Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012073663 Xt7.1-TGas137e18.3 - 47 ESTs
                                                                       .........0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas137e18.3          AAAATGCCTGCTCGGGAGCTTTTTTCTTTTTTCCCAAGATGGCGTCTATGAGGGAGAGTGACACCGGCCTGTGGCTTCACAACAAGTTGGGCTCCGCTGACGAGCTGTGGGCGCCCCCGAGTATCGCCTCCTTGCTCACCGCCTCCGTCATAGACAACGTGCGGCTGTGTTTCCATAACTTGTCCTCCGCCGTCAAACTGAAGCTGCTGCTGGGGATCCTGCACCTCCCGCGGCGCACAGTGGATGAGATGAAAGGCGCACTGACAGAAATCATTCAGCTCGCCACTCTAGATTCTGACCCCTGGATCCTGATGGTCGCGGATATCCTAAAATCCTTCCCTGACACAGGATCCCTGAATCTCGATCTCGAGGAACAGAATCCGAATGTGCAGGACATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACCAAAAAAAAAAAAAAATCCAGATCCAACCGTGCTATCCACAGTAACTGACTGATAAGAAAAACACAGGTCATTGCTGACCAGGAGAAGGACATTTCCTTCAGCTGGATAAGGAACAGATGCCTTCCCAACCAGACTGATCTCTGCGTATTTCCCACAATTCATAGAGGACTTCTTAACGGTGATTGGCCAGTTTTGTATTAAAGAACAGAGT
                                                  Xt7.1-CHK-1008226036                CCTGCTCGGGAGCTTTTTTCTTTTTTCCCAAGATGGCGTCTATGAGGGAGAGTGACACCGGCCTGTGGCTTCACAACAAGTTGGGCTCCGCTGACGAGCTGTGGGCGCCCCCGAGTATCGCCTCCTTGCTCACCGCCTCCGTCATAGACAACGTGCGGCTGTGTTTCCATAACTTGTCCTCCGCCGTCAAACTGAAGCTGCTGCTGGGGATCCTGCACCTCCCGCGGCGCACAGTGGATGAGATGAAAGGCGCACTGACAGAAATCATTCAGCTCGCCACTCTAGATTCTGACCCCTGGATCCTGATGGTCGCGGATATCCTAAAATCCTTCCCTGACACAGGATCCCTGAATCTCGATCTCGAGGAACAGAATCCGAATGTGCAGGACATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACCAAAAAAAAAAAAAAATCCAGATCCAACCGTGCTATCCACAGTAACTGACTGATAAGAAAAACACAGGTCATTGCTGACCAGGAGAAGGACATTTCCTTCAGCTGGATAAGGAACAGATGCCTTCCCAACCAGACTGATCTCTGCGTATTTCCCACAATTCATAGAGGACTTCTTAACGGTGATTGGCCAGTTTTGTATTAAAGAACAGAGTTTTAAT
                                                      consensus depths               2     2     2     2     3     3     3     3     4     5     4     5     5     6     6     6     7     7     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    12    13    13    13    13    13    14    14    14    14    14    14    15    15    15    16    15    16    16    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    16    16    16    16    16    17    16    17    17    18    17    18    17    18    18    19    19    19    20    20    19    20    19    20    19    20    21    23    22    23    21    24    22    27    24    27    25    29    24    29    24    27    22    25    22    25    21    24    20    23    20    24    22    26    23    26    24    27    24    27    24    26    24    26    24    27    24    27    24    27    24    27    24    27    26    28    26    28    26    28    26    28    26    28    26    28    25    27    26    27    26    27    29    30    29    30    29    30    29    30    29    30    28    29    28    29    27    28    27    28    25    26    25    26    25    26    25    26    25    26    24    25    22    26    22    26    21    25    21    25    21    25    23    25    23    25    23    25    22    24    21    22    21    22    21    22    23    24    24    25    24    25    24    25    24    25    24    25    25    25    25    25    25    25    25    25    24    24    22    24    23    23    22    22     6     7     3     6     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     4     2     4
                                                                   SNP                                                                                                                                                                                                                                                                      ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------G
                                               BLH ATG      38     623          
                                               BLH MIN      32     192          
                                               BLH MPR      -4     192          
