Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012073706 Xt7.1-TNeu118d19.3 - 54 ESTs
                                                                       ....-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu118d19.3                                                       ACTGTTCAAGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTACAGAAAAAAAA
                                                  Xt7.1-CHK-1008225387                                                             CAAGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTACAGAAAAAAAAAAAAAA
                                                      consensus depths                                                            9     9    13    14    16    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    18    18    18    18    18    18    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    20    20    20    20    20    21    21    21    21    21    21    21    21    21    20    20    21    21    22    22    22    22    22    23    22    23    22    24    25    27    25    27    26    28    30    32    32    34    32    34    33    35    33    35    31    34    31    34    32    35    32    35    32    35    32    35    31    35    31    35    30    34    29    33    33    37    32    36    32    36    30    34    29    33    29    33    29    33    29    32    28    32    29    32    30    33    28    33    30    33    31    33    33    34    32    34    32    33    30    33    32    33    31    33    31    33    31    34    30    33    31    33    32    33    30    32    30    32    28    32    30    32    30    32    29    32    30    32    31    32    31    32    30    32    31    32    31    32    30    31    30    31    31    31    29    30    29    30    28    29    28    28    28    28    28    28    27    28    28    28    22    23    18    19    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17     4     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----------T
                                               BLH ATG      36    1862                                                       
                                               BLH MIN      36     213                                                       
                                               BLH OVR      36      66                                                       
                                               EST CLI     -12      24                                                       
                                               ORF LNG      36       3                                                       
                                                                                      PROTEIN --- Ce ---- 4e-057     NP_501822.1 C. elegans WNT family CWN-2 (40.4 kD) (cwn-2) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PROTEIN --- Dm ---- 3e-058     NP_476810.1 Wnt oncogene analog 2 CG1916-PA [Drosophila melanogaster] -------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 9e-062     AAD52655.1 Wnt-5 protein precursor [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN --- Sp ---- 1e-092     NP_999832.1 Wnt8 protein [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                              PROTEIN --- Bf ---- 8e-112     AAF80559.1 Wnt8 [Branchiostoma floridae] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                              PROTEIN --- Bb ---- 2e-112     AAF19840.1 secreted protein Wnt8 [Branchiostoma belcheri] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN --- Mm ---- 4e-151     NP_035850.1 wingless related MMTV integration site 8b [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN -== Hs ==== 4e-158     NP_490645.1 wingless-type MMTV integration site family, member 8A isoform 2 precursor; WNT8dprecursor [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN === Dr ==== 7e-166     NP_571021.1 wnt8 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN === Gg ==== 1e-173     NP_990862.1 Wnt-8C [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN === Xl ==== 0          CAA40510.1 Xwnt-8 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN === ?? ==== 0          NP_001081637.1 Wnt-1/int-1-related [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN === Xt ==== 0          CAJ82989.1 wingless-type MMTV integration site family, member 8B [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu118d19.3                                                                                           ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------TGA---------ATG---ATG---------------------------------------------------------ATG---TAA------------------------------------------TAA------------ATG------TGA------ATG---------------------------------ATG---------TGA---ATG------------TAA---------------------------------TAA---ATG---------------------------------ATG
                                                                   ORF                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  0   1   1           Neu  FL                     TNeu118d19.FL-Sanger                                                           TTCAAGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATAAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTACGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTCATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTACAGAAAAAAAAAAAAAAAAAA
