Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-CAAO2362.5.5                         40 END     1           1        2                MGC81703 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012073823 Xt7.1-CABJ2364.5.5 - 85 ESTs
                                                                       ..-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABJ2364.5.5                                                                                                       CGGTGTCTCACGATAACGTGCAACTATCGCGGCCTAGCTGGGCAGGAGAAGCCTCGGGCTGGAATAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTCATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGAAGAGACACTGAATTACAAGTTAAGCAATAAAAAGTAACAATTATAATAACATTTTAGTTACGTTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGAAGGCAAATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGAATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGAAGAGACACTGAATTACAAGTTAAGCAATAAAAAGTAACAATTATAATAACATTTTAGTTACGTTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGAAGGCAAATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGAATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAGTTTGTGTGTTTATTACTGTAAAACATGTATTTTAGTATGCTGCCTTTACATGATTCCCTTCCAAAACAGCAATGTTATTAAAAAAAAAAGGTTTATTAATTTCACTCAAAAGCCCCCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAA
                                                  Xt7.1-CHK-1008223716                                                                                                             CTCACGATAACGTGCAACTATCGCGGCCTAGCTGGGCAGGAGAAGCCTCGGGCTGGAATAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAxxxxxCATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGAAGAGACACTGAATTACAAGTTAAGCAATAAAAAGTAACAATTATAATAACATTTTAGTTACGTTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGAAGGCAAATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGAATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACxxxxAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTxAxAxTATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGAAGAGACACTGAATTACAAGTTAAGCAATAAAAAGTAACAATTATAATAACATTTTAGTTACGTTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGAAGGCAAATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGAATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGxxxxTxTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAGTTTGTGTGTTTATTACTGTAAAACATGTATTTTAGTATGCTGCCTTTACATGATTCCCTTCCAAAACAGCAATGTTATTAAAAAAAAAAGGTTTATTAATTTGACTCAAAAGCCCCCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATT
                                                      consensus depths                                                                                                            2     2     3     3     3     4     4     6     6     8     6    11    13    16    15    18    17    20    17    22    23    25    25    27    25    27    26    28    26    28    26    28    26    28    26    29    26    29    26    29    27    30    27    30    27    30    28    31    28    31    28    31    31    33    31    33    31    34    32    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    33    33    32    32    31    31    31    31    31    31    31    31    31    32    30    31    30    30    30    30    31    31    31    31    31    31    30    30    29    29    27    28    26    27    26    27    26    27    26    27    26    28    26    28    26    28    27    29    24    29    25    28    26    29    26    29    18    21    16    20    17    20    17    20    16    19    16    18    16    18    14    17    15    20    14    18    16    19    16    19    15    19    15    18    16    18    17    19    17    19    18    19    19    20    19    20    19    20    18    19    18    19    18    19    17    19    18    20    19    20    17    19    19    20    20    21    18    21    19    21    19    21    19    22    19    21    18    22    18    22    18    22    17    22    17    22    18    22    18    22    18    22    18    22    18    22    17    22    18    22    18    22    17    21    17    21    17    21    16    21    19    21    18    21    18    21    16    22    18    22    13    22    14    26    13    26    13    24    12    26    12    25    12    24    11    24    12    25    10    23    10    23     9    19     9    16     9    12     9    12     9    12     9    11     9    11     9    11     9    11     9    11     9    11     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7     9     7     9     7    10     7    10     4    10     4    10     4    10     4    10     4    10     4    10     4     9     4    10     4    10     4    10     4    10     4    10     4    10     4    10     4    10     4    10     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     3     7     3     7     3     7     3     7     3     7     2     7     2     7     2     5     2     5     2     5     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     3     4     3     4     4     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     3     4     3     5     3     6     5     7     5     8     7     8     7     9     8    10    10    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11     9     9     9     9     5     5
  5   1   2  SIG                                      Xt7.1-CABJ2364.5                                                                                                       CGGTGTCTCACGATAACGTGCAACTATCGCGGCCTAGCTGGGCAGGAGAAGCCTCGGGCTGGAATAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTTATTTTCAAGAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAA------------------------AAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGAAGAGACACTGAATTACAAGTTAAGCAATAAAAAGTAACAATTATAATAACATTTTAGTTACGTTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGAAGGCAAATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGAATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAGTTTGTGTGTTTATTACTGTAAAACATGTATTTTAGTATGCTGCCTTTACATGATTCCCTTCCAAAACAGCAATGTTATTAAAAAAAAAAGGTTTATTAATTTCACTCAAAAGCCCCCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAA
  5   1   2  SIG                                      Xt7.1-CABI4486.3                                                                                                                                                              CTCGGGCTGGAAAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTGACCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAANCAACAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGAAGAGACACTGAATTACAAGTTAAGCAATAAAAAGTAACAATTATAATAACATTTTAGTTACGTTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGAAGGCAAATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGAATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTTTGGAATGTACATATTTTGTGACATTTTTTACCAGTGTAAATAAATTTTATTTTTCAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABC8084.5                                                                                                                                                                                         AGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGGCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACTCAGCCCAAGCTCCAGACATTGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTAACTGCTGGTTAAGCTTGAAAAGTGTATCCTTTATGTTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGAAGAGACACTGAATTACAAGTTAAGCAATAAAAAGTAACAATTATAATAACATTTTAGTCACATTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGACAAATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGAATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTCAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TTpA020p14.5                                                                                                                                                                                                                        TTCAGAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAAGATAAAAAAAAAAAAAAAAAAAAATAAAAAAAATAAAAAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATTTTTCAAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGAATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACT
                                                                   SNP                                                                                                                                                                                                                   C-----------
                                                                   SNP                                                                                                                                                                                                                               --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                           -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                       --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------GT-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------AA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           G-----------
                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 2e-025     NP_726148.1 CG30327-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                         PREDICTED - Sp ---- 1e-097     XP_783188.2 PREDICTED: similar to RNA-binding region (RNP1, RRM) containing 3 [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PREDICTED - Dr ---- 6e-134     NP_001035019.1 hypothetical protein LOC565672 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                      PREDICTED - Mm ---- 1e-153     NP_080319.2 RIKEN cDNA 2810441O16 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                      PROTEIN --- Hs ---- 4e-154     NP_060089.1 similar to mouse 2810441O16Rik protein [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 4e-162     XP_422302.2 PREDICTED: similar to KIAA1839 protein [Gallus gallus] -------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                          PROTEIN --- Xt ---- 0          CAL49356.1 RNA-binding region (RNP1, RRM) containing 3 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABJ2364.5.5                                                                                                                                                                         ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------TAG---------TAA------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------TAA---------------TGA---------------------------------------TAA------TAATAA------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------ATG---------------------TAG------------------------------------TAA------------------------------------TAA---------------------------------------------------------ATG------------------ATG---------------------------ATG---------------ATG------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------TAG---------------------------TAA---TGA------------------------------------------TAG---TAA---------------------------ATG------------ATG---------------------------------------------------------ATG------------------------------------------------------------TAA---------------TGA---------------------------------------TAA------TAATAA------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------ATG---------------------TAG------------------------------------------------------------TAA---------------------------------TAA---ATG---------ATG---------------------------------------TAA---------------TAA---------------------------------------TAG---TAG------------TAGATGATG------------------------------------------------------------------------ATG------------------------------TGA------------------------------------------------------TAA------------TGA---------TAG---------------TAG---------TAA---------TAA---------TAAATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------TGA---------TAG---------------------ATG---------------------------------------TGA------------------------------------------------------------------------------------TGA------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2  SIG                                      Xt7.1-CABJ2364.5                                                                                                       CGGTGTCTCACGATAACGTGCAACTATCGCGGCCTAGCTGGGCAGGAGAAGCCTCGGGCTGGAATAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTTATTTTCAAGAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAA------------------------AAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGAAGAGACACTGAATTACAAGTTAAGCAATAAAAAGTAACAATTATAATAACATTTTAGTTACGTTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGAAGGCAAATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGAATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAGTTTGTGTGTTTATTACTGTAAAACATGTATTTTAGTATGCTGCCTTTACATGATTCCCTTCCAAAACAGCAATGTTATTAAAAAAAAAAGGTTTATTAATTTCACTCAAAAGCCCCCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAA
                                                  Xt7.1-CHK-1008281484                                                                                                             CTCACGATAACGTGCAACTATCGCGGCCTAGCTGGGCAGGAGAAGCCTCGGGCTGGAATAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTxxTTTTCAAGAAAAAxxTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAA------------------------AAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGAAGAGACACTGAATTACAAGTTAAGCAATAAAAAGTAACAATTATAATAACATTTTAGTTACGTTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGAAGGCAAATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGAATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGxxxxTxTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAGTTTGTGTGTTTATTACTGTAAAACATGTATTTTAGTATGCTGCCTTTACATGATTCCCTTCCAAAACAGCAATGTTATTAAAAAAAAAAGGTTTATTAATTTGACTCAAAAGCCCCCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATT
  5   1   2       add Gas  FLq  in                   TGas117e07.p1kSP6                             CAAGCAGTAACCGGAGGCCCACGATGGCAGTGTCCGCCCGAAGCAGCTATCGCCCGGCTACGGACAAACTCTCGCGGTGTCTCACGATAACGTGCAACTATCGCGGCCTAGCTGGGCAGGAGAAGCCTCGGGCTGGAATAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGGCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTC
  5   1   2       ext Gas7 PIPE                             XZG9193.5p                                                                                           GGACAACTCTCGCGGTGTCTCACGATAACGTGCAACTATCGCGGCCTAGCTGGGCAGGAGAAGCCTCGGGCTGGAATAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACCTTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGANAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGANATAGNCACTTTGCTGCCCTAGAGAAAAAATCANAAGAAGCAAAGC
  5   1   2       ext Brn3      in                         CAAK1547.5p                                                                                                                 CGATAACGTGCAACTATCGCGGCCTAGCTGGGCAGGAGAAGCCTCGGGCTGGAATAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGGCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCNTAGAGAAAAAATCAAAAGAAGCAAAGCCAGC
  5   1   2       add Neu       in                  TNeu067g06.p1caSP6                                                                                                                            CCGGGGATCGCGGCCTACTGGGCAGGAGAAGCCTCGGGCTGGAATAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCGGGGGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCGGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAGTAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTGTCCTCCACCAAGCAGCACTATTCTGGCAAATAT
  5   1   2       ext BrSp      in                     EC2BBA19DG07.g1                                                                                                                                 GGGGCGGCCTAGCTGGGCAGGAGAAGCCTCGGGCTGGAATAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACCTTCCTTCAGAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCC
  5   1   3        nb Neu                            TNeu003m06.p1kSP6                                                                                                                                    CGGCCTAGCTGGGCAGGAGAAGCCTCGGGCTGGGATAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGATCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTT
  5   1   2       ext Neu       in                   TNeu072p13.p1cSP6                                                                                                                                            CTGGGCAGGAGAAGCCTCGGGCTGGAATAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCATAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAAGTGTTGCATTTAATGAATAAACTGAATTACCAGCTCCTTTTGGACCACTAACAGCTC
  5   1   3        nb Neu       in                   TNeu123g02.p1cSP6                                                                                                                                            CTGGGCAGGAGAAGCCTCGGGCTGGAATAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCATAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCGAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGA
  5   1   2       ext Gas       in                   TGas139o10.p1kSP6                                                                                                                                                        AAGCCTCGGGCTGGAATATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGC
  5   1   3        nb Neu                            TNeu003e09.p1kSP6                                                                                                                                                           CTCGGGCCTGGATAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATNTAGCACTACCTATGCCATACCCACCTGTGCCA
  5   1   3        nb Egg                            TEgg080k04.p1kSP6                                                                                                                                                                             CTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACCTTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATG
  5   1   2       ext Liv1      in                         CAAR2440.5p                                                                                                                                                                             CTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGGCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCAC
  5   1   2       ext Gas7      in                         XZG54383.5p                                                                                                                                                                             CTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACCTTCCTTCAGAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGNGAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTTAAAGATTATATTACTGTGCCTGCTGTGCCTC
  5   1   2       add Neu       in                   TNeu109a13.p1cSP6                                                                                                                                                                              TGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGGCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCA
  5   1   4      seed Mus1      in                          CABH914.5p                                                                                                                                                                                   CGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGGCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATG
  3   1   3        nb Ski1      in                         CABJ2364.3p                                                                                                                                                                                               AGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGGCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACG
  5   1   3        nb Ski1      in                         CABJ2364.5p                                                                                                                                                                                               AGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGGCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGANATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAANAAAAAAAAAAAAAA
  3   1   3        nb Sto1      in                          CABG401.3p                                                                                                                                                                                                                  CATTCCTTCAGAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACG
  5   1   3        nb Sto1      in                          CABG401.5p                                                                                                                                                                                                                  CATTCCTTCAGAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAAAAAAAAAAAAA
  5   1   2       ext Int1      in                        CAAP12072.5p                                                                                                                                                                                                                       CTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGGCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACAAAAAAAG
  3   1   2       ext Neu       in                    TNeu072p13.q1kT7                                                                                                                                                                                                                            GAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAAAGAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATNGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAAAAAAA
  3   1   2       ext BrSp      in                     EC2BBA19DG07.b1                                                                                                                                                                                                                                                                                                                   GAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCT
  5   1   3        nb Gas7      in                           XZG110.5p                                                                                                                                                                                                                                                                                                                                             CAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGGCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACATGTNNATATGGC
  3   1   2       ext Gas       in                    TGas139o10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                     TGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTGTAGGAGAGGCGCTCGAAAAAGGAAGAATTACTAAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu       in                    TNeu123g02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                       AATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAAAGAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGA
  5   1   2       ext Ski1      in                         CABJ7042.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              TCGATTCAATTGGCACGAGGTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCNGAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGC
  5   1   2       ext Int1      in                        CAAP12030.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGANACAGANAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCCACTGAGATGTAGCAGCACAGGCGTTGAA
  3   1   2       add Neu       in                    TNeu067g06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCNTTTGCCAGAGCTCGATGATGATTATGACATGNNGAGNGTGTCCAGCAGGGAAGANNGTCGGAATATGAGAGNNTGGGGAAGAGGAGGANNTAAAGAGAGANNANTGGCTTCGTTCTGAAGGAAANNTAGCAAACTTTTGCTGCTCTAAGAGAAAAAATNNCAAAAGAAGNNCAAA
  5   1   2       add Sto1      in                         CABG2315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCCTCTAAAACACAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAGTGTATCC
  3   1   0       add Sto1      in                         CABG2315.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAgagagactggaatatgaatagaagagacactgaattacaagttaagcaataaaaagtaacaattataataacattttagTCACATTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGACAAATAGTACATAAATTGTAAATAATAATAATAaagaccaattgcaacgtttctaggaataggagattctgtaacattctaacagttaccttaaaggtgaacaaccccttAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTC
  3   1   2       add Gas  FLq  in                    TGas117e07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTGGGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACAATGTTGTACCAGTGTAAATAAATTTATTTTCAAGAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas7      in                         XZG54383.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTCCTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTTTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAAGAT
  3   1   2       add Neu       in                    TNeu109a13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCNCCAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAA
  3   1   3        nb Gas7      in                           XZG110.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATATGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTAT
  5   1   2       ext HeRe                             EC2CAA45BG01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCCAGATAAAAAA
  3  -1   1       add Int1      in                         CAAP3043.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGT
  5   1   1       add Int1      in                        CAAP11374.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGA
  5   1   2       ext TpA       in                   TTpA074k09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCGGGCTCTTGGGCAAACTTAATGGCCTTTTATTACATAACCCCTGGTGTGTCTTATTCCTGTGAAGCAAATGCATATACAGATACAGACAACTTTAGTCTTCCTCTACCAATCTTGTTCTTAAACTGCCTTAGCAGAAAGGCAATGCTTACTGCTATAACAACTGGTAAAGAAAATGCAATAAAAACACTTGTGCTATTCTTCTCCCTAAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAgagagactggaatatgaatagaagagacactgaattacaagttaagcaataaaaagtaacaattataataacattttagttacgtttggcaaccggggtcactgacccccacttcaaagcttgaaatagacagaagaggaaggcaaatagtacataaattgtaaataataataataaagaccaattgcaacgtttctaggaataggagattctgtaacattctaacagttaccttaaaggtgaacaaccccttAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATG
  5   1   3        nb Te1                                 CBWN10109.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCTTTTATTACATAACCCCTGGTGTGTCTTATTCCTGTGAAGCAAATGCATATACAGATACAGACAACTTTAGTCTTCCTCTACCAATCTTGTTCTTAAACTGCCTTAGCAGAAAGGCAATGCTTACTGCTATAACAACTGGTAAAGAAAATGCAATAAAAACACTTGTGCTATTCTTCTCCCTAAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATATATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGAAGAGACACTGAATTACAAGTTAAGCAATAAAAAGTAACAATTATAATAACATTTTAGTCACGTTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGAAGGCAAATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGGATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGA
  5   1   3        nb Hrt1                                 CAAQ8484.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAgagagactggaatatgaatagaagagacactgaattacaagttaagcaataaaaagtaacaattataataacattttagttacgtttggcaaccggggtcactgacccccacttcaaagcttgaaatagacagaagaggaaggcaaatagtacataaattgtaaataataataataaagaccaattgcaacgtttctaggaataggagattctgtaacattctaacagttaccttaaaggtgaacaaccccttAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAGTTTGTGTGTTTATTACTGTAAAACATGTATTTTAGTATGCTGCCTTTACATGATTCCCTTCCAAAACAGCAATGTTATTAAAAAAAAAAGGTTTATTAATTTGACTCAAAAGCCCCCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTG
  5   1   2       ext Neu                            TNeu082d19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  aattgcaacgtttctaggaataggagattctgtaacattctaacagttaccttaaaggtgaacaacccctTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAGTTTGTGTGTTTATTACTGTAAAACATGTATTTTAGTATGCTGCCTTTACATGATTCCCTTCCAAAACAGCAATGTTATTAAAAAAAAAGGTGTATTAATTTCACTCAAAAGCCCCCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTC
  5   1   2       ext Brn4      in                        CAAL22330.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAGTTTGTGTGTTTATTACTGTAAAACATGTATTTTAGTATGCTGCCTTTACATGATTCCCTTCCAAAACAGCAATGTTATTAAAAAAAAAAGGTTTATTAATTTCACTCAAAAGCCCCCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCT
  5  -1   2       add Int1      in                         CAAP3043.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGTAAAACATGTATTTTAGTATGCTGCCTTTACATGATTCCCTTCCAAAACAGCAATGTTATTAAAAAAAAAAGGTTTATTAATTTGACTCAAAAGCCCCCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTT
  3   1   2       ext Int1      in                        CAAP12072.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAAACATGTATTTTAGTATGCTGCCTTTACATGATTCCCTTCCAAAACAGCAATGTTATTAAAAAAAAAGGTTTATTAATTTCACTCAAAAGCCCCCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTT
  3   1   2       ext Int1      in                        CAAP12030.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTATGCTGCCTTTACATGATCCCTTCCAAAACAGCAATGTTATTAAAAAAAAAAGGTTTATTAATTTGACTCAAAAGCCNNCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCA
  3   1   2       ext Ski1      in                         CABJ7042.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATGATCCCTTCCAAAACAGCAATGTTATTAAAAAAAAAAGGTTTATTAATTTGACTCAAAAGCCCCCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAAG
  3   1   2       ext Brn3      in                         CAAK1547.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACAGCAATGTTATTAAAAAAAAAGGTTTTATTAATTTCACTCAAAAGCCCCCCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAAGAT
  3   1   2       add Int1      in                        CAAP11374.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAAAAAAGGTTTATTAATTTGACTCAAAAAGCCCCCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTC
  3   1   2       ext Brn4      in                        CAAL22330.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCACTCAAAAGCCCCCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAGG
  3   1   2       ext Liv1      in                         CAAR2440.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTCAAAAGCCCCAGTTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTNTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTC
  3   1   4      seed Mus1      in                          CABH914.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAAAANAAAACCTCTCGC
  3   1   2       add Gas7      in                         XZG36813.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATCCAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAGGAT
  3   1   2       ext TpA       in                   TTpA074k09.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTCAA
  5   1   2  SIG                                      Xt7.1-CABI4486.3                                                                                                                                                              CTCGGGCTGGAAAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTGACCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAANCAACAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGAAGAGACACTGAATTACAAGTTAAGCAATAAAAAGTAACAATTATAATAACATTTTAGTTACGTTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGAAGGCAAATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGAATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTTTGGAATGTACATATTTTGTGACATTTTTTACCAGTGTAAATAAATTTTATTTTTCAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008281474                                                                                                                                                                    CTGGAAAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTGACxxxxGxAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGxxxCxxAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAxxAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGAAGAGACACTGAATTACAAGTTAAGCAATAAAAAGTAACAATTATAATAACATTTTAGTTACGTTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGAAGGCAAATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGAATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTTTGGAATGTACATATTTTGTGACATTTTTTACCAGTGTAAATAAATTTTATTTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  5   1   4      seed HdA       in                  THdA038a08.p1kaSP6                                                                                                                                                              CTCGGGCTGGAAAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGANGGANATAGNCACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAANAGATTATATTACTGTGCCTGCTGTGCCTCATAGNCATGTTCACACACCATTACAGCCTTCTG