                                                                                                                      PREDICTED = Sp ==== 1e-055     XP_793990.1 PREDICTED: similar to Wolf-Hirschhorn syndrome candidate 2 homolog, partial [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                           PROTEIN === Xl ==== 0          AAH81231.1 MGC85474 protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                           PROTEIN === ?? ==== 0          NP_001087790.1 MGC85474 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                      PREDICTED = Dr ==== 0          XP_688132.1 PREDICTED: similar to Wolf-Hirschhorn syndrome candidate 2 (predicted) [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                      PROTEIN === Hs ==== 0          NP_005654.2 Wolf-Hirschhorn syndrome candidate 2 protein; WHSC2 protein [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                      PROTEIN === Mm ==== 0          NP_036044.1 Wolf-Hirschhorn syndrome candidate 2 homolog [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                            PROTEIN --- Gg ---- 0          NP_001026338.1 Wolf-Hirschhorn syndrome candidate 2 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas137e18.3                                                ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------TAA------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2       bld Brn3 5g3  in                         CAAK9859.5p TGACTTCATAAAATGCCTGCTCGGGAGCTTTTTTCTTTTTTCCCAAGATGGCGTCTATGAGGGAGAGTGACACCGGCCTGTGGCTTCACAACAAGTTGGGCTCCGCTGACGAGCTGTGGGCGCCCCCGAGTATCGCCTCCTTGCTCACCGCCTCCGTCATAGACAACGTGCGGCTGTGTTTCCATAACTTGTCCTCCGCCGTCAAACTGAAGCTGCTGCTGGGGATCCTGCACCTCCCGCGGCGCACAGTGGATGAGATGAAAGGCGCACTGACAGAAATCATTCAGCTCGCCACTCTAGATTCTGACCCCTGGATCCTGATGGTCGCGGATATCCTAAAATCCTTCCCTGACACAGGATCCCTGAATCTCGATCTCGAGGAACAGAATCCGAATGTGCAGGACATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCCGTGGTGGTCG
  5   1   2       bld AbdN 5g                            IMAGE:7005825          AAAATGCCTGCTCGGGAGCTTTTTTCTTTTTTCCCAAGATGGCGTCTATGAGGGAGAGTGACACCGGCCTGTGGCTTCACAACAAGTTGGGCTCCGCTGACGAGCTGTGGGCGCCCCCGAGTATCGCCTCCTTGCTCACCGCCTCCGTCATAGACAACGTGCGGCTGTGTTTCCATAACTTGTCCTCCGCCGTCAAACTGAAGCTGCTGCTGGGGATCCTGCACCTCCCGCGGCGCACAGTGGATGAGATGAAAGGTGCACTGACAGAAATCATTCAGCTCGCCACTCTAGATTCTGACCCCTGGATCCTGATGGTCGCGGATATCCTAAAATCCTTCCCTGACACAGGATCCCTGAATCTCGATCTCGAGGAACAGAATCCGAATGTGCAGGACATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCCAAGGAGAGAGGTGTAAAAGTTACTAGAACTTATCTGAAACTGGGACACGGTCCGGTGGGTGGTCCGGGGAAGGCCCAGAAAAAGAAAGGGAAGAACTGTTAGAAAACCCT
  3  -1   2       bld Gas       in                    TGas104l04.q1kT7                           TTTTTTTTTTTTTTTTCCCAGATGGCGTCTATGAGGGAGAGTGACACCGGCCTGTGGCTTCACAACAAGTTGGGCTCCGCTGACGAGCTGTGGGCGCCCCCGAGTATCGCCTCCTTGCTCACCGCCTCCGTCATAGACAACGTGCGGCTGTGTTTCCATAACTTGTCCTCCGCCGTCAAACTGAAGCTGCTGCTGGGGATCCTGCACCTCCCGCGGCGCACAGTGGATGAGATGAAAGGCGCACTGACAGAAATCATTCAGCTCGCCACTCTAGATTCTGACCCCTGGATCCTGATGGTCGCGGATATCCTAAAATCCTTCCCTGACACAGGATCCCTGAATCTCGATCTCGAGGAACAGAATCCGAATGTGCAGGACATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGC
  5   1   2       bld Tbd0 PIPE                          IMAGE:6981041                                                   GGCGTCTATGAGGGAGAGTGACACCGGCCTGTGGCTTCCAACAAGTTGGGCTCCGCTGACGAGCTGTGGGCGCCCCCGAGTATCGCCTCCTTGCTCACCGCCTCCGTCATAGACAACGTGCGGCTGTGTTTCCATAACTTGTCCTCCGCCGTCAAACTGAAGCTGCTGCTGGGGATCCTGCACCTCCCGCGGCGCACAGTGGATGAGATGAAAGGCGCACTGACAGAAATCATTCAGCTCGCCACTCTAGATTCTGACCCCTGGATCCTGATGGTCGCGGATATCCTAAAATCCTTCCCTGACACAGGATCCCTGAATCTCGATCTCGAGGAACAGAATCCGAATGTGCAGGACATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGACGCCCTTTGCGCAGGAGAGAGTGTAAGTTACTAGACTATN
  5   1   2       bld Gas                            TGas109m07.p1kSP6                                                     GTCTATGAGGGAGAGTGACACCGGCCTGTGGCTTCACAACAAGTTGGGCTCCGCTGACGAGCTGTGGGCGCCCCCGAGTATCGCCTCCTTGCTCACCGCCTCCGTCATAGACAACGTGCGGCTGTGTTTCCATAACTTGTCCTCCGCCGTCAAACTGAAGCTGCTGCTGGGGATCCTGCACCTCCCGCGGCGCACAGTGGATGAGATGAAAGGTGCACTGACAGAAATCATTCAGCTCGCCACTCTAGATTCTGACCCCTGGATCCTGATGGTCGCGGATATCCTAAAATCCTTCCCTGACACAGGATCCCTGAATCTCGATCTCGAGGAACAGAATCCGAATGTGCAGGACATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCT
  5   1   2       bld Gas7      in                         XZG37588.5p                                                                        ACCGGCCTGTGGCTTCACAACAAGTTGGGCTCCGCTGACGAGCTGTGGGCGCCCCCGAGTATCGCCTCCTTGCTCACCGCCTCCGTCATAGACAACGTGCGGCTGTGTTTCCATAACTTGTCCTCCGCCGTCAAACTGAAGCTGCTGCTGGGGATCCTGCACCTCCCGCGGCGCACAGTGGATGAGATGAAAGGTGCACTGACAGAAATCATTCAGCTCGCCACTCTAGATTCTGACCCCTGGATCCTGATGGTCGCGGATATCCTAAAATCCTTCCCTGACACAGGATCCCTGAATCTCGATCTCGAGGAACAGAATCCGAATGTGCAGGACATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTTACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGA
  3  -1   2       bld Int1      in                        CAAP12833.3p                                                                                                       CCGCTGACGAGCTGTGGGCGCCCCCGAGTATCGCCTCCTTGCTCACCGCCTCCGTCATAGACAACGTGCGGCTGTGTTTCCATAACTTGTCCTCCGCCGTCAAACTGAAGCTGCTGCTGGGGATCCTGCACCTCCCGCGGCGCACAGTGGATGAGATGAAAGGCGCACTGACAGAAATCATTCAGCTCGCCACTCTAGATTCTGACCCCTGGATCCTGATGGTCGCGGATATCCTAAAATCCTTCCCTGACACAGGATCCCTGAATCTCGATCTCGAGGAACAGAATCCGAATGTGCAGGACATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGT
  5   1   2       bld Lun1      in                         CABD6873.5p                                                                                                           TGACGAGCTGTGGGCGCCCCCGAGTATCGCCTCCTTGCTCACCGCCTCCGTCATAGACAACGTGCGGCTGTGTTTCCATAACTTGTCCTCCGCCGTCAAACTGAAGCTGCTGCTGGGGATCCTGCACCTCCCGCGGCGCACAGTGGATGAGATGAAAGGTGCACTGACAGAAATCATTCAGCTCGCCACTCTAGATTCTGACCCCTGGATCCTGATGGTCGCGGATATCCTAAAATCCTTCCCTGACACAGGATCCCTGAATCTCGATCTCGAGGAACAGAATCCGAATGTGCAGGACATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAG
  5   1   2       bld Te5       in                         CAAO5059.5p                                                                                                                  CTGTGGGCGCCCCCGAGTATCGCCTCCTTGCTCACCGCCTCCGTCATAGACAACGTGCGGCTGTGTTTCCATAACTTGTCCTCCGCCGTCAAACTGAAGCTGCTGCTGGGGATCCTGCACCTCCCGCGGCGCACAGTGGATGAGATGAAAGGCGCACTGACAGAAATCATTCAGCTCGCCACTCTAGATTCTGACCCCTGGATCCTGATGGTCGCGGATATCCTAAAATCCTTCCCTGACACAGGATCCCTGAATCTCGATCTCGAGGAACAGAATCCGAATGTGCAGGACATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAACCACCAAAGGAGGAGACTGTATTGGAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTG
  5   1   2       bld Gas       in                   TGas113g20.p1kSP6                                                                                                                                                                                                                TGAAGCTGCTGCTGGGGATCCTGCACCTCCCGCGGCGCACAGTGGATGAGATGAAAGGCGCACTGACAGAAATCATTCAGCTCGCCACTCTAGATTCTGACCCCTGGATCCTGATGGTCGCGGATATCCTAAAATCCTTCCCTGACACAGGATCCCTGAATCTCGATCTCGAGGAACAGAATCCGAATGTGCAGGACATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGATCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACA
  3  -1   2       bld Lun1      in                         CABD8293.3p                                                                                                                                                                                                                                                                                                                                                                                             GAACAGAATCCGAATGTGCAGGACATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAAACTCTGCTGCCACTCAGGCAGCAACC
  3  -1   2       bld Int1      in                         CAAP2912.3p                                                                                                                                                                                                                                                                                                                                                                                                GAAAGATCCGAATGTGCAGGAATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAAC
  5   1   2       bld Eye       in                         CCAX6773.b1                                                                                                                                                                                                                                                                                                                                                                                                    ATCCGAATGTGCAGGACATATTGGGGGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGA
  5   1   2       bld Te5       in                        CAAO10202.5p                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAAAGTCAGTGAATGTGAAGCATCTGCCATGCTGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGC
  5   1   2       bld Lun1      in                         CABD7881.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCCACTTGAATGCCAGTACCTCAACAAGAATGCCCTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGA
  5   1   2       bld Int1      in                        CAAP13083.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCGATTCAATTGGCACGAGGTGACCACCCTAGCTGGACCCCTCACGCCCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCANACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAG
  5   1   2       bld Int1      in                         CAAP7780.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCAGTGAAACATTTCCAGCTCAAAAGAAAACCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACGGCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGG
  5   1   2       bld Gas       in                   TGas137e18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAGGGGTTCCATTTCACTCAAAAGGACGAGGCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTC
  5   1   2       bld Te5       in                        CAAO10722.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTTGGTAAAAAAACTGGACACAACAACTCCTCTCAAAGGTATACCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCC
  5   1   2       bld Gas7      in                         XZG29179.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACGCGNTCCGCAAAGCAGGCACCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATC
  5   1   2       bld Te5       in                         CAAO7370.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCTTCAGGAGTCCAACCACACCAAGTGTATTTAGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCA
  3   1   2       chi Lun1      in                         CABD7881.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTCCGACCGCTAACAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCAGACGGTACAGGCAGCACTACTATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACC
  3   1   2      seed Gas       in                    TGas137e18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAACACCTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTG
  5  -1   2       bld Int1      in                        CAAP12833.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAACACTTATAGCGCCCTCCAGAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCAGACGGTACAGGCAGCACTACTATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCCCTCGTGCCGAA
  5  -1   2       bld Int1      in                         CAAP2912.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAACACCTATAGCGCCTCCAGAAACGCCCTTGCGCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCAGACGGTACAGGCAGCACTACTATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGT
  3   1   2       bld Egg                             TEgg041b16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAAGGAGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCCAAAGGAGGAGACTGTATTGGAAAACCCTACCTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGGGACCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ski1      in                         CABJ3281.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTATTTTTTGGTTTCAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACCAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas113g20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAGAGGTGTAAAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCAGACGGTACAGGCAGCACTACTATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGGGACCAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG37588.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGAGGTGTAAAGTTACTAGACATATCTGAGCTGAACACGTCCGGTGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCNTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACCAAAAAAAAAAAAAAAGG
  3   1   2       bld Ski1      in                         CABJ3281.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGTTACTAGACATATCTGAGCTGGACACGGTCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTTGAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACC
  5  -1   2       bld Lun1      in                         CABD8293.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGACATATTTGAGCTGGACACGTCCGGTGGTGGTCGGGAAGCGAAGAAGAGAAGGAAGACTGTAGAAGCAGAAGTTGTGAAAAAACCACCAAAGGAGGAGACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAACACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACC
  3   1   2       chi Brn3 5g3  in                         CAAK9859.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGTTCATCATTAGATTAGAAAGCCCAGATCACAGCATGGCCTGGTAAAATCAATCAGACGATATGCCCAAAATCAGCCAAACTGCTCAACCATGTCTGGGATGCACTGTCAGCTTACTGAACCACATAGTAACTCCCACTAATGTCTGACTGGGGACCCTTAGGCCCACTGTAGGACCTGATGTCAAGGACCACTGCTTCCTCTGACAATAACATCCCTCACCCACCTCTGTCCTGATGACATCCCACTCCCCTTATCAAGCCTAGCACATCCCACCTACACAACACCCACCAACCTCTTTGATGACAACAACCTCTCCTCTACTGCAATGACATCTGATTAATTTACCCCTTGCCTCAGCAACCTTACCAGTATCCTGCCCAGTCCAACCCTCACTGCCGCTGCCGACTACGCACACTTTTACTCATGTACAGGAAACAGTTCAGCTTGCCCCCAAGGCAGGAGTGATGAGATGCAGTTGCTAAGAATTTCATATACCTGTGGCCTAGCTATACCTATGGCCGGTGGCCACATACAGCCCAATTAGTCAGGACCCCACTATATACAACCGATTTTCTGCAGAAAATAGCTGAATTATTTTTTTTTCTTTGTTTTGCCTTTGCAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCAGACGGTACAGGCAGCACTACTATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACC
  3   1   2       bld Te5       in                        CAAO10202.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAGGAGGAGACTGTATTGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCAGACGGTACAGGCAGCACTACTATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACC
  3   1   2       bld Te5       in                         CAAO5059.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTGTATTGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACC
  3   1   2       bld Gas7      in                         XZG29179.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGTATGGAAAACCCTACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACC
  3   1   2       bld Lun1      in                         CABD6873.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTCCAGACTATGCTGCTGGCCTTGTCTCTACACAGAAACTGGGTGCCTTGAACAATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGGGACCAAAAGCCTCTCGCCCTATAG
  3   1   2       bld Eye       in                         CCAX6773.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATGAGAGTGCACTTCCATCTACAAGCTATTTGCCAGCAACTCCCAGCGTGGTGCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACC
  3   1   2       bld Int1      in                        CAAP13083.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCATCCTCCTCCTATATTCCAACGTCTGAAGCACAGCAAGCCGGACCAGTACGGGAAGCCTTGCAAGCAACAAGGCAGCCAGAGGAGCCCACAGCAGCCAACACTACTCTTCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCAGACGGTACAGGCAGCACTACTATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACCAAAAAAAAAAAAAAATCCAGATCCAACCGTGCTATCCACAGTAACTGACTGATAAGAAAAACACAGGTCATTGCTGACCAGGAGAAGGACATTTCCTTCAGCTGGATAAGGAACAGATGCCTTCCCAACCAGACTGATCTCTGCGTATTTCCCACAATTCATAGAGGACTTCTTAACGGTGATTGGCCAGTTTTGTATTAAAGAACCAGAGTTTT
  3   1   2       bld Int1      in                         CAAP7780.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCAACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACCAAAAAAAAAAAAAAAAATCCAGATCCAACCGTGCTATCCACAGTAACTGACTGATAAGAAAAACACAGGTCATTGCTGACCAGGAGAAGGACATTTCCTTCAGCTGGATAAGGAACAGATGCCTTCCCACACCAGACTGATCGCTGCGTATTTCCCACAATTCATAGAGGACTTCTTAACGGTGATGGCCAGTTTGTC
  3   1   2       bld Te5       in                        CAAO10722.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCAGACGGTACAGGCAGCACTACTATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACCAAAAAAAAAAAAAAATCCAGATCCAACCGTGCTATCCACAGTAACTGACTGATAAGAAAAACACAGGTCATTGCTGACCAGGAGAAGGACATTTCCTTCAGCTGGATAAGGAACAGATGCCTTCCCAACCAGACTGATCTCTGCGTATTTCCCACAATTCATAGAGGACTTCTTAACGGTGATTGGCCAGTTTTGTATTAAAGAACAGAGTTTTAATGTTG
  3   1   2       bld Te5       in                         CAAO7370.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAGTTTAAACAAAGGACGCCAATGTACCATAGCAATCCAAATGCTGCCACCACTACCCCTTCTCCTGCAGCGACCCCTACCTCTCCATTAACTCCTGCTGCCACTCAGGCAGCAACCCCAGCGGCACAGGCTCCCCAGATAACCACTCAAACGCAGCCGCAACCCAAGAAGAACCTTTCTCTCACGAGGGAGCAGATGTACGCCGCACAGGAGATGTTCAAGACGGCAAACAAAGTCACAAGGCCAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCAGACGGTACAGGCAGCACTACTATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACCAAAAAAAAAAAAAAATCCAGATCCAACCGTGCTATCCACAGTAACTGACTGATAAGAAAAACACAGGTCATTGCTGACCAGGAGAAGGACATTTCCTTCAGCTGGATAAGGAACAGATGCCTTCCCAACCAGACTGATCTCTGCGTATTTCCCACAATTCATAGAGGACTTCTTAACGGTGATTGGCCAGTTTTGTATTAAAGAACAGAGTTTTAATGTTG
  3   1   2       bld Te3       in                         CAAM2512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTCTGGCCTTGTGACTTTGTTTGCCGTCTTGAACATCTCCTGTGCGGCGTACATCTGCTCCCTCGTGAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACCAAAAAAAGGAAAAAAA
  5   1   2       bld Te3       in                         CAAM2512.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTCTGGCCTCGTGACTTTGTTTGCCGTCTTGAACATCTCCTGTGCGGCGTACATCTGCTCCCTCGTGAGAGAAGGCTCTTATTCTTGGCTTTATGGCTGGATCCAGAGAGAATCCTTGCCCAGAACAAGGTGATATCATTCAAATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACCAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg072d03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGATCAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTGGTAAGGAATTCCCAGAATTCTCCTGGGACCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg072d03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAACTCAGCGAATACACAGAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCGACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACC
  5   1   2       bld Egg                            TEgg091b05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACACACAGCAATTGCCAAAGGCGGACGGTACAGGCAGCACTACCATGTTAGTCCACACAGTGTTTGAAATGAACTATTCTACTGGCCAGTGGACCAAGCTCAAGAAGTACAAGCCAATAACCAATGTCTCTTAAGGAATTCCCAGAATTCTCCTGTGGACC
  5  -1   2       bld Gas       in                   TGas104l04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTGTTTGAAATGAATTATTTTACTGGCCAGTGGCCCAAGCTCAAGAAGTCCAAGCCAATACCCAATGTCTTTTAAGGAACCCCCAGAATTCTCCTGTGCCCCAAAAAAAAAAAAAAAAATCCAGATCCCACCGTCCCCCCCCCAGTAATTGATTGATAAGAAAAACACAGGTCATTGCTGCCCAGGAGAAGCACATCTCCTTCAGCTGGATAAGGAACAGACGCCTTCCCACCCAGACTGATCGCTGGGTATTTCCCACAATTCATAGAGGACTTTTTAACGGTGATGCGCCCGCTTTGTATTAAAGAACAGAGTTTTAAAAAAAAAAAAAAACC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)