  5   1   2       chi Gas7 5g3  in                         XZG46480.5p                                        CCACGCTTCCGGGATACTGTTCACGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAAGAGCTGCAGAAAGCTCTGTACAGACTGCGGCCTC
  5   1   2   14  bld Neu5 5g3  in                         ANHP1192.5p ..........................................CGGGGGGAGGATACTGTTCAAGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGT
  5   1   2   12  bld Gas7 5g3  in                         XZG58486.5p .............................................GCTGAGGATACTGTTCAAGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCTGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTG
  5   1   2       bld Gas  5g                        TGas015m15.p1kSP6                                               CTGAGGATACTGTTCAAGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGA
  5   1   2   12  bld Gas7 5g3  in                         XZG60063.5p ................................................GAGGATACTGTTCAAGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGA
  5   1   2   22  bld Gas7 5g                              XZG20256.5p ..................................................GGATACTGTTCAAGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTNAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCTGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGAT
  5   1   2   12  bld Gas7 5g3  in                         XZG26784.5p ..................................................GGATACTGTTCAAGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCTGTGGCTGGGTCTGAACTGATTTTCCTGAAGACTCTCCTGATTATTGCTTAAAAATGTCA
  5   1   2   12  bld Gas7 5g3  in                         XZG49734.5p ....................................................ATACTGTTCAAGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACA
  5   1   2   12  bld Gas7 5g3  in                         XZG58896.5p ....................................................ATACTGTTCAAGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGGTACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGT
  5   1   2   12  bld Gas7 5g3  in                         XZG46379.5p .........................................................GTTCAAGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCTGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGNATATTGCTTAAAAATGTCAGTTTGGGTCTGCAGNGCAC
  5   1   2       bld Neu  FL   in                   TNeu118d19.p1cSP6                                                           TTCAAGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAAGGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTA
  5   1   2       bld Neu  5g3  in                   TNeu118d20.p1cSP6                                                           TTCAAGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAAAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCACAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTG
  5   1   2   12  bld Gas7 5g3  in                          XZG4248.5p ..............................................................AGCATTACCCTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCTGTGG
  5   1   2   12  bld Gas7 5g3  in                          XZG6176.5p ...............................................................AGCATTACCCTGGAAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGT
  5   1   2       chi Gas7 PIPE in                         XZG39069.5p                                                                        CTGGATAGCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGTCTTACATTCCTGTCTTAGGAGCATAATTTGCGACCAAAGCAAGTCTGCAGCAGGCACCTACAGCCAACAGGGCTATAAACCCAGCAACCCAAGCAAGCTTGTCAGATAAAGGCTAATTGATTCTGCCATGTGGCTACTTCTGGCCCTAAGTGCAGATCTTGATGACAGGGCTCCTGGTTTTTGACTAGAAAGAGGTAGACTGTTCCATTAAAGCAGAGGCAGTGAAAGAGACGATG
  5   1   2   12  bld Gas7 5g3  in                         XZG61703.5p ..............................................................................GCAGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCTGTGGCTGGGTCTGAACTGATTT
  5   1   2   12  bld Gas7 5g3  in                         XZG34436.5p ................................................................................AGTCTCCATCATGAAGAACACCACTTTGTTTGTCCTTTCAACTCTTCTCATATTCTGCCCATTTTTCACTGCATCAGCATGGTCAGTCAATAACTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGNATATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAAGGGGCGAGAGTGCCTG
  5   1   2       bld Gas                            TGas040f14.p1kSP6                                                                                                                                                                              CTTTCTGATGACAGGACCCAAGGCATATCTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTG
  5   1   2       bld Gas7      in                         XZG62317.5p                                                                                                                                                                                                          CTGACATACTCTGCCAGTGTCGCTGTGGGTGCACAGAGTGGAATAGAGGAATGTAAGTTCCAGTTTGCATGGGAAAGGTGGAATTGCCCAGAAAGTACCCTTCAACTTGCCACCCACAATGGACTTCGCAGTGCAACCAGAGAGACCTCCTTTGTACATGCCATTAGTTCAGCAGGAGTGATGTACACCCTGACGAGAAACTGCAGCATGGGGGACTTTGATAACTGCGGATGTGATGACTCCAGAAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAAC
  5   1   2       bld Gas                            TGas029f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAATGGCCGCATTGGTGGCAGAGGCTGGGTGTGGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCT
  5   1   2       bld Gas7      in                         XZG62037.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCACGCGTCCGGGCGGCTGCAGTGATAATGCAGAATTTGGAGAGCGGATCTCTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCTGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGA
  5   1   2       bld Gas7      in                         XZG41207.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTAAACTATTCGTTGATGGCTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCTGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATTATGATGGTGATCCATACTGT
  5   1   2       bld Gas                            TGas056g21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTGGAGACGGGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAAGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAAGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAAGTAGTCATCAAGCATTACTGCTCCAGAAAGGAAAGGGATTCTAATAACATGTTCAATACAAAG
  3   1   2       bld Gas7 5g3  in                         XZG61703.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGACAAGATGCCAGAGCCCTAATGAACTTGCATAACAATGAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAGAGGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCTGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTTGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATT
  3   1   2       bld Gas7      in                         XZG41207.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCATAACATGAAAGCAGGAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTCCGGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCTGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTTGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTAC
  3   1   2      seed Neu  FL   in                    TNeu118d19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGACTTGCAGTGAAAGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATAAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTACGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTCATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTACAGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7                                  XZG9242.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTANAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCA
  5   1   2       bld Gas7      in                         XZG41007.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGACGATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCCTTTGATTAAAAATATATTAATTA
  5   1   2       bld Gas7      in                         XZG44638.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGAAGAGGACGTGCAAGTGCCATGGAATATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCTGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTANAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGNTGGCAGNTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCC
  5   1   2       bld Gas                            TGas005h04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGTGCCATGGAATATCTGNGAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACT
  5   1   2       bld Gas7                                  XZG7923.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATCTGGAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCTGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTTGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATNTAAAATATATTAATTACATTAATCTTGTCCCCCT
  3   1   2       bld Gas7 5g3  in                          XZG6176.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAAAAAAAAAAT
  3   1   2       bld Neu  5g3  in                    TNeu118d20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACNTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATAAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTACGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTCATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 PIPE in                         XZG39069.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATT
  3   1   2       bld Gas7                                 XZG26958.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTAC
  3   1   2       bld Gas7      in                         XZG41007.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAAAAAAAAAAAAAAAGG
  3   1   2       bld Neu5 5g3  in                         ANHP1192.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAGTTTCCGGGACATTGGCAATCACCTGAAGATCAAGCACGACCAGGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTATTTCC
  3   1   2       bld Gas7 5g3  in                         XZG46379.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAGCACTAAAACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCTGTGGCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTTGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTT
  3   1   2       bld Gas                            TGas122f08.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACTAGAGATGGACAAGAGGAAAATGAGGTCTGGTAACAGCGCAGATAACAGAGGAGCAATCGCCGACGTCTTCAGTTCAGTGGCTGGGTTTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATTTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTTTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGGTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTTTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCCCCACCGGAGATGACGACATTTCATGAAAATGTTTAAATGTTTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTTTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTTTGTGCTCAGTTTGTATCATCAAAAGGATTTAATAAACATATTTTTCCGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                         XZG46480.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGTTGCAGTGTGCAGACTTGCTGGCTCCAGCTGGCAGAGTTCCGGGACATTGGCAATCACCTGAAGATTTTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTTTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACTTTTTTCAGTGGGAAAGAAGGAGCTGCAGAAGGTTTTGTACAGATTGGGGCCTCAGAGTGGAAGAGAGAAAGACCGAGTTCTTCAGTAGCTGCAACTGCAAATTCCACTGGTGTTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCTTCAAGCATTATTGTTCCAGAAGGGAAAGGGATTTTAATAACATGTTCAATCCAAAGGGGAGGAACGGGGGCCCCCCCCGGAGATGACGCCATTTCATGAAAATGTTTAAATTTTTGTTTAGGGAAGGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTAGGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGAGGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATAGGGTTTCATTTGATTAAAAATATTTTAATTCCCCC
  3   1   2       bld Gas7      in                         XZG44638.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTTGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTACAG
  3   1   2       bld Gas7 5g3  in                         XZG58486.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTTGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTCCGG
  3   1   2       bld Gas7      in                         XZG62317.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTCTGAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCCCCCCCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGAGATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTCCGG
  3   1   2       bld Gas7      in                         XZG62037.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTCTGAACTGATTTCCCTGAAGACTCTCCTGATTATTGCTAAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTTGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTACGGAAAAAAAAAAAAAAACC
  3   1   2       bld Gas7 5g3  in                         XZG34436.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTACAGAAACC
  3   1   2       bld Gas7 5g3  in                         XZG49734.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTACAG
  3   1   2       bld Gas7 5g3  in                          XZG4248.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAACTGATTTTCCTTGAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTTGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTCCGGGG
  3   1   2       bld Gas7 5g3  in                         XZG58896.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGACTCTCCTGATTATTGCTTAAAAAATGTCAGTTTGGGTCTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCCCCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTCCGG
  3   1   2       add Gas7 5g3  in                         XZG60063.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCGGGGCCTTTGGCATTCCCTTGAAGTTCAAGCCGGCCCAAGCCTTAAAATTGGGGTTGGCCAAGGGGAAAATGGGTTTTGGTAACAGCCCAAATAACAGGGGAGCTGCAGAAGGTTTTTTACAGATTGGGGCTTCAGAGTGGAAGAGAAAAAGCCCGAGTTCTTCGGTGGCGGCAACTGCAATTTCCCCGGGTGTTGCCTTTTCAAATGGGAGCGGTGCAAGCGGGTGGTCTTCAAGCTTTTTTGTTCCAGAGGGGAAAGGGTTTTTAATACCTTTTTCAATCCAAGGGGGAGGACCGGGGGCCCCCCCCGGGGAGGGGGCCTTTTCAGGAAAATTTTTAAATTTTTTTTTAGGAAAGGGGTTTGGGGGTTTTCAGTTTTGCTTCCTTTTTTTAGGGACTAAAGTAACGTCTTTAAAAGTTTAAGC
  3   1   2       bld Gas7 5g3  in                         XZG26784.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCAGGGCACAGAGGGGCGAGAGTGCCTGCAGAGCGGCAAGAACCTATCTCAGTGGGAAAGAAGGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAATGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTTGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTACAG
  5   1   2       bld Neu                            TNeu036k16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGAAGAGCTGCAGAAGGCTCTGTACAGACTGCGGCCTCAGAGTGGAAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTACNG
  5  -1   2       bld Gas                            TGas023f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGAGAGAAAGACCGAGATCATCAGTAGCTGCAACTGCAAATTCCACTGGTGCTGCACTGTCAAATGCGAGCAGTGCAAGCAGGTAGTCATCAAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTACAAAAAAAAAAAAAAAAAAGCGG
  3   1   2       bld Gas7      in                         XZG30731.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCACGCGTCCGAGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTACAG
  5   1   2       bld Gas7      in                         XZG30731.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCATTACTGCTCCAGAAGGGAAAGGGATTCTAATAACATGTTCAATACAAAGAGGAAGAACAGAGGCCACCACCGGAGATGACGACATTTCATGAAAATGTCTAAATGTCTGTTTAGCGAATGGGTTTGTGTGTATTCAGTATTGCATCCTTTATTTATGGACTAAAGTAACGTCATTAAAAGTATAAGCTATAAAGGCAGTCTGTTGTAAATATATAAATATATGCACTTATGAATATTGATGGTGATCCATACTGTCGGCAGTTGGAAGATTTGTATGAGTATTCCATGAAATATGGTTTCATTTGATTAAAAATATATTAATTACATTAATCTTGTCCCCCTTTAATTCATGTTTGGTTTGTTCATAGATATTGGGATATACGCAATGTGCATTTTTATTTTCTGTGCTCAGTTTGTATCATCATTAGTATTTAATAAACATATTTTTACAGAAAAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)