  3  -1   3        nb Ovi1      in                         CABI4486.3p                                                                                                                                                                      AAAATGTCTGGTTCGGAAGAGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACG
  5   1   2       ext Int1      in                        CAAP13899.5p                                                                                                                                                                                                                                   CTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGG
  5   1   3        nb Int1      in                        CAAP12093.5p                                                                                                                                                                                                                                         AGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCA
  3   1   2       ext Int1      in                        CAAP13899.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAANCAACAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAgagagactggaatatgaatagaagagacactgaattacaagttaagcaataaaaagtaacaattataataacattttagttacgtttggcaaccggggtcactgacccccacttcaaagcttgaaatagacagaagaggaaggcaaatagtacataaattgtaaataataataataaagaccaattgcaacgtttctaggaataggagattctgtaacattctaacagttaccttaaaggtgaacaaccccttAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAA
  3   1   3        nb Int1      in                        CAAP12093.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAACACAAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAgagagactggaatatgaatagaagagacactgaattacaagttaagcaataaaaagtaacaattataataacattttagttacgtttggcaaccggggtcactgacccccacttcaaagcttgaaatagacagaagaggaaggcaaatagtacataaattgtaaataataataataaagaccaattgcaacgtttctaggaataggagattctgtaacattctaacagttaccttaaaggtgaacaaccccttAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAA
  5  -1   3        nb Ovi1      in                         CABI4486.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGNTTGTATCCTTTATGTATTTATGNTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAgagagactggaatatgaatagaagagacactgaattacaagttaagcaataaaaagtaacaattataataacattttagttacgtttggcaaccggggtcactgacccccacttcaaagcttgaaatagacagaagaggaaggcaaatagtacataaattgtaaataataataataaagaccaattgcaacgtttctaggaataggagattctgtaacattctaacagttaccttaaaggtgaacaaccccttAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTT
  3   1   4      seed HdA       in                    THdA038a08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATTTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAgagagactggaatatgaatagaagagacactgaattacaagttaagcaataaaaagtaacaattataataacattttagttacgtttggcaaccggggtcactgacccccacttcaaagcttgaaatagacagaagaggaaggcaaatagtacataaattgtaaataataataataaagaccaattgcaacgtttttaggaataggagattttgtaacattttaacagttaccttaaaggtgaacaacccctTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATTTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCTTCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTTTAGCATTTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTTTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTTTGGAATGTACATATTTTGTGACATTTTTTACCAGTGTAAATAAATTTTATTTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCG
  5   1   2  SIG                                      Xt7.1-CABC8084.5                                                                                                                                                                                         AGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGGCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACTCAGCCCAAGCTCCAGACATTGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTAACTGCTGGTTAAGCTTGAAAAGTGTATCCTTTATGTTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGAAGAGACACTGAATTACAAGTTAAGCAATAAAAAGTAACAATTATAATAACATTTTAGTCACATTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGACAAATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGAATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTCAAAAAAAAA
                                                  Xt7.1-CHK-1008281480                                                                                                                                                                                               AGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGGCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACTCAGCCCAAGCTCCAGACATTGATGACAATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCTGxTxAxxCTTGAAAAGTGTATCCTTTATGTTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAGAAGAGACACTGAATTACAAGTTAAGCAATAAAAAGTAACAATTATAATAACATTTTAGTCACATTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGACAAATAGTACATAAATTGTAAATAATAATAATAAAGACCAATTGCAACGTTTCTAGGAATAGGAGATTCTGTAACATTCTAACAGTTACCTTAAAGGTGAACAACCCCTTAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTCAAA
  5   1   4      seed Fat1      in                         CABC8084.5p                                                                                                                                                                                         AGAGGAAGACGCTCCTGGTGCGACACATTCCTTCAGAGCTAACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGGCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTT
  5   1   3        nb Int1      in                         CAAP5774.5p                                                                                                                                                                                                                                                              AGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGGCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCCAGAGCCAGAAA
  5   1   2       ext Int1      in                        CAAP12294.5p                                                                                                                                                                                                                                                                                                                                                                                  CACCAACTTACCATCTTGGGGCACACTCTCGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGCGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACTCAGCCCAAGCTCCAGACATTGATGACAATGAGGA
  3   1   4      seed Fat1      in                         CABC8084.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGCGGAGTACNTGCTGTTAAGCTTGAAAAGTGTATCCTTTATGTTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAgagagactggaatatgaatagaagagacactgaattacaagttaagcaataaaaagtaacaattataataacattttagTCACATTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGACAAATAGTACATAAATTGTAAATAATAATAATAaagaccaattgcaacgtttctaggaataggagattctgtaacattctaacagttaccttaaaggtgaacaaccccttAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAA
  3   1   2       ext Int1      in                        CAAP12294.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAgagagactggaatatgaatagaagagacactgaattacaagttaagcaataaaaagtaacaattataataacattttagTCACATTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGACAAATAGTACATAAATTGTAAATAATAATAATAaagaccaattgcaacgtttctaggaataggagattctgtaacattctaacagttaccttaaaggtgaacaaccccttAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTCAAAAAAAAA
  3   1   3        nb Int1      in                         CAAP5774.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATCCTTTATTGTGGTATCCTTTATGTATTTATNGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAgagagactggaatatgaatagaagagacactgaattacaagttaagcaataaaaagtaacaattataataacattttagTCACATTTGGCAACCGGGGTCACTGACCCCCACTTCAAAGCTTGAAATAGACAGAAGAGGACAAATAGTACATAAATTGTAAATAATAATAATAaagaccaattgcaacgtttctaggaataggagattctgtaacattctaacagttaccttaaaggtgaacaaccccttAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAGGGGCATATACATGATTATACCTGCTGCTGAGTTCTAGCATCTTGTATGCATATTGGACAGTTGCTGTTATATTTAACCAAAGGTTGGATGCAGCCATTTAAGTTCTATATGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTC
  5   1   2  SIG                                    Xt7.1-TTpA020p14.5                                                                                                                                                                                                                        TTCAGAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAAGATAAAAAAAAAAAAAAAAAAAAATAAAAAAAATAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008281472                                                                                                                                                                                                                              GCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAAGATAAAAAAAAAAAAAAAAAAAAATAAAAAAAATAAAAAAAAAAAAAAA
  5   1   4      seed TpA       in                   TTpA020p14.p1kSP6                                                                                                                                                                                                                        TTCAGAGCTGACTCCGGAGGAACAGAGGCAACTGCTTGAGAAGAGCGGGGCGCAAAGTGTGCGCCTGGGAGCCGGGCGGAATTATAAGCTGAGAACTACTGCATTCGCTACCTATCCAAATGAATTTGCAGCAGCAAAGGCTCTGTCTGTACTTCACCAACTTACCATCTTGGGTCACACTCTTGTGGTTGAATATGCTAAAGAAAATCACATTCACTTATCAGACCAGCCTCCTTTCTCTGAAAAAAAGAAAAGTGCAGAGAACAAAGATGATGTGAAAGACAAGACTCCTCCGGATCAGATATCTATCGAAAGAGGAATAGCCCCAAATCATGGACTTCTCTTTCCAATAAAGTCCAGTCTAAAGTATCTGTATCCTCCACCAAGCAGCACTATTCTGGCAAATATTGCCAATGCTTTGGCAAGTGTTCCAAAGTTCTATGTTCAGGTGTTGCATTTAATGAATAAACTGAATTTACCAGCTCCTTTTGGACCACTAACAGCTCAGCCTCCAGTATATGCAGACTATTTAGCACTACCTATGCCATACCCACCTGTGCCACCAGACCTTCCTGAAAACCCCCCTTTGCCAGAGCTCGATGATGATTATGACATGGAGGTGTCCAGCAGGGAAGAGTCGGAATATGAGAGTGGGGAAGAGGAGGATAAAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTNATATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTTCTACAGCTAC
  3   1   2       add Gas       in                    TGas120e16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     agagaaaaaggaaactatttttaaaaatgaaatttattttcttataatggagtctatgggagatggcctttctgtaattcagaactttctggataacaggttttcggataagggatcccatacctgtACTGTGTATCCTTCCTCAGCACTGATTTGGGAGAGTACACACAGAGCAGAAGTCAAATCAGACCTGTATCCTAAAGATGTTTATTGGCCAAGCAGGGAGAGTGGAACACTAATGTAGTGAGCAGTTAACTCCAGATGTTGAATATCAGAATTTGGTTCAAAAAGTGAGAATGCTTTCAGTTCATTTTTTTTGCAGTTTTAATAGGGTACTATGTAAGAGTGACTTAGCCAAGTTAGTTAATATGACATTGAAGCTGCACTTTTGTCCTGTTATGTCTTTACATAGGTTTATAGTCTCAAATCTTGTCAAGAACAAATGCTTGCATGCTTGGTAAATAGTTATGAGGAAAGACAAAAAAAAACTTTGTGCTTTGTCGCGTCCTACACATTTTATTTTAAAACAAGTTTTATATAATCTGTTGTTAATAACCATAAAAGGAAAACTTATGTTGACAGGGAATACATTTTTAACATAGTTTGCTAAACCTGGAGCATATACACACTTGTTATTACATTACCCCATGCCTGTTCGTTGGGTTCGGTGTAGCCATTAGTAAATTCTTTGCACCTATTACGTTTTACTTAAATCTGTACCAGCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTTTTTCAAAAAAAAAAAAAAAAAA
  5   1   2       ext HdA       in                   THdA023d06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGAGAGAATGGCTCGTCTGAAGGAAATAGCAACTTTGCTGCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAANAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTAAATATTTTGTGACATTTTTTTA
  3   1   0       chi Ski1      in                         CABJ5225.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAgagagactggaatatgaatagaagagacactgaattacaagttaagcaataaaaagtaacaattataataacattttagttacgtttggcaaccggggtcactgacccccacttcaaagcttgaaatagacagaagaggaaggcaaatagtacataaattgtaaataataataataaagaccaattgcaacgtttctaggaataggagattctgtaacattctaacagttaccttaaaggtgaacaaccccttAAAGTGTTAATTGCTTTTAGAGATATACTATTTATCTTCCATTCATTTGAGAAGGCATAAGGTCATATTAAAAGCACAGCGGTATTCATCATACAGCAGAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAAGAT
  5   1   3        nb Tbd1      in                        CBXT20221.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCTAAGAGAAAAAATCAAAAGAAGCAAAGCCAGCCACGAAAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAACAACAAAGAAGAAATAGAGAGGAGGTAAAGCTCATCAGAGGAACAGCATATTTACTGCAGAC
  5   1   0       chi Te1       out                        CBWN4547.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCCGAAAGTTATGAAATTTTCTTATCCGAACGATCGTAAACGGCGCAAAAACATTTCTGCCTTTGAAACTTCAATGCATGATTTTGGAAGCCTCCCATAAACTTTAGAAAAAATAAGAATTTTTCGCAATTGTGGTCATTGTGCTTTGAAAAATGTGCCCCCTAATGTTGGAATGTCATCTGTTTCAGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTATGTCTTGCATAAAA
  3   1   4      seed TpA       in                    TTpA020p14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAAGAAAAAGTTAAAAGATTATATTACTGTGCCTGCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTTTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTTTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTTTAGGAGAGCGCTCGAAAAAGGAAGAATTTCTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGGTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTTTCATTTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGGGATTCAATTCGCTCGATCTGTTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTTCTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTTTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAAGATaaaaaaaaaaaaaaaaaaaaataaaaaaaataaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   0       add Brn3      in                         CAAK4685.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAAAAGGTTTATTAATTTCACTCAAAAGCCCNCAGTTCTCATTTAGAAAAACAGTAGCAGTAGCTGGTAGGTTTTTAGATGATGAAGCTTACACTATTACCTTTTAGGACAAAAATTAATTTTTTCACTTATTGCTATTTGCAGTCTGAAACCCTGATGCTTGAAAATGATACCAGCCCTGAATATGGCTGACAGCCTTACTTTAATCATGTGCAAAAATCAACATTAAATATTTATATTTTTAAATAAGTTAAATATATATGACTTTTTCATTAGTGTTCTTTTTCTCCATAGTGTAATTTTTAATTATCATGCTAAAATGGAACTTAAATGTTAATTTCCAGGCTTTGTTTAAGGATTCTAGGGAACTATATAAATCCTGTTTACAGTAGAACCCCAATTTTACATTTCCCAGAGGGAAAACCTAAAATCCATGGAAAAACAAAACACAGCTTGTCTGTATGGGACCACAAAAAACATTGTAATATCCGGAAAAACTTAAAATCAGGGGTCTACGGTATTTAAAAATTGGAAATACAGGAAAAAAATGTACTAAGTTACAAAATTGAACTCTGATTGTCTTCCTAGTGGCGGCACATTTTAAGGCAAATGCATTCATCTCTGAAGGTGGCTTTAAAGAATGCAAACACTTGAACCTCTATTTGTATTCCAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAAG
  5   1   3        nb Gas7      in                         XZG19568.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGTGCCTCATAGCAATGTTCACACACCATTACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACTAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATATACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGGTACACTGAAAAAATGTCTATTTA
  5   1   2       add Ski1      in                         CABJ5225.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAGCCTTCTGATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGATGGCCGAGTAACTGCTGTTAAGCTTGAAAAGTGTATCCTTTATTGTTGTATCCTTTATGTATTTATTGTTAGTGCTAAAATGGTGCAAACATTGGAGAAGGCAAAATGGCTGTGCTGATCATGAAACATGATATAATAAAAAGGTTAAGTGCAGAACCTAACCACTGTCATATCTTACCCATGTATAGGAAATATTTTCATCAATATTTACTTTCTGGTAATACTCTACATTTATTTTTTATTTAAAGAGAGACTGGAATATGAATAG
  3   1   2       add Gas7      in                         XZG24455.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACGCGTCCGGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAAG
  3   1   2       ext HdA       in                    THdA023d06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATGTATTTGAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTTGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTTTTTTCAAAAAAAAAAAAAAAAAAAGC
  5   1   2       add Gas7      in                         XZG24455.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAGAACCATGTATTATGGGCCCAAAAAAACTGGAACTGCATATTCCTACTGACATTCTAACAGCTACTCAGGAGCCAGAAAAAGAAGTTGAAATAAGTGAAGATTTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGANAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAA
  3   1   3        nb Tbd1      in                        CBXT20221.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGAAAAGAAGTTGAAATAAGTGAAGATTATCTGGGTTTGGCAAGATTTACCCAGCCCAAGCTCCAGACATTGATGACAATGAGGAGGAAGAAGATGATGATTTGCCTAAGGAATTTATTTCTAGGAGAGCGCTCGAAAAAGGAAGAATTACTAAAGAAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTAAAGCTCATCAAGAGGAACAGCATATTTACTGCAGACATGTAACACTGAAAAATGTCTATTTATGAAATGCCTGTCTTCTGGAATGTACATATTTTGTGACATTTTTTACAGTGTAAATAAATTTTATTTTTCAAGATAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG19568.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGAAATGAGGAAAACGTCTGTTTTCAAAAACTATGAACTGGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCTTCTGAAACAGAAAAGAATATGTTTGATATTCTTCTGATGAAAGAAGGGGGGATGAAGGGCCAAGCTTTCATAGGATTTCCCCCTGAAGATGTAGCAGCCCAGGCGTTGAAACCCGTGCAGGGATATATACTCCATGCCAAGCCAAGGGGGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTTTAAACCACCAAAGAGGAAATGGGGGGGAGGGTAAAGCTCTTCAAGGGGACCGGCATTTTTCCTGCAGCCATGTACCCCTGAAAAATGTCTTTTTATGAAATGC
  5   1   2       add Brn3      in                         CAAK4685.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAACGTCTGTTTTCAAAAACTATGAACCAGGCGAACCAAACTGCAGACTGTATGTAAAAAACCTCTCCAAGCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTATGTCTTGCATAAAAAAATATTTAAGGATGCCTGTTTGACACATGATAAATTACTAATTAAGCTTCAGTAGGGATGCACTGAATTTAGGATTCATGTCAGAATTCAGCTGAATCCCAGCCCTTGTTAAATATTAATATGTGGTTCTGTATTTGTCCAAACCTTTAATGGAGGTCTTTAAATGAGGGTGGGGGTGATAGAAGGGTTGGAAAACTTTTATGTCAAGCAGCGGCTAAACCAGCCTCAGTCCCCTTAATGCCACCAGTGATTTCACAAATGGGACGGTTTGGCATGAAGGCATGTCAGTGTTAGGTAGATTTTAGTCAATAAATGGAACAAGCCCTGCTTTAAGTCTGGCCCATAACCCACACTAACCTTATTCTGGGGCTAGGTTTATTTATAAACAGGTTTATGAAACATTCACTTCAGTTGGATGGATTATTTAGTGTAATAAGTTACCCTATAAG
  5   1   1       add Gas7      in                         XZG36813.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTTTGTCGCGTCCTACACATTTTATTTTAAAACAAGTTTTATATAATCTGTTGTTAATAACCATAAAAGGAAAACTTATGTTGACAGGGAATACATTTTTAACATAGTTTGCTAAACCTGGAGCATATACACACTTGTTATTACATTACCCCATGCCTGTTCGTTGGGTTCGGTGTAGCCATTAGTAAATTCCTTGCACCTATTACGTTTTACTTAAATCTGTACCAGCAATTCGCTCGATCTGCTCGTCCAAAGCCCGAAGCCTCTAAAACAACAAAGAAGAAATAGAGAGGAAGGTATGTCTTGCATAAAAAAATATTTAAGGATGCCTGTTTGACACATGATAAATTACTAATTAAGCTTCAGTAGGGATGCACTGAATTTAGAATTCATGTCAGAATTCAGCTGAATCCCAGCCCTTGTTAAATATTAATATGTGGTTCTGTATTTGTCCAAACCTTAAATGGAGGTCTTTAAATGAGGGTGGGGGTGATAGAAGGGTTGGAAAACTTTCATGTCAAGCAGCGGCTAAACCAGCCTCAGTCCCCTTAATGCCACCAGTGATTTCACAAATGGGACGGTTTGGCATGAAGGCATGTCAGTGTTAGGTAGATTTTAGTCAATAAATGGAACAAGCCCTGCTTTAAGTCTGGCCCATAACCCACACTAACCTTATTCTGGGGCTAGGTTTATTTATAAACAGGTTTATGAAACATTCACTTCAGTTGGATGGATTATTTAGTGTAATAAGTTACCCTATAAGATAAGTGAGCATGAAAGAGACAGTTATGCCCCTGTACATTATTGCAAAATTTAGGCTAAGGACACACATGCCAGATCCTTAGCCAGTGTTGAAAATGCAGCAGCTGCATCTGCCATTCAGTTTTT
  5   1   0       chi Gas       in                   TGas120e16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGGCTGAAGAAAAGGATCTTAAGTTTATCTTTGGAAGGTTCATCGACTTCTCATCTGAAACAGAAAAGAATATGTTTGATATTCGTCTGATGAAAGAAGGGAGGATGAAGGGCCAAGCTTTCATAGGATTTCCCACTGAAGATGTAGCAGCACAGGCGTTGAAACACGTGCATGGATATGTACTCCATGACAAGCCAATGGTGATTGTATCCTTTTATATATCTGAAAATAGAATTTTACACCAACGTCCTTAATCCATAGAAAATGAAAGTTGAAGGAGTGGTTTTTGCAAATAATAAAATGTTGATATAGGTAATTGGTAGAGTGCATAATGTATAAATCCATTTCAAAAATGACTTCTCTGTATCAGTAGTCAGGGATTAAGCTGGCAGTATATTGGTGTATTTATTGCTCAGTGATGTCCTGCTGTGTGAACAAATAAagtacaggtataggacctgttatccagaatgcttgggaaccggggcttt

In case of problems mail me! (mike.gilchrist@crick.ac.uk)