Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 202.0    0Xt7.1-XZG45076.5                            2 PI      100       944     1049                (no blast hit)

 This cluster: approximate FL confidence score = 90%

 1012073869 Xt7.1-XZT33734.5.5 - 44 ESTs
                                                                       ...-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZT33734.5.5                                  ATACGGCTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGTGATC
                                                  Xt7.1-CHK-1008226308                                        CTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTxxxTxxTTCTGATGTTTAxTxAxxxxxxxxGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACT
                                                      consensus depths                                       6     7     9    10    10    12    12    14    12    14    14    15    15    16    15    17    18    19    20    21    20    22    21    23    22    24    22    24    21    24    25    27    25    27    26    27    26    27    27    28    28    29    28    30    30    33    33    34    34    36    35    37    34    37    35    37    35    37    35    37    35    37    35    37    35    37    36    38    36    38    37    39    36    38    37    39    37    39    37    39    37    39    36    39    37    39    37    39    36    38    35    39    36    38    36    38    24    38    24    38    23    38    24    38    24    38    21    37    21    35    23    35    20    34    22    34    22    34    22    34    20    34    21    34    21    33    21    33    19    32    20    32    20    32    19    31    18    30    19    30    18    29    17    29    17    29    18    28    17    27    15    26    13    23    13    23    10    20     9    18     8    16     8     9     7     8     7     7     7     7     7     7     6     7     4     4
  5   1   2  SIG                                      Xt7.1-XZT33734.5                            GCCCGCATACGGCTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGT
  5   1   2  SIG                                    Xt7.1-TGas135i20.3                             CCCGCATACGGCTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTTAATTTGCCATGGCAATAAAATAGAAATGTTCT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-------
                                               BLH ATG      62     469                                  
                                               BLH MIN      35      76                                  
                                               BLH MPR      32      76                                  
                                               BLH OVR      62      32                                  
                                               EST CLI      -6      15                                  
                                               ORF LNG      62       1                                  
                                                                                                                                                             PROTEIN --- Sc ---- 5e-019     NP_015353.1 Ypt Interacting Protein. Regulates vesicular traffic in stressed cells either tofacilitate membrane turnover or to decrease unnecessary secretion.; Yop1p[Saccharomyces cerevisiae] ========================================================================================================================================================================================================================================================================================================
                                                                                                                                        PROTEIN === Ce ==== 7e-035     NP_491033.1 polyposis locus protein 1 (20.6 kD) (1D299) [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                           PROTEIN --- Dm ---- 2e-042     NP_610936.2 CG8331-PA [Drosophila melanogaster] --=================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                      PREDICTED = Sp ==== 4e-048     XP_780122.1 PREDICTED: similar to Polyposis locus protein 1 (TB2 protein) isoform 1 [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                PREDICTED = Gg ==== 1e-060     XP_424848.2 PREDICTED: hypothetical protein [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                      PROTEIN === Mm ==== 1e-062     NP_647453.1 polyposis locus protein 1-like 1; deleted in polyposis 1-like 1; TB2protein-like 1 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                      PROTEIN === Hs ==== 8e-063     NP_612402.1 polyposis locus protein 1-like 1; likely ortholog of mouse polyposis locusprotein 1-like 1 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                          PROTEIN --- Dr ---- 5e-064     NP_001004656.1 zgc:101529 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                      PROTEIN === Xt ==== 4e-100     CAJ83476.1 novel protein TB2/DP1, HVA22 family protein (ortholog of human chromosome 5 open reading frame 18, c5orf18) [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                      PROTEIN === Xl ==== 2e-102     AAI23301.1 Unknown (protein for MGC:154612) [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                      PREDICTED = ?? ==== 2e-102     NP_001088158.1 hypothetical protein LOC494868 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZT33734.5.5                                                   TAG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------ATGATG---------TGA---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------ATG---------------------------------------------------TAGTAA------TAA------ATG---------TAG
                                                                   ORF                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2  SIG                                      Xt7.1-XZT33734.5                            GCCCGCATACGGCTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGT
                                                  Xt7.1-CHK-1008289866                                  ATACGGCTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCT
  0   1   1           Egg  FL                     TEgg033k11.FL-Sanger                                 CATACGGCTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATCATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGTGATCCACTGACAGTAATTTTTTGATGCATGTATTTATTTTAAGTAATACCTCCTCTCTGTACCTCCTAAGAGACACAGATTACTCTCATTAAGGCTGTGCTTTTTGTCTTTTCATTGGTATGAATTAGGACTGATATTTCCTACTTTTAAAAGTAAAGAATTTTGTCAGAACAGATAAGTGAAATCTGGTCCACTGGAAACCCACCATATCTATTTTATAAATGTGCCTCTCTAAAATCATGATTGAAATGTAGTAACTTGGTAAAAGAGATTGAGAAAAAACATCCATTAAGTTCAACCTTTTTGCCTAAGTGAAACCCTGCCAAACTGGTCAATGATTCAGATAAAAATAACAGTAAAATATCTGCAGCCTTTCCAAGTACCTTGATGGCCATTCCTTCTACTGGCTGGCCCTTCTTGCTACAGTTTCTACGTGTCTAAATTAATCTAATTTAGAGTATAAGTGGCTTGCATATTTTTTTTCCCCAAAATACAAAATCAGTCCTGAATTTCATCTGCATAGTCTTCCAGTTTGTCCAAATCTCCCTGCAAGGATACATAGTTTTGTGTCATCTGCAAGCATTGATACATCAATTTTAAAGGAGAACTAAAGCTTAACTAAAGAAATCAGCTAGAAATGTTGTACATTATATTTCTGGCTTCTGACATTGCCCAAGGCAACCACAGCCCTTTAGCAAGGAAGATCTATGCCTCCAAAGATGCCCCCAGTAGCTCCCCATCTTTCCTGTTTATTCCCTGCACATGCTTTGTGCTGCTGTCAGTTACTTAGCTTAGGGGAGGACTCACAATATACTGTACATATATAGAATATAAATGTAACAGTATAAGGCTGACTAGTAATTCATTCGGATTCACATGACATGGCAGCTCGGGAATCGGTGCAATTAGCATCAGAATTTAAGCATCAGTTTATATGACAGGCCAGCCTCATTTTTAGCTTGATAATTTGCAACAACCCCTAAGCTTTGCTTCTCAACAGAGCACACTGAGCATGAGCAGTGTCACTGAACAGAATTCAAGAAAAGGCCTGTGACAACTGTAAAGACCTATATAATTAGTGCTATAGAGATAGTGAAACTTGTGGCTAGTGCAGTCAGTTTAGATTACAAAATATGGCATTTCTAGCCATTTTATATCTTAGGGTTTAGTTCTCCTTTAATGCACCCCAAGTCATTAATGAACAAGTTAAATTAATTAAAAGTTATGACCATAACAGAACCCTGCAACACCTCACTAAGAGCCCTTCTCCAAGTAAAGGATGTTTTATTGACTACCATTTTTAGTACACGTTCCTTATAGGGGACCTATCACGAAAATTAAAATTTAATATAAGCTTAATTTCACTGAAATAAAAAAACCTTCTAAATATAACCAGTTAAATACTCTGACCAATTTCTTGTTTCGGTGAGATAAAGCTTATATTACATTTTCTTTTTTGTAATGTTGTTTGTATGTGGATAGTAAACAGGCTTAAAGGAATACTGTCATGATTTTTATGGTGTACTTTTTATTTCTAAATTGCATTGTTTACATAGCAAATAATTCACTCTACCATTTACAATTTTATTCTTGAACCAAAAAATGAATTATTTTTTAGTTGTAATATTGGTGTATAGGCAGCCATCTCAGTGCATTGTGCCTGATTCTGAGCTTTCAGAAGGAGCCAGCACTACACATTAGAACTGCTTTCAGGCAACCTATTCTTTTTCCTACTCCCATGTAACTGGAGGAGTCCCAAGCCGGACTTTGATTTCTTACAATTGAGTGCTATTCTGATATCTACTGGGAGCTGCTACCTTCCCATTGTTCTGCTGATCGGCTTCTGACGGGGAGGGGGGTGATATCACTCCAACTTGCAGCTCGGCAGTAAAGTGTGACTGAAGTTTATCAGAGCACAGGTAACATGCCTGTGGCACCCTGGGGAAATGAAGAATATGGCTAGCGCCATGTGAAATTTCAAAATTAAATATAAAAAATTCTGTTTGTTTTTTAAAAAATAGATTTCAATGCAGGATTCTGCTGGATAAGTTCTATTTACTGATGCTTTTTATAAATCCGGTTTCCCTATGACCGTATTCCTTTAAAGGGAGCATATATAAACAGACCTTAAAAAGCAAATATCTGTGTGGGACTGTATCAAAAACTTTGGCAACGCCTGTGAGTATTCTGTTATGAGCACTAACCAATATGAAATGCATTTATTTGACATATATGTGTTCACAAATATACTGTGGTGACATTTTTGAAAAACAAACAAACAAAAAAAAAAAAAAAAAA
  5   1   2   32  ext Tad5 5g                              XZT19780.5p .........CTGCAGTCCAGCCGGTGCGCCCGCATACGGCTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTTCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGC
  5   1   3        nb Egg  5g                        TEgg116h23.p1kSP6                            GCCCGCATACGGCTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTTCGC
  5   1   2   12  ext Gas7 5g3  in                         XZG21364.5p ...........................GCCAGCATACGGCTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGC
  5   1   2       ext Te5  5g3  in                        CAAO12935.5p                              CCGCATACGGCTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTTCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTNCATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATT
  5   1   3        nb Egg  FL   ?                    TEgg033k11.p1kSP6                                 TCCTGCCTCATACCCTGTAGATGATCTGTTTGTCCCCCATACCTGGACCTTGCTCCATAACCATGCCTTCTATCTAGGAGCGCCTCCATAACTTTCTGAATGGAGATACTTCGTATCCCGAGTTATTGGGGAAGGCTGATGAGACTTCTGGGATCAAAACGTATTATCTTGCTTCCGGTTCCACTCTGCTCCCTACGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTGTGCCATCTGATTGGCTCTGCGTACCCTGCCTAT
  5   1   4      seed HeRe 5g3  in                      EC2BAA1AG10.g1                                          GAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGC
  5   1   3        nb HeRe 5g3  in                      EC2CAA1AG10.g1                                          GAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGCTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGCGTCCCCAAGTGTAACAATGATGTTATCT
  5   1   3        nb HeRe 5g3  in                     EC2CAA44BC03.g1                                                   GAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCC
  5   1   3        nb HeRe 5g3  in                     EC2CAA27CH06.g1                                                                GGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAAGACAAGCTCTAAAC
  5   1   2   12  ext Tad5 5g3  in                         XZT33734.5p ...................................................................................TGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTTCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGC
  5   1   2       ext Ova1      in                         CABE1542.5p                                                                                                    CTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTTCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCCTCAAAAC
  5   1   3        nb Tad5      in                         XZT50759.5p                                                                                                                   CGGACGCGTGGGTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTTCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGT
  3   1   4      seed HeRe 5g3  in                      EC2BAA1AG10.b1                                                                                                                         AGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTATACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATT
  3   1   3        nb HeRe 5g3  in                      EC2CAA1AG10.b1                                                                                                                                   GAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGC
  5   1   2       add HdA       in                   THdA005m04.p1kSP6                                                                                                                                          AGAAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATCATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAAACTCAAAAC
  3   1   2       ext Ova1      in                         CABE1542.3p                                                                                                                                                        CCCGGTTATGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTGCTTCGGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTTCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGG
  5   1   3        nb TbA       in                   TTbA032k07.p1kSP6                                                                                                                                                                    GCTGAGCGAGAAAACTGTGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGATATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCACATAAAAAAGATGACACAATATGTGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGAGCGAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCGTCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAAGCTCTAAACACACGCTGAATCTGTCACTAGAGGAGCATTCAAAGGATCAGTAACCCTGTCTTTCTAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATCATGTTATCTATTTGAGACTTTATAAGCCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGGTCTGATGTTTATTTATTACCTCT
  3   1   2       ext Ova1      in                         CABE6317.3p                                                                                                                                                                                                                     TCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGG
  5   1   2       ext Ova1      in                         CABE6317.5p                                                                                                                                                                                                                     TCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGTGAAAAAAAAAAAAAAAAAAC
  3   1   2       ext Tad5 5g3  in                         XZT33734.3p                                                                                                                                                                                                                      CCATCTGCTCCTAGGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTTCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGTG
  5  -1   2       add Tad0                               IMAGE:6984704                                                                                                                                                                                                                                                                                    TGATTGGCTTTTGTACCCAGCCTATGTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATCATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTAAAAAAAAAAAAAAAAGGGCGATCCCGG
  3   1   3        nb HeRe 5g3  in                     EC2CAA27CH06.b1                                                                                                                                                                                                                                                                                               GTACCCAGCTTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTGCC
  3   1   3        nb Tad5      in                         XZT50759.3p                                                                                                                                                                                                                                                                                                TACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTTCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGTG
  3   1   2       ext Gas7 5g3  in                         XZG21364.3p                                                                                                                                                                                                                                                                                                                                        ATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTTCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGTGAAGG
  3   1   2       add HdA       in                    THdA005m04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                        CATTTTATTATCTGGGCAAGTGATGCCTTTTATTTAGGTGTACGGCTCCAATTTTATGGAATGGCTCTCAGATTATATATGACCGGTTTATTCGCCCATTTTTTCTGAAGCACCATTGAAAGGTGGACAGGGTTGTTAGTGACCTTGGAGGACAGGCTTTAAACACAGGTGAATTTGTCACTAGAGGGGCATTTAAAGGAGCAGTAACCCAGTTTTTTGGGAATTAAAAGTTCAAATGATTGGACTTTTCCGCTCTTTACAAGGGGTCCCCAAGTGTAACAATCATGTTATTTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGGTTTTACAGCAGGATTTTTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAAATTTATTTTTTTTTAGACAGCAGCAAATTGTTCCCAGGTTTACAGTAGCACTTGTTTTGATGTTTATTTATTACCTTTGTAAAACAAGCAAACCTCAAAAATCCTTTCAAAAATAGTAAATTGGTTAATTTGCCATGGCAAAAAAATAGAAAAGTTTTTTCTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb HeRe 5g3  in                     EC2CAA44BC03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTGCCATGGCAATAAA
  3   1   3        nb TbA       in                    TTbA032k07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTTCATGGAATGGCTCTCAGATTATATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCCCCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTTTAAACACAGGTGAATTTGTCGCTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGAGTTGTCCGCTCTTTACAAGGTGTCCCCAAGGGTAACAATCATGTTTTTTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGTTTCTACAGCAGGATTTTTGCAAAATTCAACCCACACCCTAAGTCCTTTTACATCGTGTAAATATGTGCTAGCTGTAGATCAAGCATCAACTTCATTTTTTTTCAGACAGCAGCAACTTGTTTCCAGGTGTACAGTAGCACTTGTTTTGAGGGTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAAATAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAA
  3   1   2       ext Te5  5g3  in                        CAAO12935.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTTGGAGGACAGGCTGTAAACACAGCTGAATCTGTCACTAGAGGAGCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGAGTTCTTCGCTCTTTTCAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTGTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCTA
  5   1   2  SIG                                    Xt7.1-TGas135i20.3                             CCCGCATACGGCTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTG
                                                  Xt7.1-CHK-1008289868                                   TACGGCTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGTGATCC
  0   1   1           Ova1 FL                          CABE6639.FL-MGC                                                             GTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTTTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGTGAAAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas053h05.FL-Sanger                                                              TTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGTGATCCATTGACAGTAATTTTTTGATGCATGTATTTATTTTAAGTAATACCTCCTCTCTGTACCTCCTAAGAGACACAGATTACTCTCATTAAGGCTGTGTTTTTTGTCTTTTCATTAAAAAAAAAAAAAAAAAA
  5   1   4   12 seed Gas7 5g3  in                         XZG41148.5p CGGACGCGTGGGCGGACGCGTGGGTGCGCCCGCATACGGCTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTG
  5   1   3        nb Gas  5g3  in                   TGas135i20.p1kSP6                             CCCGCATACGGCTCAGACCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGA
  5   1   0       chi Te3  5x3  in                        CAAM14486.5p                                              CCCTGTAGATTATCTGTTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTGTATGTAAACAAACTAGCAAGAGGAGGAGAGCTCAGCTTGAGCTTATAGTTGTTTTTTGTGTTAGGTTTTGCTCACTGTGTTGATGAAAGGGGCATAATTATCANAGGGGTTCAGTACAGATCACTGCAGGCATATTTCATTACTCATTTTCTCTTGTACAGGATTTTTTAGGGGCCTAAGAATGAACTCATACATTTTGCCTCTGATAAACA
  5   1   2       ext Ova1 FL   in                         CABE6639.5p                                                      CCGAGGGTTTGTCCCCAGTACCTGGACCTTGCTCNCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTTTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTT
  5   1   2       ext Gas  FL   in                   TGas053h05.p1cSP6                                                              TTTGTCCCCAGTACCTGGACCTTGCTCCATAGCCATGCCTTCTATCAAGGAGCGCCTCCAGAACTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTG
  5   1   3        nb Ova1      in                         CABE4739.5p                                                                                                                             CTTTCTGAATGGAGACAACTTCGTATCCCGGTTATTGGGGAAGGCTGAGGAGAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGNCAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGT
  3   1   3        nb Gas  5g3  in                    TGas135i20.q1kT7                                                                                                                                                                                GAAAACTGGGATCAAAAAGTATTATCTTGCTTCGGGTTCCATCTGCTCCCTAGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTTCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7      in                         XZG24099.5p                                                                                                                                                                                                                                                              CCCTATTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATCATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTC
  3   1   3        nb Ova1      in                         CABE4739.3p                                                                                                                                                                                                                                                                        GTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTAAAAGCTATGAAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGTG
  5   1   2       ext Ova1      in                         CABE1420.5p                                                                                                                                                                                                                                                                          CTGCAATCTGATTGGCTTTGTGTACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGATATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGTGATCCATGAAAAAAAAAAAAAAAAA
  3   1   2       ext Ova1      in                         CABE1420.3p                                                                                                                                                                                                                                                                                                TACCCAGCCTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACATNATGGCTGATATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGTGATCCATTG
  3   1   0       chi Te3  5x3  in                        CAAM14486.3p                                                                                                                                                                                                                                                                                                        CTATGTTTCGGTTAAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTGTATGTAAACAAACTAGCAAGAGGAGGAGAGCTCAGCTTGAGCTTATAGTTGTTTTTTGTGTTAGGTTTTGCTCACTGTGTTGATGAAAGGGGCATAATTATCAAAGGGTTCCAGTACAGATCACTGCAGGCATATTTCATTACTCATTTTCTCTTGTACAGGATTTTTTAGGGGCCTAAGATTGAACTCATACATTTTGCCTCTGATAAACAGGCCCTGAATAATCCTACACAATTAAATATAATGATATGAACTTTGTCACTGGTGAACTATGGTAAGCATTGTTGCACCATTTGATAAATATATCCGAACGAGTCAAAGATTAAAAAAAAACCAGGATGGTATCTTGCACTCTGGTCAGAATGAAAGGAAATTAG
  3   1   2       ext Ova1 FL   in                         CABE6639.3p                                                                                                                                                                                                                                                                                                                     AAAGCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCGTACTGG
  3   1   3        nb Gas7      in                         XZG24099.3p                                                                                                                                                                                                                                                                                                                        GCTATTGAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATCATGTTATCTATTTGAGACTTTATAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTACATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTACAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAACCAAAAG
  3   1   2       ext Gas  FL   in                    TGas053h05.q1kT7                                                                                                                                                                                                                                                                                                                             GAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGTGATCCATTGACAGTAATTTTTTGATGCATGTATTTATTTTAAGTAATACCTCCTCTCTGTACCTCCTAAGAGACACAGATTACTCTCATTAAGGCTGTGTTTTTTTCTTTTCATAAAAAAAAAAAAAAAAA
  3   1   4      seed Gas7 5g3  in                         XZG41148.3p                                                                                                                                                                                                                                                                                                                              GAAAGCCCAGATAAAAAAGATGACACAATATGGCTGACATACTGGGTGGTATATGGCGTGTTCAGTGTAGTGGAATTTTTCTCTGACATATTTCTCTTCTGGTTTCCATTTTACTACCTGGGCAAGTGTTGCTTCTTACTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGACCGGTTCATCCGCCCATTTTTCCTGAAGCACCATCGAACGGTGGACAGCGTTGTTAGTGACCTTGGAGGACAGGCTCTAAACACAGCTGAATCTGTCACTAGAGGAGTCCTGCATACCTTGACCAGCAGCAGAACCCTTCTGGCACGTGAGGGAGGCCAGCAAGCTCTCCCCAGCACCTCTCATTCAAAGGAGCAGTAACCCAGTCTTTCGAGAATCAAAAGTTCAAATGATTGGACTTCTCCGCTCTTTACAAGGTGTCCCCAAGTGTAACAATGATGTTATCTATTTGAGACTTTCTAAACCTGGCATTATTCAATCCTAAGTGCTTCTACAGCAGGATTTCTGCAAAATTCAACCCACACCCTATGTCCTTTTATATTGTGTATATATGTGCTAGCTGTAGATCAAGCATCAACTTCATCTTTTCTCAGACAGCAGCAACTTGTTCCCAGGTCTATAGTAGCACTTGTTCTGATGTTTATTTATTACCTCTGTAAAACAAGCAAACCTCAAAACTCCATTCAAAACTAGTAAATTGGTTAATTTGCCATGGCAATAAAATAGAAATGTTCTTACTGTGAAAAAAAAAAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)