Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-EC2BBA13BC10.5.5                    101 END     1           1        1                CD2-associated protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012073641 Xt7.1-XZT50087.3 - 56 ESTs
                                                                       .....-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT50087.3                                                                                                                                                                                                              AGGATTTGGAGTTGTCAGATGATGAAGATTATGTACCCTATGTGCCTCTTAAGCAAAGGAGGCAGGAGATGCTGCAGAAGCGAATGTTGATTCGCCGAAAGGGAGTCCTAGAGGAAGAACAAAAAGACAGTGGCAGTGACCACCGAGGGGATGAAGATGACATTCCCTTGGGACCCAGATCCAATGTCAGTCTTTTGGACCAACACCAGCACCTAAAAGAGAAGGCTGAAGCTAGAAAAGAATCTGCCAAGGAGAAGCAGCTAAAAGAAGAAGAAAAAATCTTGGAGAGTGTAACAGAGGGAAGAGCTCTGATGTCTGTAAAAGAAATGGCCAAAGGTATAACCTACGATGACCCCATTAAAACTAGCTGGAAACCACCACGTCACATTTTGGAGATGTCTGAAGCGCGTCATGATCGGGTCAGAAGTAAATACCATATCCTTGTGGAGGGTGAAAGGATTCCTCAGCCCATTAAGAGTTTTAAAGAAATGAAGTTTCCTGCAGCTATTTTACGAGGACTAAAGAAGAAAGGAATTCATCACCCTACTCCTATCCAGATCCAAGGGATCCCAACCATTCTTTCTGGACGGGATATGATTGGCATTGCCTTTACTGGCTCTGGAAAAACCCTGGTCTTCACTCTACCTGTTATCATGTTCTGCTTGGAGCAGGAGAAGAGACTGCCCTTTGCCAAGAGGGAGGGACCATATGGACTCATTATTTGTCCCTCTAGGGAGTTGGCTCGTCAAACTCACAGTATAATTGAGTATTACTGCCATTTACTGCAAGAAGATAACTTTCCACATTTACGTACAGCACTTTGCATTGGGGGGATGTCTGTCAAGGAACAGATGGAAACCATCAAACAGGGTGTGCATATGATGGTTGCCACACCCGGCCGGCTCATGGACCTCTTGCAGAAAAAGATGGTGAGTTTGGACATCTGCAGGTACCTGGCACTGGATGAGGCTGACCGCATGATTGATATGGGCTTTGAAGAAGATATCAGAACAATATTCTCCTACTTCAAGGGTCAGAGACAGACTTTGCTTTTTAGTGCCACTATGCCAAAGAAGATTCAGAATTTTGCCAAAAGTGCACTGGTAAAGCCAATAACTATTAATGTGGGGCGAGCAGGGGCTGCCAGTCTGGATGTGATTCAGGAAGTAGAGTATGTGAAGGAGGAGGCTAAAATGGTCTATCTCCTAGAATGTTTACAGAAGACTCCTCCGCCAGTACTGATATTTGCTGAAAAGAAGGCGGATGTTGATGCTATACACGAGTATTTACTACTTAAGGGTGTTGAGGCCGTAGCCATCCATGGAGGAAAGGACCAAGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTGAAAAAAAAAGTAAGATTTGCTCATGTGGTAAATTGTACTATTTATCACTTGTTATGTGTGGTCGCAAAGTGTAACATTGTAGCTAACAAAGCATCAGGTTTAAGCATAATAACCTTTGAATTAGGTGGCTGTATAGGTCTGAAGTTATTGGAGACAGGCTCCCATAGACCAGGCTGTTTATTTGTAGAAGTTACTTAACACTGGTGCCTTATTTATAAAAATTGGAATTCAACATTTTCATTTTCCCCACAAAGACCCTTCACTTGTGTAAATGTATTGAATGTTTTTTCACATTATTTTATTAAACTTCCAGTTATTGGG
                                                  Xt7.1-CHK-1008225238                                                                                                                                                                                                                    TGGAGTTGTCAGATGATGAAGATTATGTACCCTATGTGCCTCTTAAGCAAAGGAGGCAGGAGATGCTGCAGAAGCGAATGTTGATTCGCCGAAAGGGAGTCCTAGAGGAAGAACAAAAAGACAGTGGCAGTGACCACCGAGGGGATGAAGATGACATTCCCTTGGGACCCAGATCCAATGTCAGTCTTTTGGACCAACACCAGCACCTAAAAGAGAAGGCTGAAGCTAGAAAAGAATCTGCCAAGGAGAAGCAGCTAAAAGAAGAAGAAAAAATCTTGGAGAGTGTAACAGAGGGAAGAGCTCTGATGTCTGTAAAAGAAATGGCCAAAGGTATAACCTACGATGACCCCATTAAAACTAGCTGGAAACCACCACGTCACATTTTGGAGATGTCTGAAGCGCGTCATGATCGGGTCAGAAGTAAATACCATATCCTTGTGGAGGGTGAAAGGATTCCTCAGCCCATTAAGAGTTTTAAAGAAATGAAGTTTCCTGCAGCTATTTTACGAGGACTAAAGAAGAAAGGAATTCATCACCCTACTCCTATCCAGATCCAAGGGATCCCAACCATTCTTTCTGGACGGGATATGATTGGCATTGCCTTTACTGGCTCTGGAAAAACCCTGGTCTTCACTCTACCTGTTATCATGTTCTGCTTGGAGCAGGAGAAGAGACTGCCCTTTGCCAAGAGGGAGGGACCATATGGACTCATTATTTGTCCCTCTAGGGAGTTGGCTCGTCAAACTCACAGTATAATTGAGTATTACTGCCATTTACTGCAAGAAGATAACTTTCCACATTTACGTACAGCACTTTGCATTGGGGGGATGTCTGTCAAGGAACAGATGGAAACCATCAAACAGGGTGTGCATATGATGGTTGCCACACCCGGCCGGCTCATGGACCTCTTGCAGAAAAAGATGGTGAGTTTGGACATCTGCAGGTACCTGGCACTGGATGAGGCTGACCGCATGATTGATATGGGCTTTGAAGAAGATATCAGAACAATATTCTCCTACTTCAAGGGTCAGAGACAGACTTTGCTTTTTAGTGCCACTATGCCAAAGAAGATTCAGAATTTTGCCAAAAGTGCACTGGTAAAGCCAATAACTATTAATGTGGGGCGAGCAGGGGCTGCCAGTCTGGATGTGATTCAGGAAGTAGAGTATGTGAAGGAGGAGGCTAAAATGGTCTATCTCCTAGAATGTTTACAGAAGACTCCTCCGCCAGTACTGATATTTGCTGAAAAGAAGGCGGATGTTGATGCTATACACGAGTATTTACTACTTAAGGGTGTTGAGGCCGTAGCCATCCATGGAGGAAAGGACCAAGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTGAAAAAAAAAxxAAxATTTGCTCATGTGGTAAATTGTACTATTTATCACTTGTTATGTGTGGTCGCAAAGTGTAACATTGTAGCTAACAAAGCATCAGGTTTAAGCATAATAACCTTTGAATTAGGTGGCTGTATAGGTCTGAAGTTATTGGAGACAGGCTCCCATAGACCAGGCTGTTTATTTGTAGAAGTTACTTAACACTGGTGCCTTATTTATAAAAATTGGAATTCAACATTTTCATTTTCCCCACAAAGACCCTTCACTTGTGTAAATGTATTGAATGTTTTTTCACATTATTTTATTAAACTTCCAGTT
                                                      consensus depths                                                                                                                                                                                                                   2     2     2     2     2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     9     7     9     8    10     8    10     9    11     9    11     9    10     9    10     9    10     9    10     7     9     8     9     7     8     7     8     7     9     8    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     7    10     7    10     7    10     7    10     7    10     6     9     8    10     7     9     7     9     7     9     7     9     7     9     7     9     6     8     8     9     8     9    10    11    10    11    10    11    10    11    10    11    10    12    11    13    12    14    11    13    11    13    12    15    12    14    12    15    15    18    14    19    20    22    20    22    22    24    20    24    22    24    24    26    24    27    26    29    26    29    26    29    27    29    29    31    29    31    28    31    28    31    29    31    29    31    30    32    26    29    26    29    26    29    26    29    30    31    30    30    30    30    31    31    30    30    30    30    31    31    31    31    31    31    31    31    30    31    31    31    31    31    30    31    31    31    32    34    33    34    33    34    34    34    34    34    34    34    32    34    34    34    33    35    34    35    34    35    34    36    35    36    35    38    33    37    33    35    34    35    32    34    30    32    29    32    30    32    28    31    25    30    22    30    23    30    21    28    22    28    21    27    20    27    20    27     6    11     3     7     3     6     3     6     2     5     2     5     2     5     2     5     2     5     2     5     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------GC
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Bf ---- 6e-047     AAM18861.1 unknown [Branchiostoma floridae] ------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Cs ---- 3e-074     BAB12216.1 vasa homolog [Ciona savignyi] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Sc ---- 2e-077     NP_014287.1 ATP-dependent RNA helicase of DEAD box family; Dbp2p [Saccharomyces cerevisiae] ------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                   PREDICTED - ?? ---- 2e-077     XP_709304.1 PREDICTED: similar to Pl10 isoform 5 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                               PROTEIN --- Xl ---- 5e-078     AAH94097.1 Unknown (protein for MGC:115016) [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                      PREDICTED - Xt ---- 1e-078     AAH63374.1 Hypothetical protein MGC76021 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Ce ---- 0          NP_491962.1 DEAD-box protein abstrakt (70.4 kD) (1H429) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Dr ==== 0          XP_693992.1 PREDICTED: similar to DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 0          NP_524220.1 abstrakt CG14637-PA [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN --- Ci ---- 0          BAE93318.1 zinc finger protein [Ciona intestinalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 0          XP_796437.2 PREDICTED: similar to DEAD (Asp-Glu-Ala-Asp) box polypeptide 41, partial [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- Mm ---- 0          NP_598820.1 expressed sequence AI324246; DEAD-box protein abstrakt [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                PREDICTED - Gg ---- 0          XP_425202.2 PREDICTED: similar to DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PREDICTED - Hs ---- 0          NP_057306.2 DEAD-box protein abstrakt; putative RNA helicase [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT50087.3                                                                                                                                                                                                                                                                                  ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------ATGATG---------------------ATG------------------ATG------------------------------------------------ATG------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------ATG------------------------------ATG------TGA---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------TAA------------------------TGA---------------------------------------------------------------TGA------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------TAA---------TAA------------------------------TGA---------------------------------------------TAG------------------------------------------------TAA------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2       bld In63 PIPE                       IMAGE:8958731.5p                                                                                                    AATCCTCAGATATCTACGATAACACAAGAATTCAAATTCGTCCCGTAGCTTAGTGTTGTAGCCATGGAGAGTGGAGGCGAGAGAAAGAGAGTGCATGCAGAGGAGGAGGATTTGGAGTTGTCAGATGATGAAGATTATGTACCCTATGTGCCTCTTAAGCAAAGGAGGCAGGAGATGCTGCAGAAGCGAATGTTGATTCGCCGAAAGGGAGTCCTAGAGGAAGAACAAAAAGACAGTGGCAGTGACCACCGAGGGGATGAAGATGACATTCCCTTGGGACCCAGATCCAATGTCAGTCTTTTGGACCAACACCAGCACCTAAAAGAGAAGGCTGAAGCTAGAAAAGAATCTGCCAAGGAGAAGCAGCTAAAAGAAGAAGAAAAAATCTTGGAGAGTGTAACAGAGGGAAGAGCTCTGATGTCTGTAAAAGAAATGGCCAAAGGTATAACCTACGATGACCCCATTAAAACTAGCTGGAAACCACCACGTCACATTTTGGAGATGTCTGAAGCGCGTCATGATCGGGTCAGAAGTAAATACCATATCCTTGTGGAGGGTGAAAGGATTCCTCAGCCCATTAAGAGTTTTAAAGAAATGAAGTTTCCTGCAGCTATTTTACGAGGACTAAAGAAGAAAGGAATTCATCACCCTACTCCTATCCAGATCCAAGGGATCCCAACCATTCTTTCTGGACGGATATGATTGGCATTGCCTTTACTGGCTCTGGAAAACCCTGGTCTTCACTCTACCTGTTATCATGTTCTGCTTGAGCAGAGAAGAGACTGCCCTTTGCCAGAGGAGACATATGACTCATTATTTGTCCCTCTAGGAGTGCTCGTCAACTCCCAAGTATATGAGTATTTACTGCCATTTACTGCAAGAAAGTAACTTTTCCAACATTTACG
  5   1   2       bld Lun1                                 CABD1300.5p                                                                                                                                                                                                              AGGATTTGGAGTTGTCAGATGATGAAGATTATGTACCCTATGTGCCTCTTAAGCAAAGGAGGCAGGAGATGCTGCAGAAGCGAATGTTGATTCGCCGAAAGGGAGTCCTAGAGGAAGAACAAAAAGACAGTGGCAGTGACCACCGAGGGGATGAAGATGACATTCCCTTGGGACCCAGATCCAATGTCAGTCTTTTGGACCAACACCAGCACCTAAAAGAGAAGGCTGAAGCTAGAAAAGAATCTGCCAAGGAGAAGCAGCTAAAAGAAGAAGAAAAAATCTTGGAGAGTGTAACAGAGGGAAGAGCTCTGATGTCTGTAAAAGAAATGGCCAAAGGTATAACCTACGATGACCCCATTAAAACTAGCTGGAAACCACCACGTCACATTTTGGAGATGTCTGAAGCGCGTCATGATCGGGTCAGAAGTAAATACCATATCCTTGTGGAGGGTGAAAGGATTCCTCAGCCCATTAAGAGTTTTAAAGAAATGAAGTTTCCTGCAGCTATTTTACGAGGACTAAAGAAGAAAGGAATTCATCACCCTACTCCTATCCAGATCCAAGGGATCCCAACCATTCTTTCTGGACGGGATATGATTGGCATTGCCTTTACTGGCTCTGGAAAAACCCTGGTCTTCACTCTACCTGTTATCATGTTCTGCTTGGAGCAGGAGAAGAGACTGCCCTTTGCCAAGAGGGAGGGACCATATGGACTCATTATTTGTCCCTCTAGGGAGTTGGCTCGTCAAACTCACAGTATAATTGAGTATTACTGCCATTTACTGCAAGAAGATAACTTTCCACATTTACGTACAGCACTTTGCATTGNGGGGATGTCTGTCAAGGGACAGATGGAAACCATCAAACAAGGTGTGCATATG
  5   1   2       bld Hrt1      in                         CAAQ2918.5p                                                                                                                                                                                                                                       AGATTATGTACCCTATGTGCCTCTTAAGCAAAGGAGGCAGGAGATGCTGCAGAAGCGAATGTTGATTCGCCGAAAGGGAGTCCTAGAGGAAGAACAAAAAGACAGTGGCAGTGACCACCGAGGGGATGAAGATGACATTCCCTTGGGACCCAGATCCAATGTCAGTCTTTTGGACCAACACCAGCACCTAAAAGAGAAGGCTGAAGCTAGAAAAGAATCTGCCAAGGAGAAGCAGCTAAAAGAAGAAGAAAAAATCTTGGAGAGTGTAACAGAGGGAAGAGCTCTGATGTCTGTAAAAGAAATGGCCAAAGGTATAACCTACGATGACCCCATTAAAACTAGCTGGAAACCACCACGTCACATTTTGGAGATGTCTGAAGCGCGTCATGATCGGGTCAGAAGTAAATACCATATCCTTGTGGAGGGTGAAAGGATTCCTCAGCCCATTAAGAGTTTTAAAGAAATGAAGTTTCCTGCAGCTATTTTACGAGGACTAAAGAAGAAAGGAATTCATCACCCTACTCCTATCCAGATCCAAGGGATCCCAACCATTCTTTCTGGACGGGATATGATTGGCATTGCCTTTACTGGCTCTGGAAAAACCCTGGTCTTCACTCTACCTGTTATCATGTTCTGCTTGGAGCAGGAGAAGAGACTGCCCTTTGCCAAGAGGGAGGGACCATATGGACTCATTATTTGTCCCTCTAGGGAGTTGGCTCGTCAAACTCACAGTATAATTGAGTATTACTGCCATTTACTGNCAGAAGATAACTTTCCACATTTACGTACAGCACTTTGCATTGNGGGGATGTCTGTCAGGGAACAGATGGAAACCATCAAAC
  5   1   2       bld Ski1      in                         CABJ1057.5p                                                                                                                                                                                                                                       AGATTATGTACCCTATGTGCCTCTTAAGCAAAGGAGGCAGGAGATGCTGCAGAAGCGAATGTTGATTCGCCGAAAGGGAGTCCTAGAGGAAGAACAAAAAGACAGTGGCAGTGACCACCGAGGGGATGAAGATGACATTCCCTTGGGACCCAGATCCAATGTCAGTCTTTTGGACCAACACCAGCACCTAAAAGAGAAGGCTGAAGCTAGAAAAGAATCTGCCAAGGAGAAGCAGCTAAAAGAAGAAGAAAAAATCTTGGAGAGTGTAACAGAGGGAAGAGCTCTGATGTCTGTAAAAGAAATGGCCAAAGGTATAACCTACGATGACCCCATTAAAACTAGCTGGAAACCACCACGTCACATTTTGGAGATGTCTGAAGCGCGTCATGATCGGGTCAGAAGTAAATACCATATCCTTGTGGAGGGTGAAAGGATTCCTCAGCCCATTAAGAGTTTTAAAGAAATGAAGTTTCCTGCAGCTATTTTACGAGGACTAAAGAAGAAAGGAATTCATCACCCTACTCCTATCCAGATCCAAGGGATCCCAACCATTCTTTCTGGACGGGATATGATTGGCATTGCCTTTACTGGCTCTGGAAAAACCCTGGTCTTCACTCTACCTGTTATCATGTTCTGCTTGGAGCAGGAGAAGAGACTGCCCTTTGCCAAGAGGGAGGGACCATATGGACTCATTATTTGTCCCTCTAGGGAGTTGGCTCGTCAAACTCACAGTATAATTGAGTATTACTGCCATTTACTGCAAGAAGATAACTTTCCACATTTACGTACAGCACTTTGCATTGGGGGGATGTCTGTC
  5   1   2       bld Gas7                                 XZG11663.5p                                                                                                                                                                                                                                                                                                                                                                                                                          CCCAGCACCTAAAAGAGAAGGCTGAAGCTAGAAAAGAATCTGCCAAGGAGAAGCAGCTAAAAGAAGAAGAAAAAATCTTGGAGAGTGTAACAGAGGGAAGAGCTCTGATGTCTGTAAAAGAAATGGCCAAAGGTATAACCTACGATGACCCCATTAAAACTAGCTGGAAACCACCACGTCACATTTTGGAGATGTCTGAAGCGCGTCATGATCGGGTCAGAAGTAAATACCATATCCTTGTGGAGGGTGAAAGGATTCCTCAGCCCATTAAGAGTTTTAAAGAAATGAAGTTTCCTGCAGCTATTTTACGAGGACTAAAGAAGAAAGGAATTCATCACCCTACTCCTATCCAGATCCAAGGGATCCCAACCATTCTTTCTGGACGGGATATGATTGGCATTGCCTTTACTGGCTCTGGAAAAACCCTGGTCTTCACTCTACCTGTTATCATGTTCTGCTTGGAGCAGGAGAAGAGACTGCCCTTTGCCAAGAGGGAGGGACCATATGGACTCATTATTTGTCCCTCTAGGGAGTTGGCTCGTCAAACTCACAGTATAATTGAGTATTACTGCCATTTACTGCAAGAAGATAACTTTCCACATTTACGTACAGCACTTTGCATTGGGGGGATGTCTGTCAAGGAACAGATGGAAACCATCAAACAGGGTGTGCATATGATGGTTGCCACACCCGGCCGGCTCATGGACCTCTTGCAGAAAAAGATGGTGAGTTTGGACATCTGCAGGTACCTGGCACTGGATGAGGCTGACCGCATGATTGATATGGGCTTTGAAGAAGATATCAGAACAATATTCTCCTACTNTCAGGGTCAGAGACAGACTTTGCTTTTTAG
  5   1   2       bld Gas7      in                         XZG34841.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGGGAAGAGCTCTGATGTCTGTAAAAGAAATGGCCAAAGGTATAACCTACGATGACCCCATTAAAACTAGCTGGAAACCACCACGTCACATTTTGGAGATGTCTGAAGCGCGTCATGATCGGGTCAGAAGTAAATACCATATCCTTGTGGAGGGTGAAAGGATTCCTCAGCCCATTAAGAGTTTTAAAGAAATGAAGTTTCCTGCAGCTATTTTACGAGGACTAAAGAAGAAAGGAATTCATCACCCTACTCCTATCCAGATCCAAGGGATCCCAACCATTCTTTCTGGACGGGATATGATTGGCATTGCCTTTACTGGCTCTGGAAAAACCCTGGTCTTCACTCTACCTGTTATCATGTTCTGCTTGGAGCAGGAGAAGAGACTGCCCTTTGCCAAGAGGGAGGGACCATATGGACTCATTATTTGTCCCTCTAGGGAGTTGGCTCGTCAAACTCACAGTATAATTGAGTATTACTGCCATTTACTGCAAGAAGATAACTTTCCACATTTACGTACAGCACTTTGCATTGGGGGGATGTCTGTCAAGGAACAGATGGAAACCATCAAACAGGGTGTGCATATGATGGTTGCCACACCCGGCCGGCTCATGGACCTCTTGCAGAAAAAGATGGTGAGTTTGGACATCTGCAGGTACCTGGCACTGGATGAGGCTGACCGCATGATTGATATGGGCTTTGAAGAAGATATCAGAACAATATTCTCCTACTTCAAGGGTCAGAGACAGACTTTGCTTTTTAGTGCCACTATGCCAAAGAAGATTCAGAATTTTG
  5   1   2       bld Gas7      in                         XZG25428.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCTGAAGCGCGTCATGATCGGGTCAGAAGTAAATACCATATCCTTGTGGAGGGTGAAAGGATTCCTCAGCCCATTAAGAGTTTTAAAGAAATGAAGTTTCCTGCAGCTATTTTACGAGGACTAAAGAAGAAAGGAATTCATCACCCTACTCCTATCCAGATCCAAGGGATCCCAACCATTCTTTCTGGACGGGATATGATTGGCATTGCCTTTACTGGCTCTGGAAAAACCCTGGTCTTCACTCTACCTGTTATCATGTTCTGCTTGGAGCAGGAGAAGAGACTGCCCTTTGCCAAGAGGGAGGGACCATATGGACTCATTATTTGTCCCTCTAGGGAGTTGGCTCGTCAAACTCACAGTATAATTGAGTATTACTGCCATTTACTGCAAGAAGATAACTTTCCACATTTACGTACAGCACTTTGCATTGGGGGGATGTCTGTCAAGGAACAGATGGAAACCATCAAACAGGGTGTGCATATGATGGTTGCCACACCCGGCCGGCTCATGGACCTCTTGCAGAAAAAGATGGTGAGTTTGGACATCTGCAGGTACCTGGCACTGGATGAGGCTGACCGCATGATTGATATGGGCTTTGAAGAAGATATCAGAACAATATTCTCCTACTTCAAGGGTCAGAGACAGACTTTGCTTTTTAGTGCCACTATGCCAAAGAAGATTCAGAATTTTGCCAAAAGTGCACTGGTAAAGCCAATAACTATTAATGTGGGGCGAGCAGGAGCTGCCAGTCTGGATGTG
  5   1   2       bld Neu0                               IMAGE:6996049                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCTCAGCCCATTAAGAGTTTTAAAGAAATGAAGTTTCCTGCAGCTATTTTACGAGGACTAAAGAAGAAAGGAATTCATCACCCTACTCCTATCCAGATCCAAGGGATCCCAACCATTCTTTCTGGACGGGATATGATTGGCATTGCCTTTACTGGCTCTGGAAAAACCCTGGTCTTCACTCTACCTGTTATCATGTTCTGCTTGGAGCAGGAGAAGAGACTGCCCTTTGCCAAGAGGGAGGGACCATATGGACTCATTATTTGTCCCTCTAGGGAGTTGGCTCGTCAAACTCACAGTATAATTGAGTATTACTGCCATTTACTGCAAGAAGATAACTTTCCACATTTACGTACAGCACTTTGCATTGGGGGGATGTCTGTCAAGGAACAGATGGAAACCATCAAACAGGGTGTGCATATGATGGTTGCCACACCCGGCCGGCTCATGGACCTCTTGCAGAAAAAGATGGTGAGTTTGGACATCTGCAGGTACCTGGCACTGGATGAGGCTGACCGCATGATTGATATGGGCTTTTGAAAAGAAATTCCGAAACCATATTCTCCCTACTTTCAAGGGTCAAAAAAAAAACTTTTTCTTTTTTTTTGGGCCCCCTTTCCCCAAAAAAAAATCCCAAAATTTTTTTCCCAAAAAGTGGTCCCCGGTTTAAACCCCCCAAAATTTTTTTTTGTGGGGGGGGGGGAAAAAAAAAAAACCCCCCCCCCCCCCCGGGGGGGGGGTTGTTTTCCTCCCCAAGAAGAAAAAAAAAATTTTTTTTTTTTAAAAGAGGAGGGGGGGGGCCCGAAAAAAAGGGGGGGTGGTTTTTCCTCCCCCTCCCCCCCCCAAAGAAGTTGTTGTGTTTAATAAAAAAAA
  5   1   2       bld Ova1      in                        CABE12853.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCATTATTTGTCCCTCTAGGGAGTTGGCTCGTCAAACTCACAGTATAATTGAGTATTACTGCCATTTACTGCAAGAAGATAACTTTCCACATTTACGTACAGCACTTTGCATTGGGGGGATGTCTGTCAAGGAACAGATGGAAACCATCAAACAAGGTGTGCATATGATGGTTGCCACACCCGGCCGGCTCATGGACCTCTTGCAGAAAAAGATGGTGAGTTTGGACATCTGCAGGTACCTGGCACTGGATGAGGCTGACCGCATGATTGATATGGGCTTTGAAGAAGATATCAGAACAATATTCTCCTACTTCAAGGGTCAGAGACAGACTTTGCTTTTTAGTGGCACTAAAAAGCAAAGAAGATTCAGAATTTTGCCAAAAGTGCACTGGTAAAGCCAATAACTATTAATGTGGGGCGAGCAGGGGCTGCCAGTCTGGATGTGATTCAGGAAGTAGAGTATGTGAAGGAGGAGGCTAAAATGGTCTATCTCCTAGAATGTTTACAGAAGACTCCTCCGCCAGTACTGATATTTGCTGAAAAGAAGGCGGATGTTGATGCTATACACGAGTATTTACTACTTAAGGGTGTTGAGGCCGTAGCCATCCATGGAGGAAAGGACCAAGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAAATGCAACTACCTTTATAAAACAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTG
  5   1   2       bld Tad5      in                         XZT50087.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGTCAAACTCACAGTATAATTGAGTATTACTGCCATTTACTGCAAGAAGATAACTTTCCACATTTACGTACAGCACTTTGCATTGGGGGGATGTCTGTCAAGGAACAGATGGAAACCATCAAACAGGGTGTGCATATGATGGTTGCCACACCCGGCCGGCTCATGGACCTCTTGCAGAAAAAGATGGTGAGTTTGGACATCTGCAGGTACCTGGCACTGGATGAGGCTGACCGCATGATTGATATGGGCTTTGAAGAAGATATCAGAACAATATTCTCCTACTTCAAGGGTCAGAGACAGACTTTGCTTTTTAGTGCCACTATGCCAAAGAAGATTCAGAATTTTGCCAAAAGTGCACTGGTAAAGCCAATAACTATTAATGTGGGGCGAGCAGGAGCTGCCAGTCTGGATGTGATTCAGGAAGTAGAGTATGTGAAGGAGGAGGCTAAAATGGTCTATCTCCTAGAATGTTTACAGAAGACTCCTCCGCCAGTACTGATATTTGCTGAAAAGAAGGCGGATGTTGATGCTATACACGAGTATTTACTACTTAAGGGTGTTGAGGCCGTAGCCATCCATGGAGGAAAGGACCAAGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAAACAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCAT
  5   1   2       bld Gas       in                   TGas079m20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAGTATTACTGCCATTTACTGCAAGAAGATAACTTTCCACATTTACGTACAGCACTTTGCATTGGGGGGATGTCTGTCAAGGAACAGATGGAAACCATCAAACAAGGTGTGCATATGATGGTTGCCACACCCGGCCGGCTCATGGACCTCTTGCAGAAAAAGATGGTGAGTTTGGACATCTGCAGGTACCTGGCACTGGATGAGGCTGACCGCATGATTGATATGGGCTTTGAAGAAGATATCAGAACAATATTCTCCTACTTCAAGGGTCAGAGACAGACTTTGCTTTTTAGTGCCACTATGCCAAAGAAGATTCAGAATTTTGCCAAAAGTGCACTGGTAAAGCCAATAACTATTAATGTGGGGCGAGCAGGGGCTGCCAGTCTGGATGTGATTCAGGAAGTAGAGTATGTGAAGGAGGAGGCTAAAATGGTCTATCTCCTAGAATGTTTACAGAAGACTCCTCCGCCAGTACTGATATTTGCTGAAAAGAAGGCGGATGTTGATGCTATACACGAGTATTTACTACT
  5   1   2       bld Ova1      in                        CABE10375.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGGTGTGCATATGATGGTTGCCACACCCGGCCGGCTCATGGACCTCTTGCAGAAAAAGATGGTGAGTTTGGACATCTGCAGGTACCTGGCACTGGATGAGGCTGACCGCATGATTGATATGGGCTTTGAAGAAGATATCAGAACAATATTCTCCTACTTCAAGGGTCAGAGACAGACTTTGCTTTTTAGTGCCACTATGCCAAAGAAGATTCAGAATTTTGCCAAAAGTGCACTGGTAAAGCCAATAACTATTAATGTGGGGCGAGCAGGGGCTGCCAGTCTGGATGTGATTCAGGAAGTAGAGTATGTGAAGGAGGAGGCTAAAATGGTCTATCTCCTAGAATGTTTACAGAAGACTCCTCCGCCAGTACTGATATTTGCTGAAAAGAAGGCGGATGTTGATGCTATACACGAGTATTTACTACTTAAGGGTGTTGAGGCCGTAGCCATCCATGGAGGAAAGGACCAAGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGT
  5   1   2       bld Ski1      in                         CABJ1333.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATGGTTGCCACACCCGGCCGGCTCATGGACCTCTTGCAGAAAAAGATGGTGAGTTTGGACATCTGCAGGTACCTGGCACTGGATGAGGCTGACCGCATGATTGATATGGGCTTTGAAGAAGATATCAGAACAATATTCTCCTACTTCAAGGGTCAGAGACAGACTTTGCTTTTTAGTGCCACTATGCCAAAGAAGATTCAGAATTTTGCCAAAAGTGCACTGGTAAAGCCAATAACTATTAATGTGGGGCGAGCAGGGGCTGCCAGTCTGGATGTGTTCCGGAAGTAAAGTATGTGAAGGAAGAAGCTAAAATGGTCTATCTCCTAAAATGGTTACCGAAAACTCCTCCGCCCGTACTGATATTTGCTGAAAAGAAAGCGGATGTTGATGCTATACACCAATATTTACTACTTAAGGGTGGTGAGGCCGTAACCCTCCCTGGAGGAAAGGACCCAGAAGAGAGAACCAAGGCCATTGAAGCTTTTAAGGAAGAAAAGAAAGATGTACTGGTTGCTACCGATGTTGCCTCAAAAGGTCTGGACTTCCCAGCTATCCCACATGGGGTTAATTATGACCTGCCTGAAGAGATCCAGAACTACCTTCACCGAATAAGACGTACTGGTCCATCCGGTAACACTGGAATTGCCACTACCTTTATAAACCAGTCTTGTGACCAATCTGTTCTGATGGATCTGAAGGCTTTGCTCCT
  5   1   2       bld Ova1      in                         CABE8768.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGCTCATGGACCTCTTGCAGAAAAAGATGGTGAGTTTGGACATCTGCAGGTACCTGGCACTGGATGAGGCTGACCGCATGATTGATATGGGCTTTGAAGAAGATATCAGAACAATATTCTCCTACTTCAAGGGTCAGAGACAGACTTTGCTTTTTAGTGCCACTATGCCAAAGAAGATTCAGAATTTTGCCAAAAGTGCACTGGTAAAGCCAATAACTATTAATGTGGGGCGAGCAGGGGCTGCCAGTCTGGATGTGATTCAGGAAGTAGAGTATGTGAAGGAGGAGGCTAAAATGGTCTATCTCCTAGAATGTTTACAGAAGACTCCTCCGCCAGTACTGATATTTGCTGAAAAGAAGGCGGATGTTGATGCTATACACGAGTATTTACTACTTAAGGGTGTTGAGGCCGTAGCCATCCATGGAGGAAAGGACCAAGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTG
  5   1   2       bld Gas       out                  TGas054c01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCCACTATGCCAAAGAAGATTCAGAATTTTGCCAAAAGTGCACTGGTAAAGCCAATAACTATTAATGTGGGGCGAGCAGGAGCTGCCAGTCTGGATGTGATTCAGGAAGTAGAGTATGTGAAGGAGGAGGCTAAAATGGTCTATCTCCTAGAATGTTTACAGAAGACTCCTCCGCCAGTACTGATATTTGCTGAAAAGAAGGCGGATGTTGATGCTATACACGAGTATTTACTACTTAAGGGTGTTGAGGCCGTAGCCATCCATGGAGGAAAGGACCAAGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCT
  5   1   2       bld Gas7      in                         XZG62343.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGAAGTAGAGTATGTGAAGGAGGAGGCTAAAATGGTCTATCTCCTAGAATGTTTACAGAAGACTCCTCCGCCAGTACTGATATTTGCTGAAAAGAAGGCGGATGTTGATGCTATACACGAGTATTTACTACTTAAGGGTGTTGAGGCCGTAGCCATCCATGGAGGAAAGGACCAAGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGCGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACANACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCT
  5   1   2       bld Tad5      in                         XZT42329.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGGAGGAGGCTAAAATGGTCTATCTCCTAGAATGTTTACAGAAGACTCCTCCGCCAGTACTGATATTTGCTGAAAAGAAGGCGGATGTTGATGCTATACACGAGTATTTACTACTTAAGGGTGTTGAGGCCGTAGCCATCCATGGAGGAAAGGACCAAGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTNGAATGTTTTATCTGGTCCTAAACAGGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTT
  5   1   2       bld Tad5      in                         XZT40895.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCTAAATGGTCTATCTCCTAGAATGTTTACAGAAGACTCCTCCGCCAGTACTGATATTTGCTGAAAAGAAGGCGGATGTTGATGCTATACACGAGTATTTACTACTTAAGGGTGTTGAGGCCGTAGCCATCCATGGAGGAAAGGACCAAGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTANAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTATCT
  5   1   2       bld TpA       in                   TTpA045g06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGATATTTGCTGAAAAGAAGGCGGATGTTGATGCTATACACGAGTATTTACTACTTAAGGGTGTTGAGGCCGTAGCCATCCATGGAGGAAAGGACCAAGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAAACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCNAGGGCATGTATTAAAAAANATAAATCATGAACTATTGTANGTATTGGCCTTTTTTAAAGCTGTGTTAAATGTAGACTTTCATTCCTAT
  3   1   2       bld Hrt1      in                         CAAQ2918.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAAGAAGGCGGATGTTGATGCTATACACGAGTATTTACTACTTAAGGGTGTTGAGGCCGTAGCCATCCATGGAGGAAAGGACCAGNAAGAGAGAACAAAGGCAATGAGGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGCGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCNTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTGA
  3   1   2       bld Ova1      in                        CABE10375.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGTTGATGCTATACACGAGTATTTACTACTTAAGGGTGTTGAGGCCGTAGCCATCCATGGAGGAAAGGACCAAGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGCGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTAT
  3   1   2       chi Fat1      out                        CABC1650.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTATCTGGAGGCCATTCTCTTGGTTTTTCTTTCCTCTAGAATAATCTCCGGTATAATTTCAGTAACTGTAACTTGNTAATATGTCAAAAATGTACTGACAATGATTGCCTCTAATTTCAGTATACATCAAGAGCCTAAATGNATATGATTCCCTCTAACCATTTGTCACTATGCCTTTGCAGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGCGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCGTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTGAACCTCTCGCCCTAT
  5   1   2       bld Gas7      in                         XZG59313.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGGCCGTAGCCATCCATGGAGGAAAGGACCAAGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAAACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGANATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTAT
  5   1   2       bld Neu       in                   TNeu086h07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGAAAGGACCAAGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGCGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAA
  3   1   2       bld Ova1      in                         CABE8768.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAGAGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTGNCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGCGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTG
  3   1   2       bld Tad5      in                         XZT50087.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGAAGAGGAACAAAGCAATTGAGGCTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTG
  3   1   2       bld Neu       in                    TNeu086h07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAGAACAAAGGCAATTGAGGCTTTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGCGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATANAAGTTTTGCCTGTGTCGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ski1      in                         CABJ1333.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCAATTGAGGCTTTTAGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGCGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTG
  3   1   2       bld Ova1      in                        CABE12853.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTAGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTGCATCAAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGCGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATCAATATAATAAAGTTTTGCCTGTGTCTG
  3   1   2      seed Ski1      in                         CABJ1057.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGCGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTC
  3   1   2       bld Gas7      in                         XZG59313.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGGAAGAAAAGAAAGATGTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTCCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAAACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTG
  5   1   2       bld Thy1      out                       CBST8892.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTACTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAAACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGANATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTAAAGCTGTGTAAATGTAGACTTCATTCCTATCTCTTACT
  5   1   2       bld Gas7      in                         XZG41928.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGGTTGCTACAGATGTTGCATCAAAGGGTCTGGACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAAACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTG
  3   1   2       bld Tad5      in                         XZT42329.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTG
  3   1   2       bld Gas7      in                         XZG41928.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTCCCAGCTATCCAACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAAACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTG
  3   1   2       bld TpA       in                    TTpA045g06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACATGTGGTTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAAACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTTTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGGTCTGAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas       in                   TGas098e02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTAATTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGCGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCT
  3   1   2       bld Gas7      in                         XZG62343.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTATGACATGCCTGAGGAGATCGAGAACTACGTTCACAGAATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGCGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTGAAAAAAAACCAAAAAAAAAAAACC
  5   1   2       bld Gas7                                 XZG10958.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATAGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAAACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTG
  3   1   2       bld Gas       in                    TGas079m20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGACGTACTGGTCGATCGGGTAACACTGGAATTGCAACTACCTTTATAAACAAGTCTTGTGACGAATCTGTTCTGATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGCGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTGAAAAA
  5  -1   2       bld Egg                            TEgg117d02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGGATCTGAAGGCTTTGCTCATGGAGGCAAAGCAACGTGTGCCCCCTGTTCTGCAGGTGCTTAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAAACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGGTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAATTGCAGGAGTTTTACCAGATGTAGGGGGCGGAATTTGGCCTTTGAAT
  3   1   2       bld Gas7      in                         XZG34841.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGGTGCTTAATGGCAGGGATGAAACGATGCTGGATTTTGGAGATGAAAGAGGCGGGGCTTTTTGGGGGGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAAACAAAGCAAGTCAGCCCCCTGGGCAGAAAGGATTTTCTTGCTCCCAGCCCAAAGGATTTTTGAGCAAAAAAAGTGTTTGGGGGCTTAGATGGGGGGTACAAAAAGGCTAACATTGCATTGCAACAATGCAATACAAATTGGGTCCCAAACCGCCGGGGTTTTTCCCGATGTAGGGGGGGGAATTTGGCCTTTGAATTCTCTGTTTGGTTTTCAACCTTGTACTAAAGGGACGGGCCCCCCGAGTTTTTGTGAAAAGTTTTTTCTGGTCCTAAACAAGGGGGAACTGCCGGGCAATGTTTTAAAAAAAAAAAATCCTGAACTTTTGTGGGGATTGGCCTTTTTTAAAGCGGGGTTAATGTAAGACTTTCATTCCCTATCTCTTTCCCGGGTATTCTTTTTTA
  3   1   2       bld Gas       in                    TGas098e02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAATGGCAGTGATGAAACGATGCTGGATATTGGAGATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGCGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTGAAACATTTCGTAAGATTTGCTCATGTGGTAAATTGTACTATTTATCACTTATGTGTGGTCGCAAAGTGTAACATTGTAGCTAACAAAGCATCAGGTTTAAGCATAATAACCTTTGAATTAGGTGGCTGTATAGGCCTGAAGTTATTGGAGACAGGCTCCCATAGACCAGGCTGTTTATTTGTAGAAGTTACTTAACACTGGTGCCTTATTTATAAAAATTGGAATTCAACATTTTCATTTTCCCCAGAAAGACCCTTCACTTGTGTAAATGTATTGAATGTTTTTTCACATTATTTTATTAAACTTCCAGTTATT
  5   1   2       bld Egg                            TEgg082c06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGAAAGAGGCTGTGCTTTTTGTGGTGGTTTGGGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAGACAAAGCAAGTCAGCACCAGGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTCGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTGAAACATTTCGTAAGATTTGCTCATGTGGTAAATTGTACTATTTATCACTTGTTATGTGTGGTCGCAAAGTGTAACATTGTAGCTAACAAAGCATCAGGTTTAAGCATAATAACCTTTGAATTA
  3   1   2       bld Gas7      in                         XZG25428.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCATCGTATTACAGACTGCCCCAAGTTGGAAGCTATGCAAACAAAGCAAGTCAGCACCATGGGCAGAAAGGATTATCTTGCTACCAGCTCAATGGATTTCTGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTGAAACATTTCGTAAGATTTGCTCATGTGGTAAATTGTACTATTTATCACTTGTTATGTGTGGTCGCAAAGTGTAACATTGTAGCTAACAAAGCATCAGGTTTAAGCATAATAACCTTTGAATTAGGTGGCTGTATAGGTCTGAAGTTATTGGAGACAGGCTCCCATAGACCAGGCTGTGTATTTGTAGAAGTTACTTAACACTGGTGCCTTATTTATAAAAATTGGAATTCAACATTTTCATTTTCCCCACAAAGACCCTTCACTTGTGTAAATGTATTGAATTTTTTTTCACATTATTTTATTAAACTTCCAGTTATTGGGTGC
  3   1   2       bld Tad5      in                         XZT40895.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGCAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTGAAACATTTCGTAAGATTTGCTCATGTGGTAAATTGTACTATTTATCACTTGTTATGTGTGGTCGCAAAGTGTAACATTGTAGCTAACAAAGCATCAGGTTTAAGCATAATAACCTTTGAATTAGGTGGCTGTATAGGTCTGAAGTTATTGGAGACAGGCTCCCATAGACCAGGCTGTTTATTTGTAGAAGTTACTTAACACTGGTGCCTTATTTATAAAAATTGGAATTCAACATTTTCATTTTCCCCACAAAGACCCTTCACTTGTGTAAATGTATTGAATGTTTTTTCACATTATTTTATTAAACTTCCAGTTATTGGGTGCAT
  5   1   2       bld Neu       in                   TNeu091d22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGT
  3   1   2       bld Neu       in                    TNeu091d22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAAGATGTGTCTGGGTGCTTAGATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCA
  5   1   2       bld Neu                            TNeu096e19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAAGAGTGTCTGGGTGCTTAATGTGGTGTACAAAATGGCTAACATTGCATTGCAACAATGCAATACAAATTGGATCACAAACTGCAGGAGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTGTGATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGT
  5   1   2       bld Neu5                                 ANHP1821.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTTTTACCAGATGTAGGGGGCTGAATTTGGCCTTTGAATACCAGACAGAGAATTCAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaCCCCCCCCCCTTTTGGGGGGGTTTTTTTT
  3  -1   2       bld Sto1                                 CABG8280.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGAATTCTCTGTCTGGTATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCCCAA
  3   1   2       bld Tad5      in                         XZT53507.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACGCGTCCGATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTG
  5   1   2       bld Tad5      in                         XZT53507.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCAACATTGTACTAAAGGGACTGGCTACCTGAGTTTCTGTGAAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTGAAAAAAAAAAAAAAAAAAAGG
  3   1   2       bld Neu       in                    TNeu074c16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAACTCAGGTAGCCAGTCCCTTTAGTACAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTGAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu074c16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACTCAGGTAGCCAGTCCCTTTAGTACAATGTTTTATCTGGTCCTAAACAAGGGAGAACTGCAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCCTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTG
  5   1   2       bld Neu                            TNeu094j22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGGGCAATGTATTAAAAAAAATAAATCATGAACTATTGTAGGTATTGGCCTTTTTTAAAGCTGTGTTAATGTAAGACTTTCATTCCTTATCTCTTTACTGTGTATTCTTTATTATAGCATACAATATAATAAAGTTTTGCCTGTGTCTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)