Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012073835 Xt7.1-TNeu069m11.3 - 71 ESTs
                                                                       -20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu069m11.3                     GCCCTGTGAGATCCCTCCTGCTGCTCTCAGAGCTGGGAGTGTGAGTGAATGTAGCCCGCAGAGCCAATGAGCTGGGACCGGATGCGATATATCCTCTGGGACAACAACTGCTCTGTTCCTCCTCACTTCCACATGACGCCATTTAGCGCTGCTGCTGCTGCCTAGGATCCCGGGAGCGGAGCAGCTCAGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGCGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCT
                                                  Xt7.1-CHK-1008224320                           TGAGATCCCTCCTGCTGCTCTCAGAGCTGGGAGTGTGAGTGAATGTAGCCCGCAGAGCCAATGAGCTGGGACCGGATGCGATATATCCTCTGGGACAACAACTGCTCTGTTCCTCCTCACTTCCACATGACGCCATTTAGCGCTGCTGCTGCTGCCTAGGATCCCGGGAGCGGAGCAGCTCAGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGCGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAAC
                                                      consensus depths                          2     2     2     2     2     2     2     2     2     3     2     3     2     3     3     3     3     3     3     3     3     3     4     4     6     6     8     8    10    10    12    13    14    14    14    14    15    15    16    16    16    16    16    16    17    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    19    19    20    19    20    20    21    20    21    20    21    20    21    20    21    20    21    20    22    20    22    20    22    19    21    19    21    18    22    18    22    18    22    18    21    19    22    19    22    19    22    19    22    19    22    19    22    21    23    21    23    21    23    22    24    22    24    22    24    23    25    23    25    24    25    24    25    24    25    23    24    22    23    22    23    20    21    20    20    21    21    20    20    20    20    19    19    17    18    17    17    17    17    16    16    14    15    16    16    15    15    15    15    15    15    16    16    16    16    16    16    14    15    14    15    14    14    13    15    15    15    15    15    15    15    15    15    15    15    14    14    14    14    13    14    13    15    13    15    13    15    13    15    13    15    13    14    13    14    13    14    15    16    15    16    15    16    15    16    17    18    16    18    16    18    15    17    15    17    17    19    19    20    21    23    23    27    23    28    22    27    22    27    22    27    20    25    22    27    23    29    24    31    26    32    26    34    26    34    27    35    26    35    25    34    26    35    27    36    27    37    29    38    29    38    29    38    28    39    28    39    28    39    27    38    27    38    26    38    26    38    26    38    26    38    26    38    26    38    26    38    31    37    31    37    30    37    30    37    29    36    29    36    28    35    28    34    27    33    27    33    27    33    26    33    27    33    26    32    26    31    25    31    24    31    26    31    26    31    26    31    24    30    25    30    25    30    24    30    24    30    24    30    22    27    21    25    21    23    22    24    21    24    21    24    19    23    19    23    19    23
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------G-T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------T
                                               BLH ATG     603    1033                     
                                               BLH MIN     603     126                     
                                               BLH MPR     165     126                     
                                               BLH OVR     603     567                     
                                               CDS MIN     603     126                     
                                               ORF LNG     603      42                     
                                                                                                                                                                                                                                                                               PREDICTED - Sp ---- 1e-011     XP_785660.2 PREDICTED: similar to sprouty-related, EVH1 domain containing 2 [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                PROTEIN --- Dm ---- 3e-041     NP_523902.2 sprouty CG1921-PB [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Dr ==== 5e-083     NP_001003842.2 sprouty homolog 2 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 8e-138     NP_036027.1 sprouty homolog 2 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 3e-139     NP_005833.1 sprouty 2 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Gg ==== 2e-140     NP_990131.1 sprouty 2 [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 1e-178     AAK51356.1 sprouty2 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === ?? ==== 1e-178     NP_001082238.1 sprouty 2 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 0          AAU43764.1 Sprouty2 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu069m11.3                           TGA------------------------------------TGAATGTAG------------ATG------------ATG------------------------------------------------ATG---------------------------TAG------------------------------------------------------------------ATG---TAG------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------TAG---------------------ATG---------------------------------------------------------------------TAG------------------------------------------------------------------------------TGA------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------TGA---------------------------------------------------------------------------------------------------------------ATG------------TAG---TAATAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------TAA------------------TAA---------------TAG---------------------------------------------------------------------------------------TGA---------------------------TGA---------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   1           Gas1 FL                     IMAGE:5308295.FL-MGC                                                                                                                                                                                                                                               GCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCCGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGTGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACGTTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg014j04.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGCGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGTCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas                            TGas099p08.p1kSP6 GCAGCAGCGTTTAGGCCATTGCCCTGTGAGATCCCTCCTGCTGCTCTCAGAGCTGGGAGTGTGAGTGAATGTAGCCCGCAGAGCCAATGAGCTGGGACCGGATGCGATATATCCTCTGGGACAACAACTGCTCTGTTCCTCCTCACTTCCACATGACGCCATTTAGCGCTGCTGCTGCTGCCTAGGATCCCGGGAGCGGAGCAGCTCAGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCCGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGG
  5   1   2   12  bld Tad5 5g3  in                         XZT50271.5p ....................GCCCTGTGAGATCCCTCCTGCTGCTCTCAGAGCTGGGAGTGTGAGTGAATGTAGCCCGCAGAGCCAATGAGCTGGGACCGGATGCGATATATCCTCTGGGACAACAACTGCTCTGTTCCTCCTCACTTCCACATGACGCCATTTAGCGCTGCTGCTGCTGCCTAGGATCCCGGGAGCGGAGCAGCTCAGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAA
  5   1   2       bld Gas                            TGas047i01.p1kSP6                                                                 TGGATGTAGCCCGCANAGCCAATGAGCTGGGGCGCGGGGGCGATATATCCTCTGGGACAACAACTGCTCTGTTCCTCCTCACTTCCACATGACGCCATTTAGCGCTGCTGCTGCTGCCTAGGATCCCGGGAGCGGAGCAGCTCANTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCGCTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTANCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGGATTTCANATGTGTTCTCAGCCCACAGGTGTGAAAACTCT
  5   1   2       bld TpA  5g3  in                   TTpA004c11.p1kSP6                                                                                                                                                        CATGACGCCATTTAGCGCTGCTGCTGCTGCCTAGGATCCCGGGAGCGGAGCAGCTCAGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCCGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCANAGGCTTCTTGTGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACC
  5   1   2       bld Neu  5g                        TNeu028f15.p1kSP6                                                                                                                                                               CCATTTAGCGCTGCTGCTGCTGCCTAGGATCCCGGGAGCGGAGCAGCTCAGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAG
  5   1   2       bld Egg  5g                        TEgg079f04.p1kSP6                                                                                                                                                                CATTTAGCGCTGCTGCTGCTGCCTAGGATCCCGGGAGCGGAGCAGCTCAGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTA
  5   1   2   10  bld Ova1 5g3  in                        CABE12000.5p ........................................................................................................................................................................ATCGATTCGCTGCCTAGGATCCCGGGAGCGGAGCAGCTCAGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCCGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCANGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCC
  5   1   2       bld Gas8 5g3  in                          st50e09.5p                                                                                                                                                                            CTGCTGCTGCCTAGGATCCCGGGAGCGGAGCAGCTCAGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCCGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCA
  5   1   2       bld Gas  5g                        TGas028n07.p1kSP6                                                                                                                                                                                  CTGCCTAGGATCCCGGGAGCGGAGCAGCTCAGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGAC
  5   1   2   12  bld Gas7 5g3  in                         XZG25221.5p .........................................................................................................................................................................................GATCCCGGGAGCGGAGCAGCTCAGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCC
  5   1   2       bld TpA  5g                        TTpA032m21.p1kSP6                                                                                                                                                                                              CCGGGAGCGGAGCAGCTCAGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCCGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCNGGAGCATACGAGGACAAGTAGCAGTTCTACAG
  5   1   2   22  bld Gas7 5g                              XZG35174.5p ..............................................................................................................................................................................................CGGGAGCGGAGCAGCTCAGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGA
  5   1   2   22  bld Gas7 5g                              XZG56397.5p ................................................................................................................................................................................................CCCACGCGTCCGCTCAGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCC
  5   1   2       bld TbA  5g3  in                   TTbA076j20.p1kSP6                                                                                                                                                                                                              CTCGTCACATCGCCAGTATCCGGCAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCCACCATGCATTCCTTGTCT
  5   1   2   10  bld Fat1 5g3  in                         CABC1656.5p ....................................................................................................................................................................................................................................CAGAGTGCAAGCTCCGCTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAAGCATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTT
  5   1   2       bld Gas1 FL   in                    IMAGE:5308295.y1                                                                                                                                                                                                                                                     CTGTCACATGCACTAGAGGCGCCCGGTGCAGCACTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCCGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAG
  5   1   2   10  bld Spl1 5g3  in                         CABK3824.5p .....................................................................................................................................................................................................................................................................................CTTTCCTTGCACACCAAGCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGCGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCC
  5   1   2       bld Gas  5g                        TGas112n24.p1kSP6                                                                                                                                                                                                                                                                                                       GCTCTTGGGATTTCTCGCTACTTTCATATTCATTTCACTTGCTGCAAGTTTAGAAGTTTGATCGCGGAGTCCGGGGATTGTACTTAGCTGCGCTACAACTCAACTTAGTGGATACAAGGATCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTC
  5   1   2   22  bld Gas7 5g                              XZG53021.5p .........................................................................................................................................................................................................................................................................................................................................................................................................GCCGTGCTCCCCCTCCTTAATCCGCAGTCTGATCACACACTCGGGTTCTTAATGGGGTTTTCAGAGAACGCTTAGAGAGCTGGGGGCTGGGAAGGGGAAGGCAGGCAGGGGAAACCTACACACTACTTGCAGTCCACAGCACGTTATGCATGGGGCCCAGGAACAGAACTGGAAAGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGCGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGANATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTA
  3  -1   2       bld Eye       in                         CCAX5546.g1                                                                                                                                                                                                                                                                                                                                                                                                                               TCGCTCTGGAATAGGGGAACCTGCAACCCTGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGCGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACAT
  5   1   2       bld Gas1 5g                            IMAGE:6987110                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGCAACCCCGTGTCATGTTTTCTGTGACCCTTCCTATTGGGCTTGGGGACCGCTGGCTGAAATTTGCCCGGAGCGAAACACGGGGCTAGCCCCATTTGCCCAGTAGGGCTCCCGGCCGGGGCGAGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGTGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCANACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTTGTTGGATTTGGTGACAAAGCAGTGGCCTTTTGCTCAGCCCCAAGGAAAGTTGGTTGGAACTATGGGAAACCCTGGTGC
  5   1   2       bld Neu  5g                        TNeu002j14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCCCCAATCTTATATAATGGGGGAACAAGTCAGTGTTGCCAAAGGCCCATTCCTATTGTATAAGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTTGACAGTGGAAANATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAAGAAGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAAGCACCTTTGTCAC
  5   1   2       bld AbdN 5g                            IMAGE:7006378                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGCAGGATTTCAGATGTGTTCTCAGCCCACAGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGTGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAGACCTGAGCTGAGATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGAAAACCCATGTTCTTGCAGTCAGTCCCCCTGCTGCACTCGATGGTCTGCCAATGGGAGTCATGGGCCCTGTTACTTGCCCTTGTTTGTGGGGGTAACCTTCCAGGCCAAGGGGTTGCCCTTTAATTTGGGCCCAGGGGCTGTTTACCAACGGCCCCAATTAAACCCCCGGATGTTCCCCTGTCCAAC
  5   1   2       bld Egg  FL   in                   TEgg014j04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAGTGAAAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGCGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAA
  5   1   2       bld TbA       in                   TTbA070k17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGATTACATAGTGATGCTGACCCACGTGAAATTCTGACACAACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGTGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTANATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCC
  5   1   2       bld TbA       in                   TTbA045j03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCTGACACACAAGTTCATGTTTTGTCTTTGGAACAAATAAGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCCGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTCGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGCGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTANATTGTGCCAGGGCTGTTACGACCGCACAAAT
  5   1   2       bld Neu       in                   TNeu069m11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAGCCATAAGAAACACTAATGAATACACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGCGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGT
  5   1   2       bld Gas       in                   TGas064c20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGAATCACAGAAGGGCCTACAGTGGCTCCACGCCCTGTGATTAAATCTGCTCCACGACAGACTACGCCACACAAAAATGAAAGAATACATGTGGTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGCGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGC
  5   1   2       bld Gas                            TGas109d02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAAATGAGCAGCGACCTTTTGTCAGGAGTCCACTTCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCACGATCAGTCGGTACAGTCACTTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGCGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACCTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTC
  5   1   2       bld Egg       in                   TEgg018a23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCATCTTGCCGGAGCAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGCGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCA
  5   1   2       bld Tbd1      in                         CBXT4237.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAATACGAGGACAAGTAGCAGTTCTACAGAGCAAAGGCTTCTTGCGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACGTTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGGTGT
  5   1   2       bld Neu       in                   TNeu083e21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGCTTCTTGCGCCACCATTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACAT
  5   1   2       bld Kid1                                CABA10179.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTACATCTTCAGGGTTGGTTGCAGACCGAATAATAAGAGTACAACCCAAACCTGAGCTGAAATCAGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTC
  5   1   2       bld HdA       in                  THdA036j09.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGGGCCCGGGGAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACGTTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGAATTTNGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTNGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTAC
  5   1   2       bld TpA       in                   TTpA069p10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGGGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGACTGTGGGAAATGTAAGTGCCAAGAATGCACCTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAAATCATCAGTATGGGTAGATTGTCCTTCGCTTTCT
  5   1   2       bld TpA       in                   TTpA049h07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGACAAGCATGTGCCTTTGCTCAGCCCAGGAAGTTGTTGACTATGGAACCTGTGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCATGTCAATCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGAGCCTTGTTTCTTGCACTTGTGTTCGTGGTGTTACCTATCCAGCCAAGGGTTAGCCTTAAATTGTGCCAGGGCTGATACGACCGCACAAATACACCCGGATGTCGCTGCAAAAGATCAAACACAGTATGCCTTACAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACGTTTATAAACAACATAACTTCCTTTTAACACTCAAATGCGACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATATAGAACCTCTAATAGAGCTTACAGAAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACATGACACTCCTATGTCACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCTGAGATGTTATGTTATATTTTTGTACATAAACCATATTTACTACTGTAGAAAAACTGCCATTTTTTGATGGCATG
  5   1   2       bld Gas7      in                         XZG37274.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCTTGCTGTGTGAAGTGCCTATTCTATCACTGTTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACACTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATNCTATGTATATTGTACAGGTACACTGTAAGAATCAGCCTTTATTTTCTAATGTT
  5   1   2       bld Neu       in                   TNeu080i05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACGTTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATG
  3   1   2       bld TbA  5g3  in                    TTbA076j20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAAATGATGACGAGGATAATTGTGCAGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAANTATTTATTTAAAAAAAAAAAAAAAAAAG
  3   1   2      seed Neu       in                    TNeu069m11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAGTCAGTCCCACTGCTGCACTCGATGTTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG65474.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTC
  5   1   2       bld Gas       in                   TGas108p13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTGCTGCACTCGATGGTCTGCCATTGGTGTCATGGCCTTGTTCTTGCCTTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGAT
  3   1   2       bld Gas7      in                         XZG37274.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTACCTCCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACACTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCTTCTT
  5   1   2       bld Gas7      in                         XZG44333.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGNGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAACAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                   TTpA069p10.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas108p13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas064c20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTTGCCTTAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACTTTCAGCCTAGGAACTTAGAAAAACCAACCATAGCACAGGTGAACGGACGTTTATAAAGAACATAACTTCTTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAACAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu080i05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAATTGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACGTTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCANCTATAAAATAGAAANNTATATTAACGTCTGAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA                             TTpA032o23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACGTTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA       in                   THdA036j09.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGCCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACGTTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAACAAAAAAAAAAAAAAAAAAGAGAGAA
  3   1   2       bld Spl1 5g3  in                         CABK3824.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAAC
  3   1   2       bld Fat1 5g3  in                         CABC1656.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGCTGTTACGACCGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAAC
  3   1   2       bld TpA       in                   TTpA049h07.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCGCACAAATAGACCCGGATGTGGCTGCAAAAGATCAAACACAGTTTGCATTAAAGTTCCACACCTTGAGCCTCGGAACTTAGAAAAACCATCATAGCACAGGTGAACGGACGTTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAATCTTTGGGATAGGATTGCCTGTTTACAGTGAAATATTTATGCATCAACGGATTTAGGCTTAATAGAGATCCTTTAATAAAGCTTTCAGTAGGATTTGGTGTTCTGTGACGATTATTGTGTACGTTATTGCAGCACAGACACTCCTATGTAACATTGTATTTTTTGTGAATAGTACTGGGAACATTTGTTAAATTTGCAAATGGCTTTTTTTGTAAGATATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGTTTTGTGGAACTTTTAATATTACCAGACTTATATTCTTTGGATGTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTTTAAAGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTATGCAAAATGGGGGTGACTGAGACATATGTTCACTTAAAATCGAAAAAATTAACGTTTAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5 5g3  in                         XZT50271.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCACAAATAGACCCGGATGTCGCTGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTG
  3   1   2       bld Egg       in                    TEgg018a23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTCCACACCTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas0                                 dad19f02.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCCTAGGGAACTTAGAAAACCCAACAATAGCACAGGTTGAACGGACCATTAATAAAGAACAATAACTTCCTTTTTACACTTCAAATGCAACCCTCTTGTTACCATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCACGGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAANTGTGAATCAATCAGNTATGGTTAGATNTGTCCTTCGNCTTTCTGGAACTTNTTAATATTACCAGNACTTCTATTCTTTGGATTCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT4237.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTCAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACGTTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAACAAACAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG65474.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCCTAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTG
  3   1   2       bld Gas8 5g3  in                          st50e09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACCAACATAGCACAGGTGAACGGACGTTTATAAAGAACATAACNTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGANGTCAGTTTCTGCAAATTGGGGGTGACGAGACAT
  3   1   2       bld Egg  FL   in                    TEgg014j04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAACCAACATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG44333.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATAGCACAGGTGAACGGACATTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTG
  3   1   2       bld Gas7 5g3  in                         XZG25221.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGACGTTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGATGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTGGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCCCTATAAAATAGAAATATATTAACGTCGGAAACC
  3   1   2       bld Gas1 FL   in                    IMAGE:5308295.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACGTTTATAAAGAACATAACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAGTATTTATTTTAAAAAAAAAAAAAAAAAAAAAG
  5  -1   2       bld Eye       in                         CCAX5546.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACTTCCTTTTAACACTCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGGGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAACAAAAAAAAAAAAAAAAAAAAAAAAAGGGCG
  3   1   2       bld TbA       in                    TTbA070k17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAAATGCAACCATCTTGTTACATTTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATTTCACTATAAAATAGAAATATATTAACGTCTGAAAACAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld TpA  5g3  in                    TTpA004c11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTAGGAAAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGACCTTCATAATAAACGCTTCCAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGTTATTGCAGCACAGACACTCTCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGACCATTTGTAAAATTTGCAAATGCCCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAACCCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTATTAATGTCCATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTTTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAACCAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA045j03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAAAGCTTTGGGATAGGATTGCCTGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTAAAAAAAAAAAAAAAAAAGC
  5   1   2       bld Gas                            TGas015m06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGGTTTGCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAAC
  3   1   2       bld Neu       in                    TNeu083e21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGTGAAATACTTATGCATCAACGGATTTAGGCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCTTTTTTTTGTCAGAGATATTATGTTATATTTTTGTACATAAACCATATTTACAACTGTGAAAAAAGTGCCATTTTTTGATGGCATGGTCACAAAATTTACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATTGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGACTTCTATTCTTTGGATCTTATGTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAAAAAAAAAAAAAAAAA
  3   1   2       chi HdA                            THdA037i15.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGGGGAGAGAACCTCTAATAAAGCTTACAGTAGGATTTGGTGTTCTGTGACGACTATTGTGTACGCTATTGCAGCACAGACACTCCTATGTAACATTGTATTGTTTGTGAATAGTACTTGGAACATTCGTAAAATTTGCAAAGGGCTTTTTTTTGTCAGAGATATCATGTTATATTTTTGCACATAACCCATATTTACAACGGTGAAAAAAGTGCCATTTTCTGATGGCATGGTCCCAAAATTTATTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTAGATCGTCCTTCGCTTTCTGGAACTTTTAATATTACCAGAATTTTATTCTGTGGATCTTATGAATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTTAAATGTTTCAATAGTGTTTAGTGTAAAGAATATCTAATTGAAGTATAATTATATACAAAGAGAAATATATATATTAAGAAGCATTTTACAACATTAATCCCGTGAGAGAGGCATAAAATTGCGCCCATAAGGGGAGTGTGGGTCCGATATACACTGTTGAATGGAAGTATATGATCGTCAGGAATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1 5g3  in                        CABE12000.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTTATGATGTCAGTTTCTGCAAATTGGGGGTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAACAAAATGTGGCCAGTACTCTTTCTTCTTTAGACTGAAACAGTCGGGTGACTTTCTGTAAGACCTAAATTAAAAGGTATAATATTGGACCAAGCATTGCATTACACACAGGTTTTATTGACATTGGGTCGCTGATAAAAACATGGCCCCCTGTTAGGCCAGATGCATTGGGAGTATCAAAAACAACATAAATATGAAAGCAGATGACCACATCTGAGAATAAGTGCACTCTGTTAGCATTTTGGTCAGTGTAAGCTGGCTTTAAAAATTAGCTTGCTAGCAGACAGTCATACAAGTAGTGGCAAAAAAATCACCTGTGTGACATTGTGCTTAGGCCTTATGCATTTACCAGCTACTACAAATTGTTCAGGTAGAATTGACAGCAACACTCAACATACTCATTCAGGCAGTACCCTTGGCATAGAATTGGACATGAACACAATGCCCACAAAAAGCTGTTGTGGATCCAAATATTCCAGAGAAAATGGGTTTGCATAAAACATGAGACCTTAGTTTCATAATGCAGTATATTTCATAACCAGTGATATTTCCCATGAATTATAGCTGGAAAACTAGATTTTTCATTGGTGTATTTGCGTTTACCCTCCCACTCATTCAGTGTAGTTGTGCTGAGGCTAATAGGTTTTTAACATCACATTCAATAAAAAATATTTCAGCACTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)