAGAGCAATCTATCATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCATTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Brn3 5g3  in                         CAAK9188.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCATTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGT
  3   1   2       ext Te4  5g3  in                         CAAN1194.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATGTAAATATTACATTTCAAAAGCTGCACTTTCTTCATTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGT
  5   1   3        nb Hrt1      in                         CAAQ1790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATTCCCCCATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCCACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGAATGTGAGTGCTGAGTGAATAGGTTTTGCCTTTCGCTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACATGGTGTTTCTTCACATTTAGGCCCTGCGTTTGTTCATGGGATCACCGCCTTCTCTATACATCACGTATTGTTCTTTTAATATAGCATGTATTTCGAGAGGCTGGGCTTTCTGCGGAATAGATTATATGAAGATGATTTTTGGAGATGCACTACAGTACATGCGTGTGAGAGGCTTTTA
  3   1   3        nb Te4  5g3  in                         CAAN2684.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCCATAAGAGTGTTATTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGT
  3   1   2       add Brn3 5g3  in                         CAAK1428.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATAAGAGTGTTATTTTGTGTCAGAGAGAGTGGGAAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGT
  3   1   3        nb Brn4      in                         CAAL5649.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGAACAATCTGTAACTCACCTCTGCATTTTTATATACAATGTGGGACTGGATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGT
  5   1   2       add Egg       in                   TEgg017e12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTCTATATACAATATAGGGACTGGATTTTGCTTTTTCTTTATGAATTACATAACTCGCAATAATATTGCGAGATCCTTAACCACGGAACTCCAACACAAAGTATGACCCAATGAAAATGCACTTCCAATTTAACGACATAAGGAATGATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGACAGGATTGAATGAAACTCCAC
  3   1   3        nb Neu  FL   in                    TNeu062c19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAAAAAA
  5   1   3        nb HdA       in                   THdA020d14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTTACTTTTTCTTTGTGAATTACATAACTTGCAATAATCATGCAAGATCCTTAACCACGGAACTCCAGCACAAAGTATGACGCAGTGAAAATGCACTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCC
  3   1   2       add Egg       in                    TEgg017e12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTATGACGCAGTGAAAATGCTCTTCAAATTTAAGGACATAAGGAATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTGTGGCAGTCTTGAATGAAACTCCACATTTTTTTTTGAACATGTTTATTGTGAGGTTGTTGGTAAGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTCTATGTAGTGTGTAGATAATGTTTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCTATCATTGTAAGGTGATGTCACTTGGCAAATAAACTTGGTGTTTATTCAAATTTAGGCCCTGCGTTTGTTCAGGGGAGTGCACCAGCTTCTCCTATACATCACGTATAGTTTTTTTAATATAGCATGTATTTCGGGAGGAGGGGCTTTCTGTGGAATAGATTATAGGAAGAGGATTTTTGGAGATGCAGTACAGTGCATGCATGTGAGAGGCTTTTAAAGATGTATGGTATGATAGTTACATGCTCAGTTTGAGCAGGTGGTGCTGTATCCTTTGGTAATGAATGCCATGCACCTCTTATAATTTAAGTAGGATAAAACAAGGTAACTGAAATGGTTCAAGGGCAGAATCTCATGAAAGGAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAAAAAAA
  5   1   3        nb Egg       in                   TEgg027c16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATTATTTTATTCATTGGGGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGT
  3   1   2       ext Neu       in                    TNeu101a10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGAAATGGACAGATTTGGCTGCTTTCTGACCTCTGGCAGTCTTGAATGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTNTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGCGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCGTGTATTTCGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAGATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATGTAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Brn3                                CAAK12472.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAAACTCTACATTTTTTTCTGAACATGTTTATTGTGAGGTTGTTGGTATGTGAGTGCTGAGTGGATGGTTTTGCCTTTCGTTCTGTAGTGTGTAGATAATCTCTACAGTCGGGACCACACTTTTTTTTTTTCCTGCCCAAAAGTTCCCAACCATCATTTTTAGGTGCTGTCACTTTGCAATTAAACTTGGTGTTTCTTCAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGT
  3   1   3        nb BrSp      out                   EC0CBA002AC12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTCTTCAAATTTAGGCCCTGCGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTAGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAGATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGCTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATGTAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACGGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAAATTAGAGCAACATTTGGGGCTCACCTTATTTGGCAATACTGCTTTGTTGTTGATTCTGT
  5   1   3        nb Neu       in                   TNeu104i14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATTTAGGCCCTGTGTTTGTTCATGGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGT
  3   1   3        nb Neu       in                    TNeu104i14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAATTTAGGCCCTGTGTTTGTTCATGGGATCACCAGCTTCTCTATACATCATGTATTGTTCTTTTAATATAGCATGTATTTTGGGACGCTGGGCTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCCATGGCTCAGGGTCTCAGA
  5   1   3        nb Brn3      ?                         CAAK11434.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTTCTGTGGAATAGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACAGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAAATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGTTGTTTCTGTTTATGGCTGAACTGTGTAAAAAAAATAGATAATTTAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGTAAACAAGGGAGTGACCTTGTTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCGGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGTGGATATTTTTGAACAGAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGT
  5   1   3        nb Tad5                                 XZT33234.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATTATAGGAAAATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATATAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACAGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAAATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGTTGTTTCTGTTTATGGCTGAACTGTGTAAAAAAAATAGATAATTTAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGTAAACAAGGGAGTGACCTTGTTTTGTCTCCC
  5   1   3        nb Gas7      in                         XZG48967.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATATTTTAAGTATGATAAAACAATGTAATTGAAATGGATCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACGGTATATTCCATATATCTAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAAATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGTTGTTTCAGTTTATGGCTGAACTGTGTAAAAAAAATACATAATTTAATCTTCATGATCTTTACGATTGGCTTACTCAAAGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACCAAAATATTGAAATCTATTGCAAACAAGGTGAGGACCTTGTCTTTGTCTCCCC
  5   1   3        nb Tad5      in                         XZT70961.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACAGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAAATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGTTGTTTCTGTTTATGGCAACTGTGTAAAAAAAATAGATAATTTAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGTAAACAAGGGAGTGACCTTGTTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCGGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGA
  5   1   3        nb Gas7      in                         XZG17864.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACCAGTCACGGTATATTCCATATATCGAGGTTTCTTTGCTTAATTGTCCCCAAGTTAAAGATTAGAGCAACATTTGGGGCTCACCTTAATTGGCATTACTGCCTTGTGGGTGATACTGATAATGGC
  5   1   2       add HdA       in                  THdA035o05.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCAGAGTAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACGGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAAATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGTTGTTTCTGTTTATGGCTGAACTGTGTAAAAAAAATAGATAATTTAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGAAAACAAGGGAGTGACCTTGTCTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCAGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGTGGATATTTTTGAGCAGAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTAGCTCCAGTGTAATTGTGTAATTACTACAAAGCCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTTACCTAAAACCCAAGGGGGCAAGCCCATCTATNGGGGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAAGTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTC
  5   1   3        nb Tad5                                 XZT28750.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACAGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAAATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGTTGTTTCTGTTTATGGCTGAACTGTGTAAAAAAAATAGATAATTTAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGTAAACAAGGGAGTGACCTTGTTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCGGTCTATATATTTGTTAAAATACTAATACTTGGAGATCAGGTGCCCTTTTTCTTATTGATCTGAGGATATTCTTGAACAGAGTCCGACCAGACAGCATAGATGTGATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTAGCTCCAGTGTAATTACTACAAAGCCTATGAGATGCATGACATAATCATGTAGCTGTCTCCCTGGTGTAGTGTCTCAAGACGATCCAGAACAGCATATTAGCATTTACCTAAAACCCAAGGCGGCAAGCCCATCTATGGAGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGCGTCACC
  5   1   2       add HdA       in                   THdA014k22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCAGGTACTAGAAAAATCCAAATAATTGCTATTGGAGAAATACAAATCACGGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAAATTAAAGAAACATTTAGGGCTCACCGTATTTGGCATTACTAGCTTTGTTGTTGTTTCTGTTTATGGCGGAACTGAGGAAAAAAATATATAATTTAATCTTCATGATCCTTAAGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTGAAAGCTGAAACACTC
  5   1   2       ext TpA       in                   TTpA044k02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGCATCCATTAGTCCTNGATATCATACTGTGCTCAAGTCCAGATCAAGTGAGTCACCAAGCTGCTGTCCTGGGCCAGTTATCAACTGCTTTGTTGTTGTTTCTGTTTATGGCTGAACTGTGTAAAAAAAATAGATAATTTAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGTAAACAAGGGAGTGACCTTGTTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCGGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGTGGATATTTTTGAACAGAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTAGCTCCAGTGTAATTACTACAAAGCCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTCACCTAAAACCCAAGGGGGCAAGCTCATCTATGGGGAAACTTATCGCCACCCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTC
  5   1   3        nb Tad5      in                         XZT31991.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTCCCAAAGTTAAAAATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGTTGTTTCTGTTTATGGCTGAACTGTGTAAAAAAAATAGATAATTTAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGTAAACAAGGGAGTGACCTTGTTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCGGCCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGCGGATATTTTTGAACACAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCCAAGGTGGAAGC
  5   1   3        nb Tad5                                 XZT26944.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTGTTTCTGTTTATGGCTGAACTGTGTAAAAAAAATAGATAATTTAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGTAAACAAGGGAGTGACCTTGTTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCGGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGTGGATATTTTTGAACAGAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTAGCTCCAGTGTAATTACTACAAAGCCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTCACCTAAAACCCAAGGGGGCAAGCTCATCTATGGCGAAACTTATCGCCACCCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTACCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTACTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCG
  3   1   3        nb HdA       in                    THdA020d14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGTGGATAGTTTTGAACAGAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTAGCTCCAGTGTAATTACTACAAAGCCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTCACCTAAAACCCAAGGGGGCAAGCTCATCTATGGGGAAACTTATCGCCACCCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATGTTGTTTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATTCTTAAAAAAAAAAAAAAAAAAAGCG
  3   1   0       chi Tbd0      in                       IMAGE:6978072                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTAGCCCTAATGGAAGTGCCACAAGAAAATTATTTCCCTGTGGCCCTGTTTTCCCCCCCGGGGTAGAGGGTTTTCAAAGGCCATATTCCCGGAGGCCCGGCCAAATTTGGGCCCTTTTCCCTAGAAAACCCAAGGGGGGGGCCAAGCCCCCATTCTTTGGGGGGAAAAACTTTGTCCCCCACTTCCTTCAGGGTCATTTTTTTATTAGGCAAGAAAATGGGTAAATTTTCCCCTTAGGGAAAAGGTTATGGGGGCCTTAGGCCGTTAAGTTCCCCCTTTGGGCAGATTTCAGGAAAAGTTTTGCCCCTTCAGTTTCTAAGCTTTTAATTTGGGGGCCAAGGGGCTCCAAGCTCCCGGAATATGGTTTTTTATACTAGGCTTTTCCGGGAAATGTGTAGGCGGCTAAGTGGGGTCCATCGTTTTGGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTTTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTTCACATTATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTTTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTGTTTTCTTCTGTTACTGTGAGAAACATT
  5   1   3        nb Gas8                                   st2e15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGGTGGAAGCGTAGTAGCTCCAGTGTAATTACTACAAAGCCTATGAGATGCATGACATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTTACCTAAAACCCAAGGGGGCAAGCCCATCTATGGGGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAANAAACAGTTCCNCATATGANGTCTTTACGNGGGAGTTAAGTTGACGNCTGTAACACAAGCNGGTTTAANATCAAATTAC
  5   1   3        nb Tad5      in                         XZT28343.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTGTAATTACTACAAAGCCTATGAGATGCATGACATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTTACCTAAAACCCAAGGGGGCAAGCCCATCTATGGGGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGGCACCTAAGAAAGTTATGGTGCTTACCGTTAGTACCACTTGGGCAGATTCAGAAATGATTGCCTTCAATTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGACCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTGAATAGAGAGATGGTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAACTTGACATCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCACAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTC
  5   1   2       ext Tad5      in                         XZT12148.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTTACCTAAAACCCAAGGGGGCAAGCCCATCTATGGGGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGNGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAAC
  3   1   3        nb Spl1                                 CABK9256.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATCCAGANCAGCAAATTAGCATTTACCTAAAACCCAAGGGGGCAAGCCCATCTATGGGGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAAATTGCTGTTTTTTTTTTCTTCTGTTACGTGAGAAAAAAAA
  3   1   3        nb Ski1                                 CABJ3314.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGAAACTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAATAAACCGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACTGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGACATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
  5   1   3        nb HeRe      in                     EC2CAA43AB05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAATAAACCGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACTGGGCTCTTGCACCGCAAAAATACCTGTCCCCAGTTTGTAATGCAATATATGACCACT
  3   1   3        nb Ova1                                 CABE5288.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACTAGGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
  3   1   3        nb Hrt1      in                         CAAQ1790.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTGAAAAAAAAAGCCTCTCGCCCTATAGGAG
  3   1   3        nb Ovi1                                CABI12348.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTCATATTTTATAGCAAGAATGGATAGTGTCACTAGGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
  3   1   2       ext Gas       in                    TGas130i04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATGTTGTTTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATATCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAAATTGCTGTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu                             TNeu116c07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATGTTGTTTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATATCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAAATTGCTGTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTAAAAAAAAAAAAAAAAAAA
  3   1   2       ext TpA       in                    TTpA044k02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATGTTGTTTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATATCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAAATTGCTGTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTTATTCGAAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas                            TGas005c05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATCAGAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATGTTGTTTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATATCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAA
  3   1   2       ext Spl1      in                         CABK9963.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
  5   1   0       chi TpA                            TTpA041p08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCGGGGGTTTCAGAATACAGTTTAATTTTGGCATTTGAATGAATGTTTCTCACAGTAACAGAAGAAAAAAAAAAAACCGCTCATTGTGTGAAATGGAAAAAATATGATATTTTCACATGGTCTGAAACATACACATCGAATGTGTAGGCTGCTAAGTTGGGTCCATCTCTTACTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCCTTAACAGAAAATTTCCAATTTTT
  3   1   3        nb Tad5      in                         XZT31991.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATGTTGTTTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATATCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTTCCATTTCACACAAAATTGCTGTTTTTTTTTTCTTCGT
  3   1   3        nb Brn3 5g3  in                         CAAK5614.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAATAAACCGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACTGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGACATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTTTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
  3   1   3        nb Brn3 5x3  out                        CAAK8943.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTATGTGCTTAGGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATGTTGTTTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTTAATAAACAGTTCCACATATGATATCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAAATTGCTGTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
  3   1   2       ext BrSp      in                     EC2BBA34CG02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAAGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCATTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTG
  3   1   3        nb Tad5                                 XZT39617.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTTTTTTG
  5   1   3        nb Ovi1      in                         CABI7984.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATCGATTCGGAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAATAAACCGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACTGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGACATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
  3   1   0       chi Egg                             TEgg021o17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGTAAACAAGGGAGTGACCTTGTTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCGTTTAGTGTTTCTTAGAGAGATGTTGTTTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATATCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAAATTGCTGTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCCAAAATTAAACTG
  3   1   4      seed Te3  5g3  in                        CAAM10328.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATGTTGTTTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATATCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAAATTGCTGTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
  3   1   3        nb Gas7      in                         XZG48967.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATNTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACCGTTCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACTGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGACATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTGAAAAAAAAAAAAAAAAGG
  3   1   3        nb Egg       in                    TEgg027c16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATGTTGTTTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACACTATGATATCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAAATTGCTGTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Ovi1      in                         CABI7984.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAATAAACCGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACTGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGACATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
  5   1   3        nb Tad5      in                         XZT31286.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCACATTACGGGGCTCTTGCACCGCAGAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCACGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGCGTCAGGAATGTGATGTAGTCCTTCTCATGGCATAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCGAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAAC
  3   1   2       add HdA       in                    THdA035o05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAATAAACCGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACTGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTTTGTGACATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTTTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATTTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Tad5                                 XZT49731.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTGAAAAAAAAAAAAAAAAGG
  3   1   2       ext Mus1      in                         CABH4374.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAATAAACCGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACTGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGACATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
  5   1   2       ext Mus1      in                         CABH4374.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAATAAACCGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACTGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGACATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Thy1                                CBST8427.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCTTCAGTTCTAGCTTTTATTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
  3   1   3        nb Tad5      in                         XZT70961.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATGTTGTTTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATATCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTTTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATTTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAAATTGCTGTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTTTG
  3   1   3        nb Tad5      in                         XZT31286.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
  3   1   2       ext Brn3      in                         CAAK4304.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATGTTGTTTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATATCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAAATTGCTGTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
  3   1   2       ext Tad5      in                         XZT12148.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCTTGTCCCGGGAATGTGTAGGCGGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTTTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTACCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAAAGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATTTTACAGGCCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCCGTTTTTTTTTTTCTT
  3   1   2       add TpA       in                    TTpA018m17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGTCCTGTGAAAGTGTAGGCTGCTAAATTGGGTCCATCGTTTAGTGTTTTTTAGAGAGATGTTGTTTATACATAATTCATGTGAGGGTTAATAGAGAGAAGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATATTTTTACGTGGGAGTTAAGTTGACGTTTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTTTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCCCTTTAATTTCAGGATTCAGGGTTTTTTTTTGTGAAATAATGCATTTTTTGTAGGCTGTATCACCACTGCTCAGCCTTGGGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTTTCATGGCAGAAGGGTTGTAGGAAAGTATATGTCCTTGACATGGGTGGTTTTGGTTTCATCCTCAAACTTTGTCACTGACTTTAACCTGGGGCTGGGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATTTTACAGACCATGTGAAAAAATCATATTTTTTCCATTTCACACACAAATGCTGTTTTTTTTTTTTTTCTGTTAACTGTGGGAAACACTTCATTCAAAATGCCACAAATTAAAACTGTATTTTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG17864.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCCCGGGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTTTAGAGGGATATGGTTTATACATAATGCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGGGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACCGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTGAAAAAAAAAAGAAAAG
  3   1   3        nb Te1                                  CBWN2108.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAATAAACCGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACTGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTGAAAAAAAAAAAAAAA
  3   1   0       chi HdA       in                   THdA014k22.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGTCCATCGTTTAGTGTTTTTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGAGGTGGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAATAAACCGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGAAGTTTGTAACACAAGCAGGTTTAAGATCAGATTATTGGGGTTTTGCACCGCAAAAATACCCGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGGTTTTTTTTTGTGACATAAGAGCATTTTTTGTAGGGTGTATCACCCCTGATTAGCCCTGGGTTCCCTACAGAAGAGTCCGTATCCCTTTAAAATGGGTCAGGAAAGTGAAGGAATCCTTTTCATGGCCAAAGGGTTGTAGGAAGGTAAAATTCCTTGACAAGGGGGCTTTTGGTTTCATCCTCAAAATTTGGAACTGAATATAACCGGGGGCTGGGGGTAAAAAGTTTTGAAACAACCTGTAGGAGGTGCCAATTAAATGGTTCTTGCGGGCCGTGTGAAAAAATAATGTTTTTTGGCATTTTAAAGAAAGTGATGTTTTTTTTTTTATTCATGGGCAAGTGCGAAACCTTTATTCTAAGAGCCAAAAATAAAGGGTATTTTGAAAATCAAAATAAAGGAAAAAAAAAAAAAAAAAAA
  3   1   3        nb HeRe      in                     EC2CAA43AB05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTTAATAAACCGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACTGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTCTGTTACTGTGAGAAACAATT
  3   1   3        nb Tad5      in                         XZT28343.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGATTATACATAATTCATGTGGGCGTTAATAGAGGGAGGTTGTTTTTACATAATTCATGGGGGCCTTAATAGAAAATTTCCAATTTTTTTTTTTTTAATAAACAGTTCCCCATATGATGTCTTTACGTGGGGGTTAAGTTGACGTTTGTAACCCAAGCAGGTTTAAGATCAGATTACAGGGCTTTTGCCCCGCAAAAATACCTGTCCCCGTTTGTAGTGCAATATATGACCCCTTTAATTTCAGGGTTCAGGGTTTTTTTTTGGGAAATAATGCATTTTTTGTGGGGGGTATCACCCCTGGTCAGCCTTGGGTTCCCTACAGAAGGGTCCGTATCCCTTTAAATTGGGTCAGGAATGGGATGTAGTCCTTCTCCTGGCCGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGGTGCTTTTGGTTTCATCCTCAAACTTTGTCACGGACTTTAACCTGGGGCGGGGGGTAAATAGTTTTGAAACAACTTGTGGGGTGGCCCCTTAAACTGTTTTTTC
  3  -1   2       ext Ovi1                                CABI10966.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTTTTTATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAAATTGCTGTTTTTTTTTTCTTCTGTTACTGTGAGAAAAATTCATTCAAATGCCAAAATTAAACTGTATTCTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaCCCCCGGCCCAAATTCAAATGGGGG
  3   1   2       ext Gas7                                 XZG15174.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATATGATATCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTTTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCCTGACATGGCGGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCCGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACACTTAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAAAAAGCGGTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTGAAAAAAAGATAAAAAAGTAATAGAAATT
  5   1   3        nb Gas                            TGas108m03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTT
  3   1   2       add Tad5      in                         XZT55704.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGCGGACGCGTGGGTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAAAATTGCTGTTTTTTTTTTCTTTC
  5   1   2       add Tad5      in                         XZT55704.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGACGCGTGGGTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAAATTGCTGTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTGAAAAAAAAAAAAAAAAAAAAAGG
  5   1   2  SIG                                      Xt7.1-CAAR6245.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATGTATTTCGGGAGGCTGGGCTTTCTGTGGAATAGATTATAGGAAGATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATTTAAGTATGATAAAACAATGTAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACGGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAGATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGGTGTTTCTGTTTATGGCTGAACTGTGTAAAAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGAAAACAAGGGAGTGACCTTGTCTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCAGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGTGGATATTTTTGAGCAGAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTAGCTCCAGTGTAATTGTGTAATTACTACAAAGCCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTTACCTAAAACCCAAGGGGGCAAGCCCATCTATGGGGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTG
                                                  Xt7.1-CHK-1008277072                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTCGGGAGGCTGGGCTTTCTGTGGAATAGATTATAGGAAGATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATTTAAGTATGATAAAACAATGTAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACGGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAGATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGGTGTTTCTGTTTATGGCTGAACTGTGTAAAAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGAAAACAAGGGAGTGACCTTGTCTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCAGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGTGGATATTTTTGAGCAGAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTAGCTCCAGTGTAATTGTGTAATTACTACAAAGCCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTTACCTAAAACCCAAGGGGGCAAGCCCATCTATGGGGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGT
  5   1   2       ext Gas8                                  st34p20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATGTATTTCGGGAGGCTGGGCTTTCTGTGGAATAGATTATAGGAAGATGATTTTTGGAGATGCACTACAGTACATGCATGTGAGAGGCTTTTAAAGATTTATGGTATGATAGTTAAATGCTCAGTTTGAGCTGTTGGTGCTGTCTCCTCTGTTAATGAATGCCATGCATCACCTATAATTTAAGTATGATAAAACAATGTAATTGAAATGGTTCAATGGCAGAATCAAATGAAATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAA
  5   1   4      seed Liv1      in                         CAAR6245.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGATTAAATGGAATAAGATTTGTTAGCATGGCTCAGGGTCTCAGAGTAAAAAAAAAAAAGTCTGGAGAATATTTTGTAATATAGAAATCAAGTACTATAAAAATCCAAATAGTTGCTATTGGATAAATACAAGTCACGGTATATTCCATATATCGAGGTTTCTTTGCTTATTTTTCCCAAAGTTAAAGATTAGAGCAACATTTGGGGCTCACCTTATTTGGCATTACTGCTTTGTTGGTGTTTCTGTTTATGGCTGAACTGTGTAAAAATCTTCATGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACGTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGAAAACAAGGGAGTGACCTTGTCTTTGTCTCCCCCAGTACAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCAGTCTATATATTTGTTAAAATACTAATACTTGCTGATCCGGTGCCCTTTTGCTTATTGATCTGAGCATATTTTTGAG
  5   1   2       ext BrSp      in                     EC2BBA31BC12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGATCTTTAGGATTGGCTTACTCAATGACTTCCTTGCTTACTTGTAATGCTTAAGGCTGAAGCACTCACAAAAATATTGAAATCTATTGAAAACAAGGGAGTGACCTTGTCTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATTACTACTGGAAGGTTGCGGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGTGGATATTTTTGAGCAGAGTCCAACCAGACAGCATATATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTATCTCCAGTGTAATTGTGTAATTACTACAAAGCCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAA
  5   1   2       ext TpA       out                  TTpA065f14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACAGGGAGTGACCTTGTCTTTGTCTCCCCCAGTAGAGTGCAGTCTTTGTACTGTGTTTTGCTGAAACATCTCCATCACTACTGGAAGGTTGCAGTCTATATATTTGTTAAAATACTAATACTTGGTGATCAGGTGCCCTTTTTCTTATTGATCTGTGGATATTTTTGAGCAGAGTCCGACCAGACAGCATAGATGTAATGGAAACTGGCTTAAGCAAAGGTGGAAGCGTAGTAGCTCCAGTGTAATTGTGTAATTACTACAAAGCCTATGAGTTGCATGAAATAATCATGTAGCTGTCTCCCTGGTGTAGTGTTTCAAGACAATCCAGAACAGCAAATTAGCATTTACCTAAAACCCAAGGGGGCAAGCCCATCTATGGGGAAACTTGTCACCACTCCTTCAGTCATATTTTATAGCAAGAATGGATAGTGTCACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATACGAAATTTTCAATTTTTTTTTTTAATAACCGTTCCACATATGATGTCTT
  3   1   2       ext BrSp      in                     EC2BBA31BC12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACCTAGGAAAGTTATGGTGCTTAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAAGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACCACTGCTCAGCCTTGCATTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTG
  3   1   4      seed Liv1      in                         CAAR6245.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGCGTTAGTACCACTTGTGCAGATTCAGAAATGTTTGCCTTCAGTTCTAGCTTTTATTTGGTGCAAGGGCTCAAGCTCCTGACTATGGTTTCTATACTAGCTTGTCCTGTGAATGTGTAGGCTGCTAAGTTGGGTCCATCGTTTAGTGTTTCTTAGAGAGATATTGATTATACATAATTCATGTGAGCGTTAATAGAGAGATGTTGTTTATACATAATTCATGTGAGCATTAATAGAAAATTTCCAATTTTTTTTTTTAATAAACAGTTCCACATATGATGTCTTTACGTGGGAGTTAAGTTGACGTCTGTAACACAAGCAGGTTTAAGATCAGATTACAGGGCTCTTGCACCGCAAAAATACCTGTCCCAGTTTGTAGTGCAATATATGACCACTTTAATTTCAGGATTCAGGCTTCTTTTCTGTGAAATAATGCATTTTCTGTAGGCTGTATCACGACTGATCAGCCTTGCGTTCCCTACAGAAGAGTCCGTATCCCTTTAAATTGGGTCAGGAATGTGATGTAGTCCTTCTCATGGCAGAAGGGTTGTAGGAATGTATATGTCCTTGACATGGCTGCTTTTGGTCTCATCCTCAAACTTTGTCACTGACTCTAACCTGTGGCTGTGTGTAAATAGTTTTGAAACAACTTGTAGGATGACACATTAAACTGTATCTTACAGACCATGTGAAAATATCATATTTTTTCCATTTCACACAATTTGCTGTTTTTTTTTTTCTTCTGTTACTGTGAGAAACATTCATTCAAATGCCAAAATTAAACTGTATTCTGAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)