Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI13149.3.5                        76 END     1           2        1                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012073642 Xt7.1-CABC4491.3 - 40 ESTs
                                                                       .........-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABC4491.3                                                                                                                                                                                                                                                                                                                                          GGCTGAGAAGATCCAAGGGTTGGCAGAGAGTCGGGTCCAGGATCTTCTGTTGTATTTATTTAGAGAATATGAGCTTTCTGGAAAAAACAGTCCGCATGACTTATAGGACAAGTAAGCTAAGAAGCCTTACAGCTCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCATGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTTTCAACTTCATCCTGTATCATTCCACCCATAC
                                                  Xt7.1-CHK-1008226840                                                                                                                                                                                                                                                                                                                                                GAAGATCCAAGGGTTGGCAGAGAGTCGGGTCCAGGATCTTCTGTTGTATTTATTTAGAGAACATGAGCTTTCTGGAAAAAACAGTCCGCATGACTTATAGGACAAGTAAGCTAAGAAGCCTTACAGCTCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCATGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTTTxxAxTxCATCCTGTATCATTCCACCCATACTGGGTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                               2     3     3     4     3     4     4     5     4     7     4     7    10    11    12    13    12    13    12    13    12    13    12    13    13    14    14    15    14    15    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    17    16    17    16    17    15    17    15    17    15    17    15    17    15    17    16    18    16    18    18    20    18    20    19    22    20    22    19    21    20    22    21    23    22    24    25    29    26    31    30    35    31    35    31    35    31    35    31    35    31    35    31    35    31    35    33    37    33    37    34    38    34    38    34    38    34    38    34    38    34    38    33    37    33    37    33    37    33    37    32    36    32    36    32    36    32    36    32    36    27    31    25    29    25    29    23    27    23    26    23    26    23    26    23    25    22    24    22    24    22    24    22    24    21    24    21    24    21    24    21    24    22    24    22    24    21    24    21    24    21    23    21    23    21    23    21    23    21    23    21    23    21    23    21    23    21    23    21    23    21    23    19    23    20    22    20    22    20    22    20    22    14    22    11    18     2     3     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -G----------
                                               BLH ATG     161     579                                                                                                                                                                                                                                                                                                                                          
                                               BLH MIN     131     150                                                                                                                                                                                                                                                                                                                                          
                                               BLH MPR      41     150                                                                                                                                                                                                                                                                                                                                          
                                               BLH OVR      68     107                                                                                                                                                                                                                                                                                                                                          
                                               CDS MIN      68       1                                                                                                                                                                                                                                                                                                                                          
                                               EST CLI      33       1                                                                                                                                                                                                                                                                                                                                          
                                               ORF LNG      68      18                                                                                                                                                                                                                                                                                                                                          
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Xt ==== 1e-015     AAH59746.1 Unknown (protein for MGC:75740) [Silurana tropicalis] =====================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Sc ==== 4e-019     NP_013386.1 Eci1p [Saccharomyces cerevisiae] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Dm ==== 1e-042     NP_612065.1 CG13890-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 2e-089     NP_496330.1 peroxisomal isomerase (42.1 kD) (2L111) [Caenorhabditis elegans] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Sp ---- 3e-110     XP_780031.1 PREDICTED: similar to Peroxisomal 3,2-trans-enoyl-CoA isomerase (Dodecenoyl-CoA delta-isomerase) (D3,D2-enoyl-CoA isomerase) (DBI-related protein 1) (DRS-1) (Hepatocellular carcinoma-associated antigen 88) isoform 1 [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 4e-128     NP_035998.1 peroxisomal delta3, delta2-enoyl-Coenzyme A isomerase [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Hs ==== 2e-134     NP_006108.2 peroxisomal D3,D2-enoyl-CoA isomerase isoform 1; acyl-Coenzyme A binding domaincontaining 2 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dr ==== 2e-143     NP_001002645.1 zgc:92030 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Gg ---- 1e-150     XP_418965.1 PREDICTED: similar to hypothetical protein [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          AAI06605.1 MGC132021 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = ?? ==== 0          NP_001089808.1 hypothetical protein LOC734873 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABC4491.3                                                                                                                                                                                                                                                                                                                                                                                                              ATG------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------TGAATG------------ATG------ATG---------------ATG------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2       bld TbA       in                   TTbA003g04.p1kSP6 GGTTGGCAGAGAGTCGGGTCCAGGATCTTCTGTTGTATTTATTTAGAGAACATGAGCTTTCTGGAAAAAACAGTCCGCATGACTTATAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGTAAGATTCTTTACTGTAAATTCTGCACTTGTACTTAATTGTATCTGCTATTCTATCATGCAGGTATGCTTCATTCTTTATCAGAGCTTATCAGGTAGGTTAAAAGCAGGTAGATATTATCTTACTGTTCAAGTCCAAAGCCACTATCCGGATTTTTCTTAATCCTCAAGGAATATCCGTTTTTATGACAAAAGATTTATGCAATTATATAACACTGTTCATGAAAGAAAACCCTAGTATCCTAAAATACACATGCCAAAAGAGTTGAACAAAAAGTCACAATCCACCAAAACACAGCCAGTTTTGGGAACTTATGTTGTTTATGTATTGCCTTACATAACTAGTTTTTATTTGTATTGCAAATGGAAAAATAAGTCAGAACTGTAAATGTGAAAGATGTACAGCAAAAAAAATATACATTATTATGCTTGAGAAATTATTTGGGCTTTGCATTTTCTCACTATGTTTACATATCCAGCGCTACTTAAGAGTCTGTCATTCTTTTTTAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCATGTTTCCTGTGAAGACAATATTA
  3  -1   2       bld Ova1      in                         CABE1879.3p                                                                                                                                                                                                                                                                                                                              TTTTGACCCCTAGGCTGAGAAGATCCAAGGGTTGGCAGAGAGTCGGGTCCAGGATCTTCTGTTGTATTTATTTAGAGAACATGAGCTTTCTGGAAAAAACAGTCCGCATGACTTATAGGACAAGTAAGCTAAGAAGCCTTACAGCCCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCAGGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTANACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTTCCAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATT
  5   1   2   10  bld Tbd1 5g3  in                         CBXT9466.b1 .........................................................................................................................................................................................................................................................................................................................................GGCTGAGAAGATCCAAGGGTTGGCAGAGAGTCGGGTCCAGGATCTTCTGTTGTATTTATTTAGAGAATATGAGCTTTCTGGAAAAAACAGTCCGCATGACTTATAGGACAAGTAAGCTAAGAAGCCTTACAGCCCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCGAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCAGGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGT
  5   1   2   20  bld Te1  5g                             CBWN17454.b1 ...............................................................................................................................................................................................................................................................................................................................................GAAGATCCAAGGGTTGGCAGAGAGTCGGGTCCAGGATCTTCTGTTGTATTTATTTAGAGAATATGAGCTTTCTGGAAAAAACAGTCCGCATGACTTATAGGACAAGTAAGCTAAGAAGCCTTACAGCCCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCAGGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAG
  5   1   2       bld Fat1      in                         CABC4491.5p                                                                                                                                                                                                                                                                                                                                                                           GGTCCAGGATCTTCTGTTGTATTTATTTAGAGAACATGAGCTTTCTGGAAAAAACAGTCCGCATGACTTATAGGACAAGTAAGCTAAGAAGCCTTACAGCTCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCATGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAA
  5   1   2   10  bld Sto1 5g3  in                        CABG12350.5p ...............................................................................................................................................................................................................................................................................................................................................................................TCGGACGAGGCTGTTGTATTTTTTGAGAACATGAGCTTTCTGGAAAAAACAGTCCGCATGACTTATAGGACAAGTAAGCTAAGAAGCCTTACAGCTCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCATGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAGTCCAGAANGCT
  5   1   2       bld Fat1      in                         CABC9446.5p                                                                                                                                                                                                                                                                                                                                                                                     TCGATTCAATCGGCACGAGGAGAACATGAGCTTTCTGGAAAAAACAGTCCGCATGACTTATAGGACAAGTAAGCTAAGAAGCCTTACAGCTCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGTAAGATTCTTTACTGTAAATTCTGCACTTGTACTTAATTGTATCTGCTATTCTATCATGCAGGTATGCTTCATTCTTTATCAGAGCTTATCAGGTAGGTTAAAAGCAGGTAGATATTATCTTACTGTTCAAGTCCAAAGCCACTATCCGGATTTTTCTTAATCCTCAAGGAATATCCGTTTTTATGACAAAAGATTTATGCAATTATATAACACTGTTCATGAAAGAAAACCCTAGTATCCTAAAATACACATGCCAAAAGAGTTGAACAAAAAGTCACAATCCACCAAAACACAGCCAGTTTTGGGAACTTATGTTGTTTATGTATTGCCTTACATAACTAGTTTTTATTTGTATTGCAAATGGAAAAATAAGTCAGAACTGTAAATGTGAAAGATGTACAGCAAAAAAAATATACATTATTATGCTTGAGAAATTATTTGGGCTTTGCATTTTCTCACTATGTTTACATATCCAGCGCTACTTAAGAGTCTGTCATTCTTTTTTAGGATGATACAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTAT
  5   1   2   10  bld Ovi1 5g3  in                         CABI6980.5p ......................................................................................................................................................................................................................................................................................................................................................................................................AGAGAACATGAGCTTTCTGGAAAAAACAGTCCGCATGACTTATAGGACAAGTAAGCTAAGAAGCCTTACAGCTCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCATGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCT
  5   1   2   10  bld Ova1 5g3  in                        CABE13176.5p ........................................................................................................................................................................................................................................................................................................................................................................................................AGAACATGAGCTTTCTGGAAAAAACAGTCCGCATGACTTATAGGACAAGTAAGCTAAGAAGCCTTACAGCTCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCATGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGGCAGCTGGGACAAAGTC
  5   1   2   20  bld Ovi1 5g                              CABI9712.5p ........................................................................................................................................................................................................................................................................................................................................................................................................AGAACATGAGCTTTCTGGAAAAAACAGTCCGCATGACTTATAGGACAAGTAAGCTAAGAAGCCTTACAGCTCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCATGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAA
  5   1   2       bld Ova1      in                        CABE11330.5p                                                                                                                                                                                                                                                                                                                                                                                                                 AGCTTTCTGGAAAAAACAGTCCGCATGACTTATAGGACAAGTAAGCTAAGAAGCCTTACAGCTCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCATGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAA
  5   1   2       bld Ova1      in                        CABE11958.5p                                                                                                                                                                                                                                                                                                                                                                                                                   TCGGCACGAGGAAACAGTCCGCATGACTTATAGGACAAGTAAGCTAAGAAGCCTTACAGCTCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCATGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAG
  5   1   2       bld Mus1      in                         CABH8737.5p                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAAACAGTCCGCATGACTTATAGGACAAGTAAGCTAAGAAGCCTTACAGCCCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCAGGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGGACAAAG
  5   1   2       bld Int1      in                        CAAP13673.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTTAACCTGCATACCACAGGGGCAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGTAAGATTCTTTACTGTAAATTCTGCACTTGTACTTAATTGTATCTGCTATTCTATCATGCAGGTATGCTTCATTCTTTATCAGAGCTTATCAGGTAGGTTAAAAGCAGGTAGATATTATCTTACTGTTCAAGTCCAAAGCCACTATCCGGATTTTTCTTAATCCTCAAGGAATATCCGTTTTTATGACAAAAGATTTATGCAATTATATAACACTGTTCATGAAAGAAAACCCTAGTATCCTAAAATACACATGCCAAAAGAGTTGAACAAAAAGTCACAATCCACCAAAACACAGCCAGTTTTGGGAACTTATGTTGTTTATGTATTGCCTTACATAACTAGTTTTTATTTGTATTGCAAATGGAAAAATAAGTCAGAACTGTAAATGTGAAAGATGTACAGCAAAAAAAATATACATTATTATGCTTGAGAAATTATTTGGGCTTTGCATTTTCTCACTATGTTTACATATCCAGCGCTACTTAAGAGTCTGTCATTCTTTTTTAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCAGTTTGGTGTCTTCTGAATCTTC
  5   1   2       bld Fat1      in                         CABC1853.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAACAATGCAAGCACGGCAGGAAGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCAGGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCT
  5   1   2       bld Ova1      in                          CABE575.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGACTTTGAAAAAGCTCAAAGTAATCTGAAGTTATTAAAGAACGATCCAGGCAATGAAGTAAAACTGAAACTCTATGCACTGTTTAAGCAGGCTACACAAGGACCTTGTAATGTACCAAAACCAGGTATGTTGGACTTTGTAAATAAAGTAAAATGGGATGCCTGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCATGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAA
  5   1   2       bld TpA       out                  TTpA060i19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGGGGGAAGTCTTTGGGAAGTTTGCCAAAGGATGATGCAAGACAGTCCTATGTGGAGCTTGTTTCCAGTTTGGTGTCTTCTGAATCTTCCACCAAAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCAGGTTTCCCGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACGGTTCTTTCCAGANAGAAGTATGGGAAAGGANNTAAAGATATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACACTGATTCGTGTAATG
  3   1   2       bld Fat1      in                         CABC4491.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGTAATGCAGATCCTGGTATAGGCCATAAGAAGTATGAAACTATTCATGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCCTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTTTCAACTTAAAAAAA
  5   1   2       bld Limb      in                        CBSU9734.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTGGTATAGGCCATAAGAAGTATGAAACTATTCAGGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAATTTATGCTAGG
  3   1   2       bld Ovi1 5g3  in                         CABI6980.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAGGCCATAGAAAGTATGAAACTATTCATGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTTCAACTCAAAAAAAA
  3   1   2      seed Sto1 5g3  in                        CABG12350.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCATGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATTTTTTCAACTC
  3   1   2       bld Ova1      in                          CABE575.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGTTTCCTGTGAAGACAATATTATCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATGGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTTTCAACTT
  3   1   2       bld Fat1      in                         CABC9446.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGCATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGGATTCATGTTTTTCAACTT
  3   1   2       bld Ova1      in                        CABE11330.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCAGAAAAGAAAAATGCTATTACTCTTACGATGTATAAGGAAATGGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTGTCAACTT
  3   1   2       bld Limb      in                        CBSU9734.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGCTATTACTCTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTTTCAACTT
  3   1   2       bld Ova1      in                        CABE11958.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTACGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGGATTCATGTTTTTCAACTT
  3   1   2       bld Spl2      in                        CBSS1999.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAGTTCATGTGAGCGTGATGGTGGGGGGCACATTGCAATAGGTATGACAAAAGTCCATCCAGGACAAAACAGATATGTGCCTGACACCCCACCAGTGTTGCTCCGAAGGCACATGCCTTTTCTGTCTATACCTGGCTTATAAATCAGGTGAATTTTATTTTTAGTTTGTCAACTTCTGTATTATGTGTGGCTGGAGTTCATAAATGAGTTTTAAGTATTTTTTTCATAAATATGAATCTGTGAATTATGTTTTTCTTAATTCATGAAAATAAAAAATGTTTCATTTATTTTCTTTGTAGGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACGGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAGCTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGGATTCATGTTTTTCAACTC
  3   1   2       bld Brn4      in                        CAAL18551.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTTCATGTGAGCGTGATGGTGGGGGGCACATTGCAATAGGTATGACAAAAGTCCATCCAGGACAAAACAGATATGTGCCTGACACCCCACCAGTGTTGCTCCGAAGGCACATGCCTTTTCTGTCTATACCTGGCTTATAAATCAGGTGAATTTTATTTTTAGTTTGTCAACTTCTGTATTATGTGTGGCTGGAGTTCATAAATGAGTTTTAAGTATTTTTTTCATAAATATGAATCTGTGAATTATGTTTTTCTTAATTCATGAAAATAAAAAATGTTTCATTTATTTTCTTTGTAGGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACGGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAGCTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTTTCAACTT
  5   1   2       bld Tad5                                 XZT48333.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCAGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACGGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAGCTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGANATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTTTCNAC
  3   1   2       bld Mus1      in                         CABH8737.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGATGTATAAGGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAGCTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTTTCAACTT
  3   1   2       bld Fat1      in                         CABC1853.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACGATGTATAGGAAATTGGGAAGCTTTGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAGCTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTTTCAACTTAA
  5   1   2       bld Spl2      in                        CBSS1999.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAAATTGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGTGTGAGTAGTTTACCTACATTTTAAATATTACGGGTTTTTTTTGCATCTCTGGCAAAATATAACTCGAAACAACTTGGGTTAATGTCTGATCTTTGTTTCCATAGTCCCACAAATTGTTAATAGTTCATGTAGTTAAAACAGCATTTGAGTTAACACTTAAATGGACAAGAGCCACAGAAAGAATAGTCGGCCACCCAAAATAACAAAATATTCCAGTAAGTGACCAGCAAACCCAAGCAAATGTCACACAGTGCATTGGTGCTATTTGACCACATATTACTTGTTGCAAAAATTCTTATACTTGAATTATATGAATGGGATGATACAATACATAACCCCAATAGCTACATGACACATAGAACTATATAACTTTCTGGTTCTTTCTACATACTGAATTGGATCTTTATGAGTAACTTAGAAGTAGTTGAAATACCCTGCTTAATTTACCCAGTACTGGGGTTCTGCTCTGTTACTGTAAGTAGTGCATCCTGTATCATTCCACCCATACTGNGTTAA
  3   1   2       bld Int1      in                        CAAP13673.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAATTGGGAAGCTTTGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTTTCAACTTAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tbd1 5g3  in                         CBXT9466.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGGGAAGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAGCTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTTTCAACTTAAAAAAAAAAAAAAA
  3   1   2       bld Ova1 5g3  in                        CABE13176.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTTTCAACTT
  5  -1   2       bld Ova1      in                         CABE1879.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTTTTGGTGACTATTTCTGCAGTGGCAATGACTTAAACAATTTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAGCTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACCCTCGTGCCGAATTG
  3  -1   2       bld Kid1      in                         CABA9894.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAAACAGATTCATGTTTTTCAACTTAAAAAAAAA
  5  -1   2       bld Kid1      in                         CABA9894.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTACCAACATCCCACCAGAGGGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTCTTCTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTCTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTACCCTGCCCAAAAATTCACTGGCCTTCTCCAAACAACTGATTCGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACGCCTTAAGGAAAGATGGTTATCAGAAGAGTGCATGAATGCCATCATTAGCTTCTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTAGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTATTAAACAGATTCATGTTTTTCAACTTAAAAAAAAACCTCGG
  3   1   2       bld TbA       in                    TTbA003g04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAAAGAAAAGATGGCAAAAGATAGTGCAGATCTGTTGGAGACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATTTCTGTGACTATATTAGGATTATTTGCCCTTGTGTATGCAACTGATCGCGCCACATTCCATACTCCATTCAGCCAGCTGGGACAAAGTCCAGAAGGCTGTTTTTTTTACACCTTTCCTAGAATAATGGGCTTAGGAAAAGCCACAGAGATGCTCCTTTTCAACAAAAAGTTGACAGCACAAGAAGCTTGCAATTTAGGACTGGTAGCAGAAGTTTTCCCTGACAGTTTTTTCCAGAAAGAAGTATGGGAAAGGATAAAAGATTATAGTCCCCTGCCCAAAAATTCACTGGCCTTTTCCAAACAACTGATTGGTGTAAATGAAAAAGAAAAACTTCATGCTGTAAATATTCAAGAGTGTGAACCCCTTAAGGAAAGATGGTTTTCAGAAGAGGGCATGAATGCCATCATTAGCTTTTTCCAAAAGAGAGCTAAATTGTGAATGTCTTTGAAATTTATGCTGGGAATGAAATATATTTATGTAATGGAAAGCAGCCATGTGTATTTTTAAAACAGATTCATGTTTTTCACCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Brn4      in                        CAAL18551.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACTTTTGTTAGCAAGTTCATTGATTTTCCAAAGCCTCTCATTGCTGTAGTAAATGGGCCAGCAACTGGGATCTCTGTGACTATATTAGGATTATTTGACCTTGTGTATGCAACTGATCGTGTGAGTAGTTTACCTACATTTTAAATATTACGGGTTTTTTTTGCATCTCTGGCAAAATATAACTCGAAACAACTTGGGTTAATGTCTGATCTTTGTTTCCATAGTCCCACAAATTGTTAATAGTTCATGTAGTTAAAACAGCATTTGAGTTAACACTTAAATGGACAAGAGCCACAGAAAGAATAGTCGGCCACCCAAAATAACAAAATATTCCAGTAAGTGACCAGCAAACCCAAGCAAATGTCACACAGTGCATTGGTGCTATTTGACCACATATTACTTGTTGCAAAAATTCTTATACTTGAATTATATGAATGGGATGATACAATACATAACCCCAATAGCTACATGACACATAGAACTATATAACTTTCTGGTTCTTTCTACATACTGAATTGGATCTTTATGAGTAACTTAGAAGTAGTTGAAATACCCTGCTTAATTTACCCAGTACTGGGGTTCTGCTCTGTTACTGTAAGTAGTGCATCCTGTATCATTCCACCCATACTGGGTTAAAGGTGAAGTATAATCATTCCATCAAGATAAGCTATTGTGTTAATCCCTAAAGATAAGCAAATTTACAATATACATGCATTCTGATTTTACTAGATAAATTACCCAGTTTTCTCTGCTGTCTCAGGCAGTGTCAGAAAGGCCTTCTTTGATTCCCAGTATTCTGGTGCCCAAACATCCAGTCCTCTGAGTACAGTCGCCCAAGGCAGTGGGCCAATGGCATCCACCCCCCACAGTTCATGTGAGCGTGATGGTGGGGGCACATTGCAATAAGTATